ID: 1105306408

View in Genome Browser
Species Human (GRCh38)
Location 13:19172111-19172133
Sequence GTGAGACTCTGGCGGTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105306405_1105306408 -6 Left 1105306405 13:19172094-19172116 CCGTGGTCTTTATCTGAGTGAGA 0: 1
1: 0
2: 2
3: 23
4: 207
Right 1105306408 13:19172111-19172133 GTGAGACTCTGGCGGTCAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 174
1105306404_1105306408 -5 Left 1105306404 13:19172093-19172115 CCCGTGGTCTTTATCTGAGTGAG 0: 1
1: 0
2: 0
3: 14
4: 154
Right 1105306408 13:19172111-19172133 GTGAGACTCTGGCGGTCAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105306408 Original CRISPR GTGAGACTCTGGCGGTCAGA AGG Intergenic
900036104 1:410455-410477 CTGAGACTCTTGCAGTCACACGG + Intergenic
900057728 1:646207-646229 CTGAGACTCTTGCAGTCACACGG + Intergenic
902592052 1:17482134-17482156 GTGAGTCTCAGGAGGTCTGATGG + Intergenic
903815196 1:26059746-26059768 GTGAGACTGTTGAGGGCAGAAGG - Intronic
906655407 1:47544746-47544768 GTGAGCCGCTGGAGATCAGAGGG - Intergenic
908043723 1:60145201-60145223 GGAAGACTCTGGCAGTCAGTAGG - Intergenic
912459955 1:109823954-109823976 GGGTGACCCTGGGGGTCAGAGGG - Intergenic
915294159 1:154908470-154908492 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
915441808 1:155950276-155950298 GTGAGACCCTGGCGGAGACATGG - Intronic
917129733 1:171728877-171728899 GACAGACACTGGCAGTCAGAAGG - Intronic
921976564 1:221209152-221209174 GTGAGACTTTGGACGTGAGATGG - Intergenic
923669689 1:236029797-236029819 GTGAGCCTGGGGCGGGCAGAAGG - Intronic
924339839 1:243018800-243018822 CTGAGACTCTTGCAGTCACATGG + Intergenic
1063720371 10:8574447-8574469 GGGAGACTCTGGCTGTCATGTGG + Intergenic
1069063779 10:63921477-63921499 GTGAGACCCTGGGAGTCAGGAGG + Intergenic
1071345041 10:84684650-84684672 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
1074392011 10:113065799-113065821 GTGAGGCTCAGGTGGTCTGAGGG + Intronic
1076152606 10:128174871-128174893 GTGAGAATGTGGGGGTCAAAAGG + Intergenic
1076843087 10:133056194-133056216 GAGAGAGTCTGCCGGTCTGACGG - Intergenic
1077908877 11:6557500-6557522 TTGAGACTCTGGCGACCTGAAGG - Exonic
1077955357 11:7013533-7013555 GTGAGAATGTGGAGGTCAAAAGG - Intronic
1079255202 11:18821906-18821928 GTGAGAATGTGGAGGTCAAAAGG + Intergenic
1080864425 11:36180725-36180747 GGGAGACTCTGGCTGTAATAAGG + Intronic
1082011504 11:47452832-47452854 GGGACGCTCTGGGGGTCAGAAGG + Intergenic
1084449038 11:69221842-69221864 GGGAGACTGAGGCGGGCAGATGG - Intergenic
1086532610 11:87803498-87803520 ATGAGAATCTGGGGGACAGATGG - Intergenic
1086748110 11:90455719-90455741 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
1088931662 11:114357563-114357585 GTGAGAATTTGGAGGTCAAAAGG - Intergenic
1089821952 11:121236726-121236748 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
1090456601 11:126855643-126855665 GTGAGGCTCTGGCAGCCAGATGG + Intronic
1090632600 11:128663151-128663173 GTGAGACTGTGGGGCACAGAAGG - Intergenic
1091947117 12:4556874-4556896 GTCAGACTGTGGAGGTCAGCAGG - Intronic
1091999307 12:5019475-5019497 GTGAGCCTCTGGAGGGCAGGGGG - Intergenic
1093302332 12:17472407-17472429 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
1093348826 12:18071656-18071678 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
1093780870 12:23135866-23135888 GTGAGAGTGTGGCTGTTAGAGGG + Intergenic
1094401382 12:30064117-30064139 GTGAAAATGTGGCGGTCAAAAGG - Intergenic
1099734994 12:86555732-86555754 GTGAGAATGTGGGGGTCAAAAGG - Intronic
1102105962 12:110323568-110323590 GGGAGACTGAGGCGGGCAGATGG + Intronic
1104442287 12:128803644-128803666 GTGAGATTCTAGCAGCCAGATGG - Intronic
1105306408 13:19172111-19172133 GTGAGACTCTGGCGGTCAGAAGG + Intergenic
1105862974 13:24433244-24433266 GTGAGAATGTGGAGGTCAAAAGG - Intronic
1106483513 13:30154293-30154315 GAGAGAATCTGGAGGTCAGGTGG - Intergenic
1106961641 13:35005396-35005418 GTGAGACTTTGGAGGAGAGAGGG + Intronic
1107312496 13:39094114-39094136 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
1109606473 13:64704525-64704547 GTGAGAATGTGGAGGTCAAAAGG + Intergenic
1109607049 13:64709258-64709280 GTGAGAATGTGGAGGTCAAAAGG + Intergenic
1109909776 13:68893753-68893775 GTGAGAATGTGGAGGTCAAAAGG + Intergenic
1112407849 13:99136748-99136770 GTGAGACTGTGCAGGTCAGAGGG - Intergenic
1114450107 14:22819816-22819838 GTGTGACTCTGGCCGGCAGCGGG + Intronic
1116790727 14:49337146-49337168 GTGAATCACTGACGGTCAGAAGG + Intergenic
1118331791 14:64821073-64821095 GTGTGATTCTGGCAGGCAGAAGG - Intronic
1118603716 14:67488229-67488251 CAGAGACCCTGGTGGTCAGAGGG - Intronic
1119328405 14:73776083-73776105 GTGAGACTCTTGGGGCCACAGGG - Intronic
1123095585 14:105765633-105765655 GTGAGCATCTGGCGGTCTGGAGG + Intergenic
1124785401 15:32674456-32674478 GTAAAACTTTGGGGGTCAGAAGG + Intronic
1126086829 15:45018901-45018923 GTGAGTCTCTGCAGGTGAGATGG + Intergenic
1127584018 15:60364826-60364848 GTGGGGCTTTGGCAGTCAGATGG + Intronic
1127946733 15:63763000-63763022 GTGAGAATGTGGAGGTCAAAAGG - Intronic
1132177212 15:99725351-99725373 GTGAGAATGTGGAGGTCAAAAGG - Intronic
1132977029 16:2716056-2716078 GTGAGACTTTGGGGGGCAGCTGG - Intronic
1134146726 16:11770942-11770964 GAGAGACACTGGCTGTCTGAAGG + Exonic
1134155043 16:11836123-11836145 GTGAGAATGTGAAGGTCAGAAGG - Exonic
1135760790 16:25136560-25136582 GTGAGACTCTGACGGGTTGATGG - Intronic
1136450769 16:30353306-30353328 GTGAGACACTGGAGGCCAAATGG - Intronic
1139449006 16:67015526-67015548 GGGAGGCTGTGGCGGGCAGATGG + Intergenic
1141819090 16:86432678-86432700 GTGAGACTCTGGGATCCAGAGGG + Intergenic
1143226810 17:5312157-5312179 GTGAGACTCTGCCTCACAGAGGG - Intronic
1144193107 17:12864159-12864181 GCAAGACTCTGGTGGTCATATGG + Intronic
1147915390 17:43882504-43882526 GTTACACCCTGGAGGTCAGAGGG + Exonic
1148085363 17:44990593-44990615 GGGAGAAGCTGGGGGTCAGAGGG - Intergenic
1151755818 17:76074768-76074790 GTGCGACTCTGCCGGGCTGAAGG - Intronic
1152410201 17:80119202-80119224 GTGAGACCCCAGCGCTCAGAAGG - Intergenic
1153678592 18:7478369-7478391 GTGAGAGTGTGGCCATCAGAAGG + Intergenic
1153854722 18:9135373-9135395 GGGAGGCTCAGGCGGGCAGATGG - Intergenic
1158614581 18:58974806-58974828 GTGAGCTTGTGGAGGTCAGAGGG - Intronic
1162311900 19:9913081-9913103 GTGAGACTCGGGGGTTTAGAAGG - Intronic
1162728111 19:12701862-12701884 GTGAGCAGCTGGAGGTCAGAGGG + Intronic
1163233185 19:16017352-16017374 GTGAGACGCCTGAGGTCAGAGGG + Intergenic
1163498982 19:17664318-17664340 GTGAAACTATGGGGCTCAGAGGG + Intronic
1164750004 19:30646545-30646567 GTGTGACTTTGCCGGTCAGTGGG + Intronic
1165602302 19:37065017-37065039 GTGAGAATGTGGAGGTCAAAAGG + Intronic
1165764043 19:38339121-38339143 GTGAGAATGTGGAGGTCAAAAGG + Intronic
1166660675 19:44644662-44644684 GTCAGACATTGGGGGTCAGAGGG - Intronic
1167554236 19:50183192-50183214 GTGAGACTCTGTCGGAAGGAAGG - Intergenic
1168340765 19:55621855-55621877 GGGAGACTCTGGAGGCCAGCTGG - Exonic
925675433 2:6356762-6356784 GGCAGACTCTGCAGGTCAGAAGG + Intergenic
928174672 2:29025676-29025698 GTGAGACTCTAGGGGACAAAAGG + Intronic
929012614 2:37460278-37460300 GTGAGAATTTGGAGGTGAGAGGG + Intergenic
931979740 2:67681837-67681859 GTGAGGCTGGGGAGGTCAGAAGG - Intergenic
932495112 2:72142285-72142307 GTGAGACCCTGGGGTGCAGAGGG - Intronic
933615287 2:84477201-84477223 GTGAGAATGTGGGGGTCAAAAGG + Intergenic
934158454 2:89225365-89225387 GTGAGAATGTGGAGGTCAAAAGG + Intergenic
934208817 2:89957062-89957084 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
934858027 2:97741013-97741035 GTGAGAATGTGGCTGTCAAAAGG + Intergenic
934972805 2:98776450-98776472 GTGAGACTCTGGGGGCAGGAGGG - Intergenic
935933245 2:108152882-108152904 GTTAGACTCTGCATGTCAGATGG - Intergenic
936047382 2:109197956-109197978 GTGAGGCCCAGGAGGTCAGAGGG + Intronic
936248409 2:110848502-110848524 GTGAGACTCTTGAGGGCCGAGGG + Intronic
938297903 2:130189814-130189836 GAGAGCCTCTGGTGGTCAGAAGG + Intronic
938458862 2:131484854-131484876 GAGAGCCTCTGGTGTTCAGAAGG - Intronic
941245028 2:163085738-163085760 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
941245036 2:163085811-163085833 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
942816143 2:180056704-180056726 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
945896604 2:215489670-215489692 GTGAGACACTGGAGGGCAGAAGG + Intergenic
947214704 2:227739517-227739539 GTGAGAATGTGGGGGTCAAAAGG - Intergenic
1172103122 20:32497634-32497656 GTTAGGCTGTGGCGGTCACAAGG + Intronic
1174014335 20:47475620-47475642 GTGAGACTCTGTTGGGCAAACGG + Intergenic
1175803362 20:61813643-61813665 CTCAGACTCTGGCTGTCGGAAGG + Intronic
1179097252 21:38326974-38326996 GTGGGACTCAGGAGGTCACATGG - Intergenic
1179123941 21:38575064-38575086 CTGAGGCTCTGGAGGTGAGAGGG - Intronic
1181181620 22:21072664-21072686 GGGATTCTCTGGTGGTCAGAAGG - Intergenic
1182454324 22:30440117-30440139 GTGCGGCTCTGGCAGTCAGCAGG + Intergenic
1184073445 22:42161336-42161358 GTGAGACTGTGGAGATGAGAAGG - Exonic
1184932739 22:47693197-47693219 GTGTGACCCAGGCGGTAAGAGGG + Intergenic
1184949213 22:47828093-47828115 GTGACAATCTTGAGGTCAGAGGG + Intergenic
950176353 3:10877575-10877597 CTGAGAGTCTGGAAGTCAGAGGG - Intronic
950777634 3:15364426-15364448 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
956846598 3:73189298-73189320 GTGAGACGCTGAGGCTCAGAGGG + Intergenic
960411620 3:117333609-117333631 GTGAGAATCTGGCGGTTTGCTGG + Intergenic
964773127 3:160245393-160245415 GTGAGAATGTGGGGGTCAAAAGG + Intronic
965825430 3:172724536-172724558 GTGAGAATGTGGCGGTCAAAAGG - Intergenic
966951068 3:184818290-184818312 GGGAGGCTGAGGCGGTCAGATGG + Intronic
968865022 4:3203358-3203380 GTCAGACCCTGAAGGTCAGAGGG + Intronic
976647676 4:87402288-87402310 GTGAGAATGTGGGGGTCAAAAGG + Intergenic
978038873 4:104033069-104033091 GTGAGACCCTGGAGAACAGATGG + Intergenic
978785126 4:112600822-112600844 GTGAGAATGTGGAGGTCAAAAGG - Intronic
979263017 4:118669779-118669801 CTGAGACTCTTGCAGTCACATGG - Intergenic
980070708 4:128240670-128240692 GTGGGGCTCTGGCAGTCTGAGGG + Intergenic
980301525 4:131001039-131001061 ATGAGATTCTAGAGGTCAGAAGG - Intergenic
983182312 4:164662841-164662863 GTGAGAGTGTGGAGGTCAAAAGG - Intergenic
985772377 5:1820918-1820940 GTGAGACTCTGGGGCCCTGAGGG + Intergenic
987684756 5:21182695-21182717 GTGAGAATGTGGAGGTCAAAAGG + Intergenic
988456810 5:31394069-31394091 GTGAGAATGTGGCGGTCAAAAGG + Intergenic
988457433 5:31398782-31398804 GTGAGAATGTGGCGGTCAAAAGG + Intergenic
988929482 5:36022456-36022478 GTGAGAATGTGGGGGTCAAAAGG + Intergenic
993843475 5:92909897-92909919 GTCAGACTCAGGCAGCCAGAGGG - Intergenic
994621632 5:102171257-102171279 GTGAGGATCAGGCTGTCAGAGGG + Intergenic
998178083 5:139914275-139914297 GTGGGAGTATGGCGGTCAGAAGG + Intronic
1001328425 5:170745765-170745787 CACAGACACTGGCGGTCAGAAGG + Intergenic
1001554394 5:172626145-172626167 GGGAGACCCTGGCGATCATAAGG + Intergenic
1002361370 5:178673891-178673913 GTGAGAATGTGGAGGTCAAAAGG + Intergenic
1002737717 5:181408409-181408431 CTGAGACTCTTGCAGTCACACGG - Intergenic
1003175361 6:3750030-3750052 GTGAGGCTCTGGGGAGCAGAGGG + Intronic
1004320511 6:14628203-14628225 GTGGGACTGGGGCGGTCGGAAGG - Intergenic
1007264508 6:40586694-40586716 GTGAAACTCTGGCGGGGAGCGGG - Intronic
1007344856 6:41221939-41221961 GAGACACTCTGGCTGTCACAGGG + Intergenic
1016316939 6:142800357-142800379 GTGGGACTCTAACTGTCAGATGG + Intronic
1016679231 6:146809022-146809044 GTGAGAATGTGGAGGTCAAAAGG + Intronic
1016679796 6:146815966-146815988 GTGAGAATGTGGAGGTCAAAAGG + Intergenic
1018153516 6:160963237-160963259 GTGAGACTCAGACGGTAGGAAGG - Intergenic
1018388245 6:163323608-163323630 GGGTAACTCTGGCTGTCAGAGGG - Intergenic
1019242815 6:170683966-170683988 CTGAGACTCTTGCAGTCACACGG - Intergenic
1020508391 7:9020936-9020958 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
1021043220 7:15889635-15889657 CTGGGAATCTGGAGGTCAGAAGG - Intergenic
1022454403 7:30545976-30545998 GTGAGAATGTGGAGGTCAAAAGG - Intronic
1023863203 7:44227396-44227418 GGGAGAGTCTGGGGGACAGAGGG + Intronic
1023910579 7:44552862-44552884 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
1027837465 7:83263756-83263778 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
1030443860 7:109624533-109624555 GTGAGAATGTGGCGGTCAAAAGG + Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1035505305 8:124189-124211 CTGAGACTCTTGCAGTCACACGG + Intergenic
1035628211 8:1089472-1089494 GAGAGACCCTGGGGGACAGACGG - Intergenic
1037219428 8:16499716-16499738 GTGAGAATGTGGAGGTCAAAAGG - Intronic
1038129829 8:24717663-24717685 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
1046027285 8:108740000-108740022 GTGAGAATGTGGGGGTCAAAAGG + Intronic
1048694795 8:137013404-137013426 GTGAGAATGTGGGGGTCAAAAGG + Intergenic
1050144860 9:2556245-2556267 GTGAGAATGTGGGGGTCAAAAGG + Intergenic
1051918086 9:22230973-22230995 GTGAGAATGTGGGGGTCAAAAGG + Intergenic
1052405790 9:28059248-28059270 GTGAGAATGTGGAGGTCAAAAGG - Intronic
1052529316 9:29659936-29659958 GTGAGAATGTGGAGGTCAAAAGG + Intergenic
1052538255 9:29775701-29775723 GTGAGAATGTGGAGGTCAAAAGG + Intergenic
1055468367 9:76587700-76587722 GTGAGTCTCTGGAGGTGAGGAGG + Intergenic
1056809026 9:89750114-89750136 ATGGGACTCTGGTGCTCAGATGG - Intergenic
1058119536 9:101123621-101123643 GTGAGAATGTGGAGGTCAAAGGG + Intronic
1058951838 9:109911114-109911136 GTCAGAGGCTGGAGGTCAGAAGG + Intronic
1061704729 9:132444234-132444256 GTGAGGCTAAGGCGCTCAGATGG + Intronic
1062009321 9:134258716-134258738 CTGACACTATGGTGGTCAGAGGG + Intergenic
1203603006 Un_KI270748v1:33190-33212 CTGAGACTCTTGCAGTCACACGG - Intergenic
1190118571 X:47641716-47641738 GTGAATCTGTGGGGGTCAGAGGG + Intronic
1197555591 X:127948685-127948707 GTGAGAATGTGGAGGTCAAAAGG - Intergenic
1199080144 X:143567895-143567917 ATGAGACTCTGGCTGTGAGCTGG - Intergenic
1202385079 Y:24318248-24318270 CTGAGACTCTTGCAGTCACACGG - Intergenic
1202485706 Y:25351880-25351902 CTGAGACTCTTGCAGTCACACGG + Intergenic