ID: 1105307206

View in Genome Browser
Species Human (GRCh38)
Location 13:19177313-19177335
Sequence ACGTGGGACGCTCGATGTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 4, 3: 2, 4: 16}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105307203_1105307206 2 Left 1105307203 13:19177288-19177310 CCAATCAGGCGATTGAGGTTGGT 0: 3
1: 0
2: 1
3: 2
4: 41
Right 1105307206 13:19177313-19177335 ACGTGGGACGCTCGATGTCCAGG 0: 1
1: 0
2: 4
3: 2
4: 16
1105307198_1105307206 25 Left 1105307198 13:19177265-19177287 CCGTGATGGAGGACACGATCTGC 0: 4
1: 0
2: 0
3: 2
4: 58
Right 1105307206 13:19177313-19177335 ACGTGGGACGCTCGATGTCCAGG 0: 1
1: 0
2: 4
3: 2
4: 16
1105307201_1105307206 3 Left 1105307201 13:19177287-19177309 CCCAATCAGGCGATTGAGGTTGG 0: 3
1: 0
2: 1
3: 7
4: 82
Right 1105307206 13:19177313-19177335 ACGTGGGACGCTCGATGTCCAGG 0: 1
1: 0
2: 4
3: 2
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105307206 Original CRISPR ACGTGGGACGCTCGATGTCC AGG Exonic
1081971781 11:47204177-47204199 AGGTGGGAGGATCGATGCCCAGG + Intergenic
1081973114 11:47213718-47213740 AGGTGGGAGGATCGATGTCCAGG + Intergenic
1083495360 11:63047430-63047452 AGGTTGGATGCTCGATGTCCAGG - Intergenic
1087992592 11:104763997-104764019 ACGTGGGAAGTTCAATGTCAAGG - Intergenic
1105307206 13:19177313-19177335 ACGTGGGACGCTCGATGTCCAGG + Exonic
1111097633 13:83535553-83535575 AGTTGGGCCGCTCGATGGCCCGG - Intergenic
1113878464 13:113608963-113608985 GTGTGAGACGCTAGATGTCCTGG - Intronic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1160511158 18:79454296-79454318 ACGTAGGAAGCTCATTGTCCAGG + Intronic
1161422892 19:4185340-4185362 AGGTGGGAGGATGGATGTCCAGG + Intronic
937332919 2:121043299-121043321 ATGTGGGATGGCCGATGTCCAGG - Intergenic
938298589 2:130194172-130194194 ACGTGGGACGTTCAATGTCCAGG + Exonic
938458142 2:131480341-131480363 ACGTGGGACGTTCAATGTCCAGG - Exonic
946366273 2:219251029-219251051 AGGTTGGGCGCTCGATGTCTAGG + Exonic
946369398 2:219271438-219271460 AGGTTGGGCGCTCGATGTCTAGG - Intronic
1181170874 22:21009161-21009183 ACATGGGACACTCGATGTCCAGG + Intergenic
1181180896 22:21067668-21067690 ACATGGGACACTCGATGTCCAGG - Intergenic
961417044 3:126766831-126766853 ATCTGGGACACCCGATGTCCAGG + Intronic
986709344 5:10477309-10477331 GTGTGGGGCGCTCCATGTCCTGG + Intergenic
1018317279 6:162569425-162569447 AGGTGGCAATCTCGATGTCCAGG - Intronic
1032916701 7:136498232-136498254 AAGTGGGAGGCTGGATGTCAGGG - Intergenic
1041248049 8:55907615-55907637 ACGTGGGTCTCTCAAAGTCCTGG - Intronic
1057943674 9:99306308-99306330 AGGTGGCAATCTCGATGTCCAGG - Intergenic