ID: 1105307255

View in Genome Browser
Species Human (GRCh38)
Location 13:19177592-19177614
Sequence CCCTCAGGCGGATCTGTGCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105307255_1105307260 7 Left 1105307255 13:19177592-19177614 CCGTGCACAGATCCGCCTGAGGG 0: 1
1: 0
2: 2
3: 10
4: 94
Right 1105307260 13:19177622-19177644 ACAACATGAATCAATGCCCGTGG 0: 1
1: 0
2: 0
3: 9
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105307255 Original CRISPR CCCTCAGGCGGATCTGTGCA CGG (reversed) Exonic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
902652030 1:17843422-17843444 AGCTCAGGCAGAGCTGTGCACGG - Intergenic
908263092 1:62353770-62353792 CACTCAGGAGGATGTGTGCACGG - Intergenic
908322988 1:62995989-62996011 GCCTCAGGCGGGACTCTGCAGGG - Intergenic
909592250 1:77363671-77363693 CCCTGAGGTGGAATTGTGCATGG - Intronic
913220222 1:116654236-116654258 CCCTCAGGAGCCTCTGTGCAGGG - Intronic
913563264 1:120044955-120044977 CCCTCAGTAGGATATGTGCTTGG + Intronic
913634859 1:120748632-120748654 CCCTCAGTAGGATATGTGCTTGG - Intergenic
914283859 1:146204313-146204335 CCCTCAGTAGGATATGTGCTTGG + Intronic
914544890 1:148655052-148655074 CCCTCAGTAGGATATGTGCTTGG + Intronic
914621680 1:149415634-149415656 CCCTCAGTAGGATATGTGCTTGG - Intergenic
920846035 1:209593766-209593788 CACTCTGGCTGATCTGTGAAGGG - Intronic
922153516 1:223023982-223024004 CCTTCAATAGGATCTGTGCAGGG + Intergenic
1063764014 10:9116661-9116683 CCATCAGACTGATCTGTGAAAGG + Intergenic
1064121864 10:12625694-12625716 CCCTCAGGGAAATCTGTGCAGGG + Intronic
1067204262 10:44199974-44199996 CCCTCCTGTGGAGCTGTGCATGG + Intergenic
1069712660 10:70499961-70499983 CACTCAGGTGGATCTGTACAGGG + Intronic
1070681660 10:78453222-78453244 CCCTGAGGATGATCAGTGCAAGG - Intergenic
1071568553 10:86684202-86684224 CCCTCAGGCCACTCAGTGCAAGG + Intronic
1072766405 10:98098243-98098265 CCCTCAGGCAGACCAGTGGAAGG + Intergenic
1074815884 10:117140478-117140500 CCCTCGGGCCGAGCTCTGCAGGG - Intergenic
1076133933 10:128031677-128031699 CCATCAGTCGGACCTGAGCAAGG + Intronic
1076851432 10:133095327-133095349 CCCTCAGGGGCCTCTGTCCAGGG + Intronic
1080635552 11:34120539-34120561 TCCTCAGCTGGATCTGTGCTGGG - Intronic
1083726951 11:64633517-64633539 CCCTCATGCGAAGCTCTGCATGG - Intronic
1085078947 11:73618012-73618034 CCCTCACACTCATCTGTGCAAGG - Intergenic
1085777850 11:79382508-79382530 TCCTGAGGCTGATCTCTGCAGGG - Intronic
1085953298 11:81359370-81359392 CCCTCAGGCTGCTCTGTCTATGG - Intergenic
1086568465 11:88254666-88254688 CCCCCAGGCTGGTGTGTGCATGG - Intergenic
1087065068 11:94020491-94020513 CCCTCAAGAGTAACTGTGCATGG + Intergenic
1087531356 11:99386335-99386357 CCCTCGGGCTGCTCTGTCCATGG - Intronic
1090330167 11:125925158-125925180 CCCCAAGGCGGAGCTGAGCACGG - Intergenic
1092056444 12:5511977-5511999 CCCCCAGGCAGCTGTGTGCATGG + Intronic
1105307255 13:19177592-19177614 CCCTCAGGCGGATCTGTGCACGG - Exonic
1112299112 13:98214028-98214050 CCCCCAGGCTGCTCTGTCCAGGG - Intronic
1113431446 13:110255127-110255149 CCTTCAGGCAGCCCTGTGCAGGG - Intronic
1114542827 14:23475249-23475271 GCCTCAGGAGGATCTCTTCAGGG + Exonic
1114576083 14:23715063-23715085 GCCCCAGGAGGAGCTGTGCATGG - Intergenic
1118776556 14:68977820-68977842 CCCCCAGGCTGATCTGGGAATGG - Intronic
1119781356 14:77278471-77278493 CCCTCCTGCGGCTCTGTGCCTGG - Exonic
1121435058 14:93913706-93913728 CCCAGAGGCTGCTCTGTGCAGGG + Intergenic
1123411751 15:20066607-20066629 CCCTCAGGCAGCTCTGGGAAAGG - Intergenic
1123521095 15:21073726-21073748 CCCTCAGGCAGCTCTGGGAAAGG - Intergenic
1124509020 15:30306541-30306563 CCCTGGGGAGGAGCTGTGCAGGG + Intergenic
1124734537 15:32232121-32232143 CCCTGGGGAGGAGCTGTGCAGGG - Intergenic
1126722837 15:51600333-51600355 CACTGAGGCATATCTGTGCAGGG - Intronic
1128058260 15:64716974-64716996 GCCTCAGGAGGATCTGGGGAAGG - Intergenic
1128127832 15:65205939-65205961 AGCTCAGGCTGATCTGAGCAAGG - Intronic
1129471912 15:75760777-75760799 CCATTAGGTGGATCAGTGCAGGG + Intergenic
1131571748 15:93544430-93544452 CACTCAGGCCGCACTGTGCATGG - Intergenic
1132677798 16:1127792-1127814 CCCTCAGGGGCATCTGTCCCAGG - Intergenic
1132756038 16:1485973-1485995 CTAGCAGGCGGATTTGTGCAGGG - Exonic
1138659020 16:58507065-58507087 CCCTCAGGGGGCAGTGTGCAAGG - Intronic
1140281308 16:73557461-73557483 CCCTCAGGCTGCTCTGTCTACGG - Intergenic
1142214143 16:88822573-88822595 CCCTCAGGTGAGTCGGTGCAGGG - Exonic
1148797673 17:50204882-50204904 CCCTCAACAGGAACTGTGCAGGG - Intergenic
1148963409 17:51412869-51412891 GACTCAGGCGGGTCTGTGAATGG + Intergenic
1153348339 18:4052246-4052268 CCCTCAGGAGAATCTTTGCTAGG - Intronic
1161422031 19:4181224-4181246 CCCTGAGGCGGGACTGTGCCTGG - Intronic
1164530809 19:29046797-29046819 CCATCAGGAGCATCTCTGCAGGG - Intergenic
1168506990 19:56944141-56944163 CCCTCATGAGGATCTGTTAAGGG + Intergenic
931563694 2:63590835-63590857 CCCTCAGGAGGGTGTGTGAATGG + Intronic
936070613 2:109368897-109368919 CCCTTAGGCTGATCTGAGCTGGG + Intronic
938065561 2:128280299-128280321 CCCTCAGGCGCAGCTCTCCAGGG + Intronic
948832371 2:240604309-240604331 CCCTCAAGCAGAGCTGTGCGAGG - Intronic
1169811496 20:9613354-9613376 CCCACAGGCAGAACTGTCCATGG + Intronic
1171460987 20:25297770-25297792 CCACCAGGAGGATCTGCGCACGG + Exonic
1172745927 20:37208880-37208902 CGCTCAGGAGGATATCTGCAGGG - Intronic
1180821522 22:18832255-18832277 CCCTCAGGAGCCTCTGTGCAGGG - Intergenic
1181170921 22:21009438-21009460 CTCTCAGGCAGATCTGTGCATGG - Intergenic
1181180849 22:21067409-21067431 CTCTCAGGCTGATCTGTGCATGG + Intergenic
1181191456 22:21143790-21143812 CCCTCAGGAGCCTCTGTGCAGGG + Intergenic
1181207742 22:21266720-21266742 CCCTCAGGAGCCTCTGTGCAGGG - Intergenic
1203219178 22_KI270731v1_random:28696-28718 CCCTCAGGAGCCTCTGTGCAGGG + Intergenic
1203271647 22_KI270734v1_random:58131-58153 CCCTCAGGAGCCTCTGTGCAGGG - Intergenic
950176400 3:10877891-10877913 CCCTCAGGGGCATGTGAGCAGGG + Intronic
953831394 3:46300605-46300627 CCCTCGGGCTGGTCTGAGCATGG - Intergenic
961561469 3:127733350-127733372 CCCTCAGGCTGCTCTGTCTATGG + Intronic
965299792 3:166995341-166995363 CCCTTAGGTAGACCTGTGCAAGG - Intergenic
968495311 4:912082-912104 CCCTCAGGGGGCTGTGCGCAGGG + Intronic
969303557 4:6311634-6311656 CCCTCGGGCTGCTCTGTCCATGG + Intergenic
969570778 4:8006858-8006880 CCCTCTGGGGGATTTTTGCAGGG + Intronic
973330182 4:48905041-48905063 CTTTCAGGAGGATCTGTGGAGGG + Intronic
976138779 4:81967394-81967416 CCCTCACCCTGAACTGTGCAAGG + Intronic
985588326 5:752082-752104 CCCTCAGGGGGCCCTGAGCATGG + Intronic
985654789 5:1124697-1124719 CCATCAAGGGCATCTGTGCAGGG + Intergenic
985699097 5:1359537-1359559 TCCTCAGGCGGTCCTGTGGAAGG + Intergenic
985704349 5:1391906-1391928 CCCTCAGGCAGTTCGGGGCAGGG + Intergenic
996738634 5:126778610-126778632 CCCTCGGGTGGTTCTGCGCAGGG + Intronic
1006260608 6:32866132-32866154 CCCTCAGCCATATCTGTGCTGGG - Intergenic
1018967793 6:168501931-168501953 CACTCTGGCAGCTCTGTGCAGGG + Intronic
1019037384 6:169072870-169072892 GCCTCAGCCGGATCTGTCAAAGG - Intergenic
1021912685 7:25401889-25401911 TCCTCAGGCTGCTGTGTGCATGG - Intergenic
1027906779 7:84195246-84195268 CCCTCAGGCGTGCCTGTGAAAGG + Intronic
1031783298 7:125997521-125997543 CCCACAGGCTGAACAGTGCATGG - Intergenic
1033414305 7:141148721-141148743 CCCTCAGTAGGATATGAGCAGGG - Intronic
1035053738 7:156019909-156019931 CCCTCAGTGGGGTCTGTGCCAGG - Intergenic
1038258983 8:25977163-25977185 CTATCAGGCAGCTCTGTGCAAGG + Intronic
1045438477 8:102187551-102187573 CTCTCAGGCTGTTCTGTGAATGG + Intergenic
1052521576 9:29554438-29554460 CCCTCAGGCTGCTCTGTCTATGG + Intergenic
1056773473 9:89496183-89496205 CACTCAGGGGGGTCTGTGCAAGG + Intronic
1059940037 9:119349757-119349779 CCAGCAGGGGGATCTGTGGAGGG + Intronic
1062174996 9:135156702-135156724 GCCTCAGTGGGATCTGTCCATGG + Intergenic
1198059053 X:133025441-133025463 CAGTCAGGCAGATCTGTACAAGG + Exonic
1201776979 Y:17676523-17676545 CACTCTGGAGGATCTGTGAAGGG - Intergenic
1201824578 Y:18229469-18229491 CACTCTGGAGGATCTGTGAAGGG + Intergenic