ID: 1105308065

View in Genome Browser
Species Human (GRCh38)
Location 13:19182713-19182735
Sequence TGGGCTGGGCGCAGTGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2763
Summary {0: 1, 1: 14, 2: 158, 3: 663, 4: 1927}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105308065 Original CRISPR TGGGCTGGGCGCAGTGCCTC AGG Intronic
Too many off-targets to display for this crispr