ID: 1105323261 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:19347219-19347241 |
| Sequence | GTGCGCGCACTTGGTGGGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 121 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 13, 4: 106} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1105323261_1105323267 | 26 | Left | 1105323261 | 13:19347219-19347241 | CCCTCCCCACCAAGTGCGCGCAC | 0: 1 1: 0 2: 1 3: 13 4: 106 |
||
| Right | 1105323267 | 13:19347268-19347290 | ACACTCTTATTCTGCCTCCCAGG | 0: 1 1: 0 2: 3 3: 114 4: 1793 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1105323261 | Original CRISPR | GTGCGCGCACTTGGTGGGGA GGG (reversed) | Intergenic | ||