ID: 1105323267

View in Genome Browser
Species Human (GRCh38)
Location 13:19347268-19347290
Sequence ACACTCTTATTCTGCCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1911
Summary {0: 1, 1: 0, 2: 3, 3: 114, 4: 1793}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105323264_1105323267 21 Left 1105323264 13:19347224-19347246 CCCACCAAGTGCGCGCACACACA 0: 1
1: 0
2: 2
3: 35
4: 226
Right 1105323267 13:19347268-19347290 ACACTCTTATTCTGCCTCCCAGG 0: 1
1: 0
2: 3
3: 114
4: 1793
1105323266_1105323267 17 Left 1105323266 13:19347228-19347250 CCAAGTGCGCGCACACACACACA 0: 1
1: 15
2: 63
3: 338
4: 1602
Right 1105323267 13:19347268-19347290 ACACTCTTATTCTGCCTCCCAGG 0: 1
1: 0
2: 3
3: 114
4: 1793
1105323263_1105323267 22 Left 1105323263 13:19347223-19347245 CCCCACCAAGTGCGCGCACACAC 0: 1
1: 0
2: 2
3: 22
4: 151
Right 1105323267 13:19347268-19347290 ACACTCTTATTCTGCCTCCCAGG 0: 1
1: 0
2: 3
3: 114
4: 1793
1105323261_1105323267 26 Left 1105323261 13:19347219-19347241 CCCTCCCCACCAAGTGCGCGCAC 0: 1
1: 0
2: 1
3: 13
4: 106
Right 1105323267 13:19347268-19347290 ACACTCTTATTCTGCCTCCCAGG 0: 1
1: 0
2: 3
3: 114
4: 1793
1105323259_1105323267 28 Left 1105323259 13:19347217-19347239 CCCCCTCCCCACCAAGTGCGCGC 0: 1
1: 1
2: 0
3: 14
4: 169
Right 1105323267 13:19347268-19347290 ACACTCTTATTCTGCCTCCCAGG 0: 1
1: 0
2: 3
3: 114
4: 1793
1105323260_1105323267 27 Left 1105323260 13:19347218-19347240 CCCCTCCCCACCAAGTGCGCGCA 0: 1
1: 0
2: 1
3: 22
4: 180
Right 1105323267 13:19347268-19347290 ACACTCTTATTCTGCCTCCCAGG 0: 1
1: 0
2: 3
3: 114
4: 1793
1105323262_1105323267 25 Left 1105323262 13:19347220-19347242 CCTCCCCACCAAGTGCGCGCACA 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1105323267 13:19347268-19347290 ACACTCTTATTCTGCCTCCCAGG 0: 1
1: 0
2: 3
3: 114
4: 1793
1105323265_1105323267 20 Left 1105323265 13:19347225-19347247 CCACCAAGTGCGCGCACACACAC 0: 1
1: 0
2: 7
3: 74
4: 370
Right 1105323267 13:19347268-19347290 ACACTCTTATTCTGCCTCCCAGG 0: 1
1: 0
2: 3
3: 114
4: 1793

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105323267 Original CRISPR ACACTCTTATTCTGCCTCCC AGG Intergenic