ID: 1105324009

View in Genome Browser
Species Human (GRCh38)
Location 13:19353796-19353818
Sequence AGTCTGTGTAGAGCACCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 120}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105324001_1105324009 10 Left 1105324001 13:19353763-19353785 CCCTCAGGGTGCCTTCCTCCCTT 0: 6
1: 0
2: 2
3: 28
4: 294
Right 1105324009 13:19353796-19353818 AGTCTGTGTAGAGCACCCCCTGG 0: 1
1: 1
2: 0
3: 15
4: 120
1105324003_1105324009 -1 Left 1105324003 13:19353774-19353796 CCTTCCTCCCTTAGCAAGCCCGA 0: 2
1: 4
2: 0
3: 9
4: 99
Right 1105324009 13:19353796-19353818 AGTCTGTGTAGAGCACCCCCTGG 0: 1
1: 1
2: 0
3: 15
4: 120
1105324005_1105324009 -8 Left 1105324005 13:19353781-19353803 CCCTTAGCAAGCCCGAGTCTGTG 0: 1
1: 5
2: 0
3: 7
4: 113
Right 1105324009 13:19353796-19353818 AGTCTGTGTAGAGCACCCCCTGG 0: 1
1: 1
2: 0
3: 15
4: 120
1105324006_1105324009 -9 Left 1105324006 13:19353782-19353804 CCTTAGCAAGCCCGAGTCTGTGT 0: 1
1: 4
2: 2
3: 6
4: 197
Right 1105324009 13:19353796-19353818 AGTCTGTGTAGAGCACCCCCTGG 0: 1
1: 1
2: 0
3: 15
4: 120
1105324000_1105324009 19 Left 1105324000 13:19353754-19353776 CCAGGACATCCCTCAGGGTGCCT 0: 6
1: 0
2: 3
3: 22
4: 212
Right 1105324009 13:19353796-19353818 AGTCTGTGTAGAGCACCCCCTGG 0: 1
1: 1
2: 0
3: 15
4: 120
1105324002_1105324009 9 Left 1105324002 13:19353764-19353786 CCTCAGGGTGCCTTCCTCCCTTA 0: 6
1: 0
2: 0
3: 19
4: 266
Right 1105324009 13:19353796-19353818 AGTCTGTGTAGAGCACCCCCTGG 0: 1
1: 1
2: 0
3: 15
4: 120
1105324004_1105324009 -5 Left 1105324004 13:19353778-19353800 CCTCCCTTAGCAAGCCCGAGTCT 0: 2
1: 4
2: 0
3: 20
4: 100
Right 1105324009 13:19353796-19353818 AGTCTGTGTAGAGCACCCCCTGG 0: 1
1: 1
2: 0
3: 15
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105324009 Original CRISPR AGTCTGTGTAGAGCACCCCC TGG Intergenic
908248659 1:62247736-62247758 AGTCTCTGATGAGCACACCCAGG - Intronic
912330745 1:108818100-108818122 AGTCTGTGAAGGGCACTGCCTGG + Intronic
915049136 1:153049351-153049373 AGTCTGACCTGAGCACCCCCTGG + Intergenic
917378431 1:174376934-174376956 TGTCTGTGTAGAAAACCCCAAGG + Intronic
917438342 1:175043920-175043942 AGTATGTGCAGAGCCCACCCGGG - Intergenic
919240658 1:194911993-194912015 AGTCTGTGTAGACAACCTCATGG - Intergenic
920365660 1:205447053-205447075 CGTCTGGGTACAGCACTCCCTGG + Intronic
924025798 1:239831709-239831731 TGTCTGGGTCAAGCACCCCCGGG - Intronic
1063096232 10:2911406-2911428 GGACTGTGTAGGGCTCCCCCAGG - Intergenic
1063673606 10:8119972-8119994 AGTGTTTGTAGAGCACTCTCAGG - Intergenic
1065332590 10:24617947-24617969 TGCCTGTGAAGAGCGCCCCCTGG - Intronic
1070673898 10:78398763-78398785 AGTCTGAATAGAGCAGCCCAGGG - Intergenic
1073773998 10:106766087-106766109 AGCCTGTGTGGAGGATCCCCAGG - Intronic
1074362565 10:112834881-112834903 GGCCTGTGTAGAGTACCCACCGG - Intergenic
1076468350 10:130701208-130701230 AGTCTGGGTGGTGCACCTCCAGG + Intergenic
1089255648 11:117192596-117192618 AGTCTGTGTAGAGCACGTGGAGG - Exonic
1089346244 11:117793568-117793590 GGTCTGTCCAGAGCACCCCATGG - Intronic
1089387951 11:118080115-118080137 ACTCTGTGTTGAGCACCTGCAGG - Intronic
1091723547 12:2830424-2830446 TGTCTGTGTAGAGCACACTGAGG + Intronic
1096823774 12:54258634-54258656 ATTCTCTGTTGAGTACCCCCTGG - Intronic
1096994640 12:55830965-55830987 TGTCGGTCAAGAGCACCCCCAGG - Intergenic
1100499409 12:95159236-95159258 AGTCTGTGTAATGCAGGCCCTGG - Intronic
1103570787 12:121843466-121843488 AGTCTCTGTAAAGCAGCCCCAGG + Intronic
1104165048 12:126219788-126219810 AGCCTGTGACGAGCAACCCCAGG - Intergenic
1105324009 13:19353796-19353818 AGTCTGTGTAGAGCACCCCCTGG + Intergenic
1105869970 13:24495965-24495987 AGTCTGTGTAGAGCACCCCTGGG - Intronic
1107658808 13:42618138-42618160 AATGTCTGTAGAGCACCTCCTGG + Intergenic
1107747800 13:43530374-43530396 AGACTCTGCAGATCACCCCCAGG - Intronic
1120851687 14:89177607-89177629 AGTCTCTCTATGGCACCCCCTGG - Intronic
1120932138 14:89859562-89859584 AGTCAGTGTGGAGAACCACCAGG + Intronic
1121688095 14:95854699-95854721 AGTCTCTGTAGAGCACCTTCAGG + Intergenic
1124715582 15:32058063-32058085 AGTCAGTGTAAATCACTCCCTGG - Intronic
1125505465 15:40265437-40265459 AGTGTGTGTGGAGGAGCCCCCGG + Intronic
1125764314 15:42123076-42123098 AATCTGTGTTGTGCACCACCTGG + Intergenic
1128091228 15:64920204-64920226 TCTCTGTGAAGAGCAACCCCAGG - Intronic
1128494894 15:68191894-68191916 AGTCCGTGAAGAGGAGCCCCAGG + Exonic
1132352568 15:101148982-101149004 AGGCAGTGCAGGGCACCCCCAGG - Intergenic
1132738289 16:1397991-1398013 ATTCTGTGAAGAACAGCCCCGGG - Intronic
1133281366 16:4667251-4667273 GGTCTTTCTAGAGCACCCCAGGG + Intronic
1134489777 16:14688039-14688061 AGTCTCTATAGACCACCCCTTGG - Intronic
1134495157 16:14727156-14727178 AGTCTCTATAGACCACCCCTTGG - Intronic
1134500542 16:14766276-14766298 AGTCTCTATAGACCACCCCTTGG - Intronic
1134527082 16:14952889-14952911 AGTCTCTATAGACCACCCCTTGG - Intergenic
1134545322 16:15103459-15103481 AGTCTCTATAGACCACCCCTTGG + Intronic
1134580040 16:15362774-15362796 AGTCTCTATAGACCACCCCTTGG + Intergenic
1134714668 16:16351422-16351444 AGTCTCTATAGACCACCCCTTGG - Intergenic
1134722544 16:16394786-16394808 AGTCTCTATAGACCACCCCTTGG - Intergenic
1134944884 16:18317083-18317105 AGTCTCTATAGACCACCCCTTGG + Intergenic
1134952148 16:18357236-18357258 AGTCTCTATAGACCACCCCTTGG + Intergenic
1135310490 16:21401298-21401320 AGTCTCTATAGACCACCCCTTGG + Intergenic
1135363436 16:21833726-21833748 AGTCTCTGTAGACCACCCCTTGG + Intergenic
1135448355 16:22537352-22537374 AGTCTCTATAGACCACCCCTTGG - Intergenic
1136307235 16:29380452-29380474 AGTCTCTGTAGACCACCCCTTGG + Intergenic
1136320760 16:29482695-29482717 AGTCTCTGTAGACCACCCCTTGG + Intergenic
1136435333 16:30222035-30222057 AGTCTCTGTAGACCACCCCTTGG + Intergenic
1140800490 16:78483553-78483575 AGTCTGCGTACAGCACCACTGGG - Intronic
1141289310 16:82703013-82703035 AGTGTTTGTAGAGCACTCACTGG - Intronic
1142049083 16:87946343-87946365 AGTCTGTGCAGTGGACTCCCGGG + Intergenic
1142307970 16:89295943-89295965 ACTCCCTGCAGAGCACCCCCAGG - Intronic
1145061534 17:19737340-19737362 AGTCTGTGTAGAGGACCCTGAGG + Intergenic
1145999512 17:29122832-29122854 GGTCCGGGTAGAGCACCCTCTGG - Intronic
1154116787 18:11618417-11618439 AGTCTCTATAGACCACCCCTTGG + Intergenic
1155150784 18:23121347-23121369 AGTCTGTGTTGAGCAGGCCCTGG - Intergenic
1158901551 18:61966552-61966574 ACTCTGTGTAGAGGACTCACAGG + Intergenic
1161941684 19:7408707-7408729 ACTCTATGTTGAACACCCCCAGG - Intronic
1163425224 19:17237082-17237104 ACTCTGTGTAGAGCAAACACCGG + Intronic
1165522741 19:36327589-36327611 AGTGTTTTTAGAGCACCTCCAGG - Intergenic
928308720 2:30192451-30192473 AGACAGTGTAGTGCACCCACAGG - Intergenic
928942219 2:36737842-36737864 AATCTGTGTGGAGAACCCACTGG - Intronic
931571074 2:63669819-63669841 GGTCTGTGAATAGCAACCCCAGG + Intronic
935367069 2:102305911-102305933 TGTCTGTGTGGAGCACTCTCTGG + Intergenic
936570702 2:113612048-113612070 AGCCTCAGAAGAGCACCCCCAGG - Intergenic
937385259 2:121424993-121425015 AATCTGTATAAAGCACACCCAGG + Intronic
941886335 2:170531329-170531351 AGTAGGTGTAGAAAACCCCCAGG - Intronic
945331562 2:208545755-208545777 AGACTGTGTAGAACACACCTTGG - Intronic
945671479 2:212807367-212807389 AGACTGTGTAGAGCATGCCTCGG - Intergenic
945761469 2:213920680-213920702 AGTCTGACTTGAGCACCCCTTGG - Intronic
945885806 2:215374328-215374350 AGTCTGTATAGAGTATCACCTGG - Intronic
1169547406 20:6664421-6664443 AGTCTGTGTAGAGGCCCACATGG - Intergenic
1172014127 20:31862908-31862930 CCTCTGTCTAGAGCATCCCCTGG + Intronic
1174951838 20:55050848-55050870 AGTCTGTGTAGATGAGCCCCTGG + Intergenic
1176051076 20:63120055-63120077 AGTCTGTGTGGAGGCCTCCCTGG - Intergenic
1178130011 21:29561738-29561760 AGTCTGTGGTGAGCACTCTCTGG + Exonic
1179506714 21:41845919-41845941 CGTTTGTGCAGAGCACGCCCCGG - Intronic
1181689480 22:24550603-24550625 GCTCTGTGTAGAGCCACCCCAGG + Intronic
1182848252 22:33449364-33449386 GGGCTGTGCAGAGCTCCCCCAGG + Intronic
1184380520 22:44142554-44142576 AGGCTGTGTATAGCACCCTGTGG + Intronic
951764173 3:26178770-26178792 ACTCTGTGCAGACAACCCCCAGG - Intergenic
954730702 3:52659060-52659082 AGACTTGGTAGAGCACCCCGTGG - Intronic
955328015 3:58024485-58024507 AGTCTGGAGAGACCACCCCCAGG - Intronic
962491960 3:135903207-135903229 ATTCTCTGGAGAACACCCCCAGG + Intergenic
962710557 3:138082139-138082161 CGTCTGAGCAGAGCACTCCCTGG + Intronic
963304420 3:143635208-143635230 AGTCTGTGGAGAGTTCCACCTGG - Intronic
965927718 3:174002724-174002746 AGTCATTCTATAGCACCCCCTGG + Intronic
967219411 3:187236238-187236260 AGTCTGGGTGGAGCACCACTCGG + Exonic
968744401 4:2352281-2352303 TGTCTGTGCTGAGCACCCCCAGG - Intronic
972696664 4:41453094-41453116 AGTCCTTCTAGAGCACCACCTGG - Intronic
975176836 4:71299414-71299436 GCTCTGTGTAGAGCTTCCCCAGG + Intronic
981508593 4:145530196-145530218 AGTCTGTGTAGGGCACACTGAGG + Intronic
985556457 5:560965-560987 GGTCTGTGTGGAGCGGCCCCCGG + Intergenic
985563164 5:602110-602132 GGTCTCTGGAGAGCACCGCCGGG + Intergenic
987175318 5:15302125-15302147 TGGCTGTGTAAAGTACCCCCAGG + Intergenic
990332602 5:54742512-54742534 CGTGTGGGTGGAGCACCCCCAGG - Intergenic
990451287 5:55933647-55933669 AGTCTGTGGACAGAACCACCTGG + Intergenic
993774032 5:91968760-91968782 AGTCTGTGTGGAGCACCACAGGG + Intergenic
998253683 5:140568962-140568984 ACTCTGTGCAGAGCTTCCCCAGG - Exonic
1001601661 5:172932868-172932890 TGTCTGTGTTGAGCACCCAGGGG - Intronic
1002461951 5:179378299-179378321 AGGCTGTGGTGAGCAGCCCCGGG - Intergenic
1009493743 6:64325249-64325271 ACTCTGTGCAGACAACCCCCTGG + Intronic
1010707701 6:79134687-79134709 ACTCTGTGCAGACAACCCCCAGG - Intergenic
1012497171 6:99846244-99846266 TGTCTGCCTAGAACACCCCCAGG - Intergenic
1017183786 6:151579567-151579589 AGGCTCTGTAGAGCACCCTCAGG + Intronic
1018652550 6:166004209-166004231 CTTCTGGGAAGAGCACCCCCAGG - Intergenic
1019152735 6:170019604-170019626 CGTCGGTGTAGAGCCCGCCCTGG - Intergenic
1020141716 7:5615380-5615402 AGTCTGTGGAGGGGACCCACTGG - Intergenic
1021781411 7:24110192-24110214 AGGCTGGGAAGAGCTCCCCCTGG - Intergenic
1024301379 7:47889996-47890018 AGTGGGTGTAGTGCAGCCCCCGG - Intronic
1025709175 7:63891514-63891536 ACCCTGGGTAGAGCACTCCCTGG - Intergenic
1025998592 7:66544024-66544046 AGTCTGGGGAGACCTCCCCCAGG - Intergenic
1029150866 7:98479490-98479512 CATCTATTTAGAGCACCCCCTGG + Intergenic
1030952775 7:115812825-115812847 AGTCTGTGTTTAGCATGCCCTGG + Intergenic
1031026863 7:116688935-116688957 AAACCGTTTAGAGCACCCCCTGG + Intronic
1032453138 7:132051921-132051943 AGTCTGTGTAGATCAGCACCAGG - Intergenic
1032470757 7:132177339-132177361 AGTTTGTGTAGAGGACGTCCTGG + Intronic
1034453105 7:151148433-151148455 AGTCTGGGAAGAGCACACCCAGG + Intergenic
1037975375 8:23207073-23207095 AGACTCTGGAGAGCACCCCCAGG + Intronic
1046794500 8:118356344-118356366 AGCCGGTGTAGGGCACCACCTGG + Intronic
1050069913 9:1799779-1799801 TGTCTATGTACAGCAACCCCTGG - Intergenic
1051596151 9:18826167-18826189 TGTCCCTGTAGAGCAGCCCCAGG + Intronic
1054455598 9:65428821-65428843 AAGCTGTGTAAAGGACCCCCAGG + Intergenic
1056769234 9:89464835-89464857 AGGGTGCGGAGAGCACCCCCAGG + Intronic
1057821101 9:98331718-98331740 AGGCTGTGCTGAGCACCTCCTGG + Intronic
1058651212 9:107177116-107177138 AGCCTGTGTGGAAAACCCCCTGG + Intergenic
1187176517 X:16900824-16900846 AGTCAGGGTAGAGCACCACAGGG - Intergenic
1190165769 X:48071721-48071743 AGGCTGGACAGAGCACCCCCCGG + Intergenic
1195431051 X:104789988-104790010 AGTCTGTGGACAGCTCCTCCTGG - Intronic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic