ID: 1105325154

View in Genome Browser
Species Human (GRCh38)
Location 13:19364174-19364196
Sequence CACCTCAGTCTCCTGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 718
Summary {0: 1, 1: 1, 2: 16, 3: 111, 4: 589}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105325154_1105325160 -2 Left 1105325154 13:19364174-19364196 CCCAGCCTCAGGAGACTGAGGTG 0: 1
1: 1
2: 16
3: 111
4: 589
Right 1105325160 13:19364195-19364217 TGGGAGGATTGCTTGAAGCCAGG 0: 207
1: 2845
2: 15665
3: 43873
4: 122020
1105325154_1105325162 7 Left 1105325154 13:19364174-19364196 CCCAGCCTCAGGAGACTGAGGTG 0: 1
1: 1
2: 16
3: 111
4: 589
Right 1105325162 13:19364204-19364226 TGCTTGAAGCCAGGAGGTTGAGG 0: 2
1: 325
2: 10247
3: 47503
4: 108808
1105325154_1105325161 1 Left 1105325154 13:19364174-19364196 CCCAGCCTCAGGAGACTGAGGTG 0: 1
1: 1
2: 16
3: 111
4: 589
Right 1105325161 13:19364198-19364220 GAGGATTGCTTGAAGCCAGGAGG 0: 19
1: 1174
2: 28246
3: 81583
4: 162176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105325154 Original CRISPR CACCTCAGTCTCCTGAGGCT GGG (reversed) Intergenic
900191111 1:1352645-1352667 AAACTCCGTCTCCTGGGGCTGGG - Intergenic
900919502 1:5661655-5661677 GACCTCAGCCTCCGGAGGCCCGG + Intergenic
901230549 1:7639655-7639677 CACTTCAGCCTCCTGAGGCTGGG - Intronic
901249060 1:7759033-7759055 CACCTCAGCCTCCAGTAGCTGGG - Intronic
901818779 1:11811998-11812020 CACCTCAGCCTCCTGAGTAGTGG - Intronic
902118978 1:14145328-14145350 CACCTCAGCCTCCTGAGAGCTGG - Intergenic
902140280 1:14347997-14348019 CACCTCAGCCTCCTGAGAGCTGG + Intergenic
902321368 1:15669418-15669440 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
902558932 1:17264893-17264915 CACTTCAGCCTCCTGAGGCTGGG - Intronic
902909243 1:19582952-19582974 CACCTCAGGCTCCTGAGTAGCGG - Intergenic
902985813 1:20153408-20153430 CACCCCTGTCTCCTGTTGCTAGG - Intergenic
903176490 1:21584580-21584602 CACCTCAGTCTCCTGAGTGCAGG - Intergenic
903477677 1:23631048-23631070 CACCTCAGCCTCCTGAGTCTGGG - Intronic
904027757 1:27515305-27515327 CACCTCAGCCTCCTGAGTAGAGG - Intergenic
904206299 1:28857580-28857602 CACCTCAGTCTCCTGAGTGATGG + Intronic
904438888 1:30516956-30516978 CACCTCAGCCTCCTGAGCAATGG - Intergenic
904562365 1:31407242-31407264 GAACTCTGTCACCTGAGGCTTGG - Intergenic
904766581 1:32853356-32853378 TGCCTCAGCCTCCTGAGGCTGGG - Intronic
905141561 1:35849571-35849593 CACCTCAGCCTCCTGAGTAGCGG - Intronic
905245382 1:36609630-36609652 CAGCACTGTCACCTGAGGCTTGG - Intergenic
905316455 1:37084551-37084573 CTCCACAGTCTCCTGCGGCTGGG - Intergenic
906324951 1:44839730-44839752 CACATCTGTGTCCTGGGGCTGGG + Intronic
906382010 1:45338877-45338899 CACCTCAGCCTCCTGTAGCTGGG + Intronic
906405840 1:45541236-45541258 CACCTCAGCCTCCTGACTATAGG - Intergenic
906465115 1:46071578-46071600 TGCCTCAGCCTCCTGAGTCTGGG - Intronic
906467750 1:46098948-46098970 CACCTCAGTCTCCCAGAGCTGGG + Intronic
906988565 1:50713044-50713066 CACCTCAGCCTCCTGTAGCTGGG - Intronic
907010902 1:50961779-50961801 CACCTCAGCCTCCTGAGAGTGGG + Intronic
907031880 1:51180500-51180522 CACCTCAGCCTCCTGAGTACTGG + Intergenic
907143583 1:52211589-52211611 GGCCTCAGCCTCCTGAGGCTGGG - Intronic
907177488 1:52538531-52538553 CACTTCAGCCTCCTGAGACTGGG - Intronic
907279716 1:53339640-53339662 CACCTCAGCCTCCCAAGGCTAGG + Intergenic
907409882 1:54276360-54276382 CACCTCAGCCTCCTCAGGCTGGG - Intronic
908228984 1:62085236-62085258 CACCTCAGCCTCCTAAGGAGTGG - Intronic
908375976 1:63541676-63541698 TACCTCAGCCTCCTGAGGCTGGG + Intronic
909959750 1:81825247-81825269 CACATCAGCCTCCTGAGAGTGGG - Intronic
911026375 1:93439943-93439965 CACCTCAGCCTCCTGAGCAGCGG + Intergenic
911199286 1:95028319-95028341 CACCTCAGCCTCCAGTAGCTGGG + Intronic
911704760 1:100998393-100998415 TGCCTCAGCCTCCTGAGGCTGGG - Intronic
912417618 1:109520807-109520829 CGCTTCAATCTCCTGAGTCTGGG + Intergenic
913498699 1:119451143-119451165 CACCTGAGTCTCCTAAGAGTGGG - Intergenic
914245287 1:145881169-145881191 TGCCTCAGTCTCCTGTAGCTGGG - Intronic
914417276 1:147495589-147495611 CACCTCTTTCTGCTGAGGCCAGG + Intergenic
914723360 1:150307469-150307491 CACCTCAGCCTCCTGAGTAGAGG + Intronic
915163757 1:153936915-153936937 CACCTCAGTCTCAAGTAGCTGGG + Intronic
915188551 1:154128369-154128391 CACCTCAGTCTCCTGAGTAATGG - Intronic
915385426 1:155487479-155487501 CACCTCAGCCTCCCAAGTCTGGG + Intronic
915388940 1:155523377-155523399 CACCTCAGTCTCCTGAGAGCTGG - Intronic
915835649 1:159172939-159172961 CTCCTCAGGGACCTGAGGCTCGG - Intronic
916004418 1:160646505-160646527 CAGCTCAGTCTCTCTAGGCTGGG + Intronic
916407130 1:164508723-164508745 CACCTCAGTCTCCTGAGTAGTGG + Intergenic
917083612 1:171282729-171282751 TACCTCAGTCTCCTGAGTAGTGG + Intronic
917157257 1:172016971-172016993 CACCTCAGCCTCCTGGGAATTGG + Intronic
917425073 1:174904761-174904783 TACCTCAGCCTCCTGAGTATTGG + Intronic
918190571 1:182170178-182170200 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
918270055 1:182889701-182889723 CACCTCAGTCTCCTAAGCAGTGG + Intergenic
918341702 1:183573141-183573163 CCCCTGAGTCTCCTGTGGCCCGG - Intronic
918578691 1:186098493-186098515 CACCTCACTCTAGTGAGGATGGG + Intronic
918607812 1:186450450-186450472 CACGTCAGTCTCCTGAGCGGCGG + Intronic
920422828 1:205847129-205847151 CACCTCAGCCTCCTGTAACTAGG + Intronic
920423628 1:205854608-205854630 CACCTCAGCCTCCTGTAACTAGG - Intergenic
922707476 1:227796900-227796922 CACCTCACCCTCCTGGGGTTGGG + Intergenic
922912396 1:229228592-229228614 CCCCTCAGTCTCCTGAAGCTGGG - Intergenic
924045819 1:240029516-240029538 AACCTCACTCTCCTGAGGCCTGG + Intronic
924401672 1:243689829-243689851 CACCTCAGCATCCTGAGTATTGG - Intronic
924489885 1:244526157-244526179 CACCTCAGCCTCCCAATGCTGGG - Intronic
924543599 1:245004489-245004511 CACCTCAGCCTCCTGAGTAGCGG + Intronic
924724522 1:246656814-246656836 CACCTTAGCCTCCTGTAGCTGGG - Intronic
924769720 1:247068200-247068222 TACCTCAGCCACCTGAGTCTGGG - Intronic
924818217 1:247461697-247461719 TACATAAGTCTTCTGAGGCTCGG + Intergenic
1063412801 10:5849673-5849695 CGCTTCAGTCTCCTGAAGCTGGG + Intergenic
1063565845 10:7171892-7171914 CACCTCTGTCCCCTCGGGCTTGG + Exonic
1063660210 10:8030318-8030340 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
1063708489 10:8454219-8454241 CACCTCAGTCTCTTGAGGCCAGG + Intergenic
1063766966 10:9153384-9153406 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1064112971 10:12554269-12554291 CGCCTCAGCCTCCCGAAGCTGGG + Intronic
1064202499 10:13296709-13296731 CACCTCAGCCTCCCAAAGCTAGG - Intronic
1064803224 10:19099874-19099896 TGCCTCAGCCTCCCGAGGCTGGG + Intronic
1065349081 10:24779396-24779418 CACCTCAGTCTCCTGAGTAGTGG - Intergenic
1065743911 10:28821481-28821503 CATATCAGTCTCCTGAGTCCTGG - Intergenic
1066532549 10:36356247-36356269 GGCCTCAGCCTCCTGAGTCTGGG - Intergenic
1066637614 10:37521835-37521857 CACCTCAGTCTCCTAAGAACTGG - Intergenic
1069123291 10:64596610-64596632 CAGCTCCATCTCCTAAGGCTGGG - Intergenic
1069620777 10:69836158-69836180 CTTCTCTGTCTCCTGAGGATGGG - Intronic
1069923691 10:71833342-71833364 CACCTCAGCCTCCTGAGTACTGG - Intronic
1069927526 10:71861207-71861229 CACCTAAGCCTCCTGTAGCTGGG - Intergenic
1070175231 10:73964352-73964374 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1070291360 10:75117306-75117328 CACCTCAGCCTCCTGAGTTCTGG - Intronic
1070293158 10:75134945-75134967 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1071528230 10:86370607-86370629 CACATCAGTGTCCTCCGGCTTGG - Intergenic
1072138294 10:92567855-92567877 CACCTCAGCCTCCTGTAGCTAGG - Intronic
1072542011 10:96405788-96405810 GACCTCACTCTCCTGAGGTGTGG + Intronic
1072593201 10:96846366-96846388 CACCTGAGCCTCCTGAGGCTGGG + Intronic
1072593624 10:96850598-96850620 CACCTCAGCCTCCTGAGTATGGG + Intronic
1073198727 10:101717303-101717325 CACCACAGCCTCCTGTAGCTGGG + Intergenic
1073480949 10:103785692-103785714 CCCCACAGTCTCCTGAGGAGGGG + Intronic
1073551784 10:104408984-104409006 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1073882231 10:107996419-107996441 CACCTCATCCTGCTGAGGTTGGG - Intergenic
1074100134 10:110348329-110348351 CACCTGGGTCTCCTGAGCTTAGG + Intergenic
1074559313 10:114520861-114520883 TGCCTCAGTCTCCTGAGTCCCGG - Intronic
1075392075 10:122099378-122099400 CTCCTCTGGCACCTGAGGCTGGG + Intronic
1075779039 10:125005229-125005251 CAGCCCATTCTTCTGAGGCTGGG - Intronic
1075921413 10:126216395-126216417 CAAGTCAGCCTGCTGAGGCTTGG + Intronic
1077057601 11:602564-602586 TGCCTCAGCCTCCTGAGGCTGGG - Intronic
1077822658 11:5765010-5765032 CACCTCAATATCATGATGCTAGG + Intronic
1079203796 11:18396374-18396396 CACCGCAGGCTCCTGTGCCTTGG + Exonic
1079239249 11:18710788-18710810 CACATCAGTCACTTGAGGCTGGG + Exonic
1079328754 11:19516769-19516791 GACCTGAGTTTCCAGAGGCTGGG + Intronic
1080735744 11:35012099-35012121 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1081674929 11:44963221-44963243 CACCTGAGTCTCCGGAGCCTTGG - Intergenic
1081833828 11:46137051-46137073 CACCACAGGCCCCCGAGGCTGGG - Intergenic
1081898445 11:46607147-46607169 TACCTCAGCCTCCTGTAGCTGGG - Intronic
1081926981 11:46838678-46838700 CACCTCAGCCTCTAGTGGCTGGG - Intronic
1083290437 11:61686912-61686934 CACCTCTGTCTCCTGGGGACAGG + Intronic
1083834726 11:65258596-65258618 CACCTCAGTCTCCTAAGTAGCGG - Intergenic
1084126324 11:67101460-67101482 CACCTCAGCCTCCTGAGTACTGG - Intergenic
1084458645 11:69284034-69284056 CACCCCAGTCTCCTGCGGAGTGG - Intergenic
1085132621 11:74054326-74054348 CATCTCAGTCTCCTGAGTAGCGG - Intronic
1085484806 11:76853342-76853364 CACCTCAGCCTCCAGAGTGTTGG - Intergenic
1086103455 11:83125809-83125831 CACCTCAGCCTCCTGAGTATTGG + Intergenic
1086356219 11:86002895-86002917 CACCTCAGCCTCCCAAGGGTGGG - Intronic
1086885838 11:92204778-92204800 CACTTCTCTGTCCTGAGGCTGGG + Intergenic
1087064786 11:94017925-94017947 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1087253329 11:95927904-95927926 TGCCTCAGTCTCCAGAAGCTGGG - Intergenic
1087766935 11:102165244-102165266 CACCTCAGCCTCCTGAGAACTGG - Intronic
1088518448 11:110665584-110665606 CAACTCTGTCTCCTCAAGCTGGG - Intronic
1088740510 11:112763230-112763252 AACCTCAGGCCACTGAGGCTGGG + Intergenic
1089050561 11:115541702-115541724 CACCACATTCTTCGGAGGCTTGG - Intergenic
1089651344 11:119915547-119915569 AGCCTCAGTCTCTTGAAGCTGGG - Intergenic
1089854679 11:121532797-121532819 TGCCTCAGCCTCCTGAGTCTGGG + Intronic
1090020957 11:123127921-123127943 TGCCTCAGCCTCCTGAGTCTGGG - Intronic
1090272823 11:125399837-125399859 CACCTCAGCCCCCTCAGGGTTGG + Intronic
1090274102 11:125407649-125407671 CACCTGAGCCTCCTGAGTCATGG - Intronic
1090387936 11:126367275-126367297 CAGCAGCGTCTCCTGAGGCTGGG + Intronic
1091454514 12:596806-596828 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1091682460 12:2536937-2536959 GACCTCACTCTTCTGTGGCTCGG - Intronic
1092393249 12:8100524-8100546 TGCCTCAGCCTCCTGAAGCTGGG + Intergenic
1092790220 12:12064241-12064263 CACCTCAGCCTCCAGAGTATGGG + Intronic
1096169368 12:49454764-49454786 CACCTCAGCCTCCTGAGTCACGG - Intronic
1096287226 12:50310869-50310891 CACCTCAGCCTCTCGATGCTGGG - Intergenic
1096645232 12:53030106-53030128 TACCTCAGTCTCCTAAGACACGG - Intronic
1096645254 12:53030264-53030286 TACCTCAGTCTCCTAAGACACGG - Intronic
1096661930 12:53131014-53131036 TACCTCAGTCTCCTGAGTAGCGG + Intergenic
1097680184 12:62641718-62641740 CACCTCAGTCTCCTGAGTTGTGG + Intergenic
1098301625 12:69060167-69060189 CACCTCAGCCTCCCAAAGCTGGG - Intergenic
1098791334 12:74828024-74828046 CACCTCAGCCTCCTGAAGTGTGG - Intergenic
1099205644 12:79723121-79723143 CACCTCAACCTCCTGTAGCTGGG - Intergenic
1100296698 12:93269154-93269176 TGCCTCAGCCTCCTGAGTCTGGG - Intergenic
1100445723 12:94657751-94657773 CACCTCAGCCTCCCAAAGCTGGG + Intergenic
1100520343 12:95368784-95368806 CACCTCAGCCTCCTGAGTGTAGG - Intergenic
1100774400 12:97958443-97958465 CACCCCAGTGTTATGAGGCTGGG + Intergenic
1101182128 12:102230582-102230604 CACCTCCTTCTCCTGTTGCTGGG + Intergenic
1101642905 12:106601360-106601382 CACCCCAGTCTCCTGTCCCTGGG - Intronic
1101761700 12:107664091-107664113 CACCTCAGTATCCTGAGTAGCGG + Intergenic
1101926227 12:108973503-108973525 CACCTCAGCCTCCTGAGTAGGGG + Intronic
1101982783 12:109422067-109422089 CACCTCACTCTCCCAAAGCTGGG + Intronic
1101999888 12:109550748-109550770 CACCTCAGTCTCGAGTAGCTGGG + Intergenic
1102138353 12:110594001-110594023 CACCTCAGCCTCCTGAGTACAGG + Intergenic
1102338776 12:112105203-112105225 CACCTCAGCCTCCTGAGTACTGG - Intronic
1102569351 12:113818110-113818132 CGCCTCAGCCTCCCAAGGCTGGG - Exonic
1102587723 12:113934764-113934786 CACCACTGTGTTCTGAGGCTGGG + Intronic
1102922021 12:116798680-116798702 CGCCTCAGCCTCCTGAATCTGGG + Intronic
1103642815 12:122365893-122365915 CACCTCAGCTTCCTGAGGAGTGG - Intronic
1103739719 12:123083102-123083124 CACCACAGCCTCCTGTAGCTGGG - Intronic
1103976040 12:124703379-124703401 CCCCTCTGTCTCTTGGGGCTTGG - Intergenic
1104764370 12:131316929-131316951 CACCTCTGTCTCCTGACCCACGG + Intergenic
1104815172 12:131641469-131641491 CACCTCTGTCTCCTGACCCACGG - Intergenic
1105325154 13:19364174-19364196 CACCTCAGTCTCCTGAGGCTGGG - Intergenic
1105531068 13:21220904-21220926 CACCTCAGCCTCCTGAGTGATGG - Intergenic
1107017070 13:35716146-35716168 CACCTCAGTCTGTGGAGGCAGGG + Intergenic
1107346496 13:39467221-39467243 ATCCTAAGTCTCCTGAGTCTGGG + Intronic
1107411979 13:40166434-40166456 CTCCCCATTCTCCTGAGGCCTGG - Intergenic
1107512939 13:41103228-41103250 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
1107618170 13:42194894-42194916 CACCTCGGTCTCCAGATGCCCGG + Exonic
1107644626 13:42481003-42481025 TGCCTCAGCCTCCTGAAGCTGGG - Intergenic
1107912559 13:45119131-45119153 CACCTCAGTCTCCCAAAGTTAGG + Intergenic
1108614283 13:52116065-52116087 CACCTCAGTCTCCTGAGTACTGG - Intronic
1110777431 13:79424783-79424805 CACCTCAGTCTCCTGAGTTGGGG + Intergenic
1110871099 13:80452832-80452854 CACCGCAGTGGCCTGAGGATTGG + Intergenic
1111193320 13:84837743-84837765 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
1112055673 13:95688626-95688648 TGCCTCAGCCTCCTGGGGCTGGG + Intronic
1112148621 13:96730845-96730867 CACCTCAGCTTCCTGTAGCTAGG + Intronic
1113366107 13:109677394-109677416 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1113819674 13:113204182-113204204 CTTCTCAGGCTCCTGGGGCTGGG - Intronic
1114195919 14:20476085-20476107 CACCTCAGCCTCCTGAGTAACGG + Intronic
1114567802 14:23645284-23645306 CCCCTCAGGCTCCTGGGCCTGGG - Exonic
1114928319 14:27433735-27433757 CACCTCAGCCTCCTGAGGAACGG + Intergenic
1115428258 14:33286178-33286200 CACCCCAGCCTCCTGAGTCCAGG + Intronic
1115591735 14:34872475-34872497 CACCTTAGCCTCCTGAGTGTGGG - Intronic
1115618071 14:35115274-35115296 CACCTCAGCCTCCTGAGTAGCGG + Intronic
1116160458 14:41261143-41261165 CTTCTCAGTTTCCTGAGCCTTGG - Intergenic
1116642194 14:47478487-47478509 CACCTCAGCCTCCTGAGAGCTGG + Intronic
1117124443 14:52606550-52606572 CACCTCAGACTCCCAGGGCTGGG + Intronic
1117980768 14:61340165-61340187 CAGCGCAGTCTCCTGGGGATGGG - Intronic
1118267422 14:64308126-64308148 CACCTCAGCCTCCTGAGGAGCGG + Intronic
1118368183 14:65113496-65113518 CACCTCAGCCTCTTGTGGCTGGG + Intergenic
1118809247 14:69261319-69261341 CAGCTCTGTCACCTGGGGCTCGG - Intronic
1119239236 14:73045147-73045169 CACCTCAGCCTCCTGAGGGAAGG + Intergenic
1119344740 14:73914146-73914168 CACATCAGTCTCCCGAGGCTGGG + Intronic
1119357454 14:74019086-74019108 GATCTAAGTCTCCTGAGGCAAGG + Intronic
1120350139 14:83344537-83344559 GACCTCAGACTCCTGAGGTCAGG + Intergenic
1120875507 14:89371636-89371658 AATGTCAGTCTCCTGGGGCTAGG - Intronic
1120910943 14:89666174-89666196 CACCTCAGCCTCCTGAGTAGGGG + Intergenic
1120932945 14:89866882-89866904 AACCTCAGTCTCCTGAGTAGCGG + Intronic
1121045739 14:90786216-90786238 GACCTCAGTCAGCTGGGGCTTGG + Exonic
1121359920 14:93247459-93247481 TGCCTCAGCCTCCCGAGGCTGGG + Intronic
1121408898 14:93735803-93735825 TGCCTCAGCCTCCTGAGGCTGGG + Intronic
1121434118 14:93907590-93907612 CACCTCATTCTCCTGAGTAGTGG - Intergenic
1121839032 14:97117543-97117565 CACCTCATTCCACTGTGGCTAGG - Intergenic
1122120448 14:99550631-99550653 CACTGCAGTCTCCTAAGGTTGGG - Intronic
1122432109 14:101658552-101658574 CACTTCAGTCTCCTGAGTACTGG - Intergenic
1122496174 14:102157146-102157168 CACCTCAGCCTCTTGTAGCTGGG - Intronic
1122659336 14:103284141-103284163 TACCCCAGTTTCCTGAGCCTTGG + Intergenic
1122922105 14:104884500-104884522 CACCTCCGTGTCCTGCGCCTCGG - Exonic
1124088597 15:26576724-26576746 CCCCTTAGTCCCCTGAGTCTTGG - Intronic
1125445944 15:39756477-39756499 CACCTCAGCCTCCTGATGCTTGG + Intronic
1125463839 15:39932089-39932111 CCACTCAGCCTCCTGAGGGTGGG + Intergenic
1125560728 15:40631002-40631024 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1125579724 15:40776581-40776603 CTCCTCACTCTCCTGGGCCTGGG + Exonic
1125580512 15:40782108-40782130 CACCTCAGCCTCCTGAGTAGGGG - Intronic
1125934819 15:43626033-43626055 TGTCTCAGCCTCCTGAGGCTGGG + Intergenic
1126473579 15:49042912-49042934 TGCCTCAGCCTCCTGAAGCTGGG - Intronic
1127981846 15:64041225-64041247 CACCTCAGGCTCCTGACTCCTGG - Intronic
1129033436 15:72635128-72635150 TGACTCAGTCTCCTGAGGCTGGG + Intergenic
1129058848 15:72844206-72844228 CACCTCCATCTCCTCAAGCTGGG + Intergenic
1129174842 15:73832559-73832581 CCCCTCAGTCTCCTGAAGCAGGG + Intergenic
1129216449 15:74102102-74102124 TGACTCAGTCTCCTGAGGCTGGG - Intronic
1129672864 15:77616709-77616731 CAGCTCAGGCTCCTGAGCCCAGG + Intronic
1130777049 15:86995270-86995292 CACCTCAGCCTCCTGATAGTTGG - Intronic
1130856363 15:87843066-87843088 CATCTCAGTGTCCACAGGCTGGG + Intergenic
1130868588 15:87952713-87952735 CTCCTCAGTCTGCGGAGGGTGGG - Intronic
1131033851 15:89208088-89208110 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1131129318 15:89885825-89885847 TACCTCAGTCTCCTGAGTAATGG - Intronic
1131513225 15:93061083-93061105 CATGTCAGTCTTCTGAGGGTTGG + Intronic
1131513784 15:93064375-93064397 TACCTCCTTCTCCTGAGTCTAGG + Intronic
1131608761 15:93938578-93938600 CACCTCGGCCTCCAGAAGCTGGG - Intergenic
1131809091 15:96153785-96153807 CACCTCAGTCTCCTTAGAAAGGG + Intergenic
1132071524 15:98781006-98781028 CACCTCAGCCTCCTGAGAAGTGG - Intronic
1132204184 15:99975321-99975343 TGCCTCAGTCACCTGAGGCGTGG + Intronic
1132313030 15:100870920-100870942 CACCTCTGCAACCTGAGGCTTGG + Intergenic
1132758698 16:1498549-1498571 CACCTCAGCCTCCTGAGTAGCGG + Intronic
1132773069 16:1575437-1575459 CACCTCAGCCTCCTGAGCGTGGG - Intronic
1132792820 16:1702418-1702440 CTCCTCCGTCTCCAGAGGCCTGG + Intergenic
1132890653 16:2202813-2202835 CACCTCAGCCTCCCAAAGCTGGG + Intergenic
1132949882 16:2555420-2555442 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1132964466 16:2644747-2644769 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1133001148 16:2852362-2852384 CACCTCACTCTCATGGGGCTGGG + Intergenic
1133033601 16:3022921-3022943 GCCCTCCGTCTGCTGAGGCTGGG - Exonic
1133158168 16:3890355-3890377 CAAGTCAGCCTCCTGAGGCCAGG + Intergenic
1133159538 16:3901283-3901305 AGCCTCAGCCTCCTGAAGCTGGG - Intergenic
1133682583 16:8133832-8133854 CAACTCTGTCTCCTAAGACTAGG - Intergenic
1134068036 16:11241964-11241986 CACCTCAGCCTCCTGGGTATTGG + Intergenic
1134568663 16:15273137-15273159 CACCTCAGCCTCCTGAGCATAGG - Intergenic
1134733770 16:16483225-16483247 CACCTCAGCCTCCTGAGCATAGG + Intergenic
1134933730 16:18229057-18229079 CACCTCAGCCTCCTGAGCATAGG - Intergenic
1136066398 16:27761751-27761773 CACCTCTCTTTCCTGAGCCTTGG - Intronic
1136398155 16:30004243-30004265 CCCCCCAGTGTCCTGAGGCTGGG + Intronic
1136589711 16:31210553-31210575 CACCTCAGCCTCCTGAGTAACGG - Intergenic
1136594314 16:31237170-31237192 CACCTCAGCCTCCTGAGTACTGG + Intergenic
1137264910 16:46860800-46860822 CACCGGAGTCTGCTGAGGATGGG - Intergenic
1137620649 16:49874405-49874427 CCCCTCAGTCTCCTTAAGCGGGG - Intergenic
1137846644 16:51696281-51696303 CACCTAAGTCTCTCGAAGCTGGG + Intergenic
1139602689 16:67996150-67996172 CACTTCAGCCTCCCGAGTCTGGG + Intronic
1140411207 16:74741540-74741562 CACCTCTGTCTTCTGGGCCTAGG + Intronic
1141508755 16:84498977-84498999 CACGGCAATCTTCTGAGGCTGGG - Intronic
1141990895 16:87608921-87608943 CACCTCAGCCTCCTGAGTGGTGG - Intronic
1142711955 17:1728243-1728265 AGCCTCAGCCTCCTGGGGCTGGG - Exonic
1142849104 17:2695782-2695804 CAGCCCCGTGTCCTGAGGCTTGG + Intronic
1143177657 17:4965770-4965792 CACCTCAGCCTCCCGAGAATTGG + Intronic
1143229301 17:5338452-5338474 TGCCTCAGCCTCCCGAGGCTGGG - Intronic
1143503802 17:7353048-7353070 ATCCTCAATTTCCTGAGGCTGGG + Exonic
1143606279 17:7988238-7988260 CACCTCAGTCTCCCAAAGCGCGG + Intergenic
1143779402 17:9221461-9221483 CCCTTCACCCTCCTGAGGCTGGG + Intronic
1144822980 17:18088390-18088412 AACCTCAGTCTCCTGATGGCTGG + Intronic
1144847493 17:18227500-18227522 CATCTCAGCCTCCTGAAGCTGGG + Intronic
1145257948 17:21337800-21337822 CAGCTCAGATTCCGGAGGCTGGG - Intergenic
1145350793 17:22081301-22081323 CACCTCAGCCTCCTGAAGGCTGG - Intergenic
1145763923 17:27444990-27445012 CACCTCAGCCTCCTGAGTAATGG + Intergenic
1145944667 17:28764326-28764348 CGCCTCAGTCTCCTGAGTAGTGG - Intronic
1146721850 17:35129489-35129511 CAACTCATTCTCCTGTGTCTTGG - Exonic
1147591190 17:41684410-41684432 CTCCTCAGGCTCCTGGGGCTGGG + Intergenic
1147947388 17:44087634-44087656 CTCCTCTGTCTCCTCAGGGTGGG + Exonic
1148066622 17:44875595-44875617 CACCTCAGTCTCCTGATAGCTGG - Intronic
1148142607 17:45339152-45339174 CACCTCAGGCTCCTGAGTCTGGG - Intergenic
1148599577 17:48884025-48884047 CACCTCAGCCTCCTGAGGCCCGG + Intergenic
1148814412 17:50317029-50317051 CACCTCAGTCTCCCGAGTAGCGG + Intergenic
1149992196 17:61389523-61389545 CGCCTCAGTCTCCTGACTCCAGG - Intronic
1150131398 17:62671183-62671205 CACCTCAGCCTCCTGAGTAGCGG + Intronic
1150153348 17:62829297-62829319 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1150239560 17:63621570-63621592 TACCTCAGACACCCGAGGCTGGG - Intergenic
1150332504 17:64305605-64305627 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
1151175434 17:72284272-72284294 AACCTCATTCTCCTGAGGTTGGG - Intergenic
1151236759 17:72725990-72726012 TACCTTAGTGTCCTCAGGCTGGG + Intronic
1151761786 17:76108260-76108282 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1152039027 17:77891312-77891334 CACCTCAGCCTCCCAAGTCTTGG + Intergenic
1152550935 17:81029796-81029818 CACCTCAGCCTCTAGTGGCTAGG + Intergenic
1152689004 17:81709016-81709038 CACCGCAGTGTCCTGCTGCTTGG - Intergenic
1152765104 17:82132666-82132688 CACCTCAACCTCCTGAGTCTGGG + Intronic
1153004131 18:482227-482249 TGCCTCAGCCTTCTGAGGCTGGG + Intronic
1155092771 18:22527440-22527462 CACCTCAGCCTCCTGAGTACTGG - Intergenic
1155236470 18:23824701-23824723 CACCACAGTTTCCTTAGGTTGGG - Intronic
1155954737 18:31947371-31947393 CACCTCAGCCTCCTGAGTAGGGG - Intronic
1156205701 18:34883423-34883445 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1156255770 18:35394941-35394963 CATCTCAGTCTCCTGAGTAGGGG + Intergenic
1157067247 18:44366519-44366541 CATTTAAGTCTCCTGAAGCTGGG + Intergenic
1158573279 18:58614670-58614692 CACCTCAGCCTCCTGAGTAGTGG + Intronic
1158872491 18:61701787-61701809 AGCCTCAGCCTCCTGAGTCTAGG + Intergenic
1159063661 18:63543708-63543730 TGCCTCAGCCTCCTGAGGCAGGG + Intergenic
1159293095 18:66446850-66446872 CACCTCAGACTCATGAGGATAGG - Intergenic
1159510071 18:69386513-69386535 CACCTCAGCCTCCTAAAGTTGGG - Intergenic
1160693138 19:469329-469351 CACCTCAGCCTCCTAACTCTGGG + Intronic
1161261973 19:3342946-3342968 CACCTCAGTCTCCTGAGTATAGG - Intergenic
1161295482 19:3517946-3517968 CACCTCAGCCTCCTGAGTCCTGG + Intronic
1161391078 19:4020706-4020728 CACCTCAGCCTCCTGAGTAGCGG + Intronic
1161515998 19:4696983-4697005 CACCTCAGCCTCCTGAGTAGAGG - Intronic
1161748971 19:6080381-6080403 CACCTTAGAATCCTCAGGCTGGG - Intronic
1161767345 19:6214932-6214954 CCCCTCAGTGGCCTCAGGCTGGG + Intronic
1161801746 19:6420194-6420216 CCACACAGTCTCCTGAGGCCTGG - Intronic
1161878661 19:6931682-6931704 TGCCTCAGCCTCCCGAGGCTGGG - Intronic
1161915322 19:7224057-7224079 CACCTCAGCCTCCAGTAGCTGGG + Intronic
1162641642 19:12014820-12014842 CACCTCAGCCTCCTAAAGCCTGG + Exonic
1162759016 19:12877351-12877373 CACCTCAGCCTCCTGAGTAGTGG + Intronic
1163465619 19:17466825-17466847 CATCTCAGTTTCCTGGGGATAGG + Intergenic
1163471449 19:17499697-17499719 TGCCTCAGCCTCCTGAGTCTGGG - Intronic
1163486047 19:17586731-17586753 CATTTCAGCCTCCCGAGGCTGGG - Intergenic
1163598128 19:18232247-18232269 CACCTCAGTCTCGAGTAGCTGGG - Intronic
1163641031 19:18462060-18462082 CACCTCCCACTTCTGAGGCTGGG - Intronic
1163706396 19:18816397-18816419 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1163757744 19:19116573-19116595 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1164223981 19:23225490-23225512 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1164611247 19:29633361-29633383 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1165196201 19:34105748-34105770 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1165527143 19:36365844-36365866 CACCTCAGCCTCCTGAGTACTGG - Intronic
1165551808 19:36593287-36593309 CACCTCAGCCTCCAGAGTATCGG + Intronic
1165861115 19:38909984-38910006 CACCTCAGCCTCCTGAGAGCTGG + Intronic
1166181307 19:41111132-41111154 CACCTCAGCCTCCTATAGCTAGG + Intergenic
1166199737 19:41229197-41229219 CACCTCGGCCTCCTAAGGCTGGG + Intronic
1167017986 19:46854077-46854099 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1167261173 19:48459124-48459146 TGCCTCAGCCTCCCGAGGCTGGG - Intronic
1167634671 19:50647564-50647586 CACCTCAGTCTCCCGAGTAATGG - Intronic
1167653949 19:50751117-50751139 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
1167693606 19:51001773-51001795 AATCTCAGACTCCTGAGGCTAGG + Intronic
1167756892 19:51418316-51418338 TGCCTCAGCCTCCTGAGTCTGGG + Intergenic
1167835863 19:52069185-52069207 CACCTCAGCCTCCTGAGAGCTGG + Intronic
1167961358 19:53106685-53106707 CACATAAGTATCCTGAGGCAGGG + Intergenic
1168025640 19:53641543-53641565 CACCTCAGTCTCCCAAGGCCTGG + Intergenic
1168184343 19:54688872-54688894 CACCTCACGCTCCCGTGGCTAGG - Intronic
1168208232 19:54868670-54868692 CATCTTAGTATCCTGAGCCTTGG - Intergenic
1168622472 19:57890438-57890460 AACCTCCGCCTCCTGAGACTGGG + Intronic
925782768 2:7398099-7398121 CACCTCAGCCTCCAGAGGGCTGG + Intergenic
925964056 2:9046721-9046743 CACCTCAGCCTCCCAAGTCTGGG + Intergenic
926024046 2:9524374-9524396 CACCTCAGCCTCCTCTAGCTGGG - Intronic
926898940 2:17728319-17728341 CACCTCAGCCTCCTGAGAGCTGG - Intronic
927122606 2:19981629-19981651 CACCTCAGCCTCCTGAGTACTGG + Intronic
927450555 2:23205969-23205991 CACTGCAGTCTCCTGCTGCTGGG + Intergenic
927769208 2:25843686-25843708 CATCTCTGCCTCCTGAAGCTGGG - Intronic
928295651 2:30080680-30080702 CACCTCAGCCTCCTGAGTAACGG - Intergenic
928425316 2:31172849-31172871 AGCCTCACTCTCCTGAGTCTAGG - Intergenic
928437405 2:31263790-31263812 CACCTAACTCTCCAGAAGCTGGG - Intronic
929470103 2:42183039-42183061 CACCTCAGCCTCCTGATACCTGG - Intronic
931852436 2:66265386-66265408 CACTGGAGTCTCCAGAGGCTGGG - Intergenic
932337829 2:70941029-70941051 CACCTCAGCCTCCTGAGAGCTGG + Exonic
932427952 2:71654975-71654997 CACCTTAGCCTCCTGTAGCTGGG - Intronic
932460017 2:71876008-71876030 CCACTCGGTCACCTGAGGCTGGG + Intergenic
932629539 2:73327441-73327463 CACCTCAGCCTCCTGTAGCTGGG + Intergenic
932752217 2:74378631-74378653 CAGCTCAGACTCCTGAGTCAGGG - Intronic
932753498 2:74388254-74388276 CCCCTCAGCCTCCTGAGTATAGG - Intronic
932769531 2:74492814-74492836 CTCCTTAGCCACCTGAGGCTTGG - Intronic
933675246 2:85050034-85050056 CACCTCAGCCTCCTGAGTAGCGG - Intronic
934058031 2:88268992-88269014 CACCTCAGCCTCCTGAGTATCGG + Intergenic
934078208 2:88445966-88445988 CACCTCAGTCTCCTAAGTGTTGG + Intergenic
934572075 2:95379136-95379158 CACCTCAGCCTCCTGGGGGATGG - Intronic
934767640 2:96888952-96888974 CAGCTCATGCTCCTGAGGCCTGG - Intronic
935040241 2:99419578-99419600 CTCCTCTGTCTCCTGTGGTTGGG - Intronic
935077759 2:99762236-99762258 CGCCTCAGCCTCCTGAGTCCTGG + Intronic
935117079 2:100145923-100145945 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
935398893 2:102640110-102640132 TGCATCTGTCTCCTGAGGCTTGG + Intronic
936025483 2:109028155-109028177 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
936603515 2:113924181-113924203 CACCTCAGCCTCCTGAGTAGCGG + Intronic
937108004 2:119337167-119337189 CACCTCAGCCTCCTGAGTGCTGG + Intronic
937224110 2:120358288-120358310 CACACCAGTCTCCTGAGACTGGG + Intergenic
937842573 2:126538391-126538413 CACATCAGTCTCCTGAGGAAAGG - Intergenic
937898053 2:126993584-126993606 TGCCTCAGCCTCCTGAGGCTGGG - Intergenic
937907477 2:127059196-127059218 CCCCTCCGTCTCCTGTGCCTTGG - Intronic
937922762 2:127143522-127143544 CACCTCAGCCTCCCGGTGCTGGG - Intergenic
938295563 2:130176799-130176821 CACGTCAGTCTCCTGAGTACAGG + Intronic
938461061 2:131497027-131497049 CACCTCAGTCTCCTGAGTACAGG - Intergenic
938760839 2:134424463-134424485 CAGCTCGGTCTCCTGAGGTTGGG - Intronic
939568567 2:143813565-143813587 CAGGTGGGTCTCCTGAGGCTAGG + Intergenic
939734983 2:145833086-145833108 TGCCTCAGCCTCCTGAAGCTGGG + Intergenic
940070286 2:149679008-149679030 CACCTCTTTCTCCTGACACTGGG - Intergenic
940323103 2:152398007-152398029 CGCCTCAGCCTCCCAAGGCTGGG - Intronic
940347991 2:152647100-152647122 CACCTCAGCCTCCTGAGAAGTGG - Intronic
942897098 2:181070272-181070294 CTCCTCAGCCTCCTAATGCTGGG - Intronic
943145879 2:184044277-184044299 CACCTCAGCCTCCTATAGCTGGG + Intergenic
944047290 2:195427739-195427761 CCCCTCAGCCTCCTGAGCCAGGG - Intergenic
945048195 2:205800160-205800182 CACCTCAGTCACCTGAGGCCAGG - Intergenic
945470994 2:210227816-210227838 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
945607704 2:211956945-211956967 CACCTCAGATTCCTGTGTCTAGG + Intronic
945621667 2:212147102-212147124 CACCTCAGCCTCCTGAGTAGTGG + Intronic
946597922 2:221326981-221327003 CACCTCAGCCTCCTGAGACGGGG - Intergenic
947512499 2:230769842-230769864 CACCTCAGCCTCCCGAGTCCCGG - Intronic
947753639 2:232545532-232545554 CTCCTCATTCCCCTGAGGGTGGG - Exonic
947775768 2:232708074-232708096 CACCTCAGCCTCCTGAGTATAGG + Intronic
948810499 2:240473008-240473030 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1169052361 20:2591589-2591611 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1169131923 20:3170373-3170395 CACCTCAGCCTCCTGAGTAGGGG - Intronic
1169133697 20:3182685-3182707 CACCTCAGCTTCCTGTAGCTGGG + Intergenic
1169387420 20:5162973-5162995 CACTTTAGTCTCCAGAGCCTAGG + Intronic
1169535728 20:6537919-6537941 AACCTCAGCCTGCTGAGCCTGGG + Intergenic
1169764745 20:9136863-9136885 CAGCCTACTCTCCTGAGGCTGGG + Intronic
1170200505 20:13738425-13738447 CACCTCAGCCTCCTGAGTAGTGG + Intronic
1170948428 20:20912403-20912425 CACCTCAGCCTCCTGAGAAAGGG + Intergenic
1171458101 20:25283123-25283145 GGCCTCAGCCTCCTGAGGCTGGG - Intronic
1172257213 20:33529623-33529645 CATCTCAGCCTCCTGAGGTGTGG - Intronic
1172734925 20:37119352-37119374 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1173627911 20:44487326-44487348 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1173708940 20:45137860-45137882 CACCAGCGTCTCCTCAGGCTTGG + Intergenic
1173904583 20:46616812-46616834 CACCTCAGCCTTCTTAGGCTGGG + Intronic
1173963728 20:47094916-47094938 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1174129288 20:48330141-48330163 CACCTCTGTCTCCTGACTTTGGG - Intergenic
1174585742 20:51606761-51606783 TACCTCAGCCTTCTGAGTCTGGG - Intronic
1175952796 20:62592364-62592386 CCCCTCTGTCTGCTGAGGCTGGG + Intergenic
1178300290 21:31447320-31447342 CACCTCAGCCTCCTGAGAGCTGG - Intronic
1178543289 21:33473201-33473223 CACCTCAGTCTCCAAAGTGTTGG - Intronic
1178945487 21:36943703-36943725 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1178985980 21:37303515-37303537 CACCTTGGCCTCCTGAAGCTGGG + Intergenic
1180011541 21:45054674-45054696 CCCGTCCGTCTCCTGTGGCTCGG - Intergenic
1180021270 21:45129113-45129135 TGCCTCAGTCTCCCGAGGCTGGG - Intronic
1180576976 22:16786159-16786181 CACCTCAGCCTCCTAAAGGTAGG - Intronic
1181510748 22:23387705-23387727 CACCTCAGCCTCCTGTGTATTGG - Intergenic
1181870057 22:25891019-25891041 CACTTAGGTCTCCTAAGGCTTGG + Intronic
1182625322 22:31641564-31641586 CACCTCAGCCTCCCAAAGCTGGG - Intronic
1182684986 22:32115336-32115358 CTTCTCAGTCTCCTGAAGCGAGG - Intergenic
1183516429 22:38269462-38269484 CACCTCAGCCTCCCAAAGCTTGG + Intronic
1183754461 22:39747235-39747257 CTCCTCAGCCTCCCGAAGCTGGG + Intronic
1184152188 22:42645715-42645737 CAAGTCTGTCCCCTGAGGCTTGG - Intronic
1185238789 22:49729704-49729726 CACCTCAGCCTCCCGAGTCACGG + Intergenic
1185334157 22:50264064-50264086 CACAGCAGCTTCCTGAGGCTGGG - Exonic
949452104 3:4197226-4197248 CACCTCAGTCTCCCGAATATTGG + Intronic
949887056 3:8703995-8704017 CATCTCAATCACCTGAGGTTAGG + Intronic
949894946 3:8761932-8761954 CACTACTGTCTCCTGGGGCTGGG + Intronic
949898448 3:8790076-8790098 CACTTCAGTCTCCCGTAGCTGGG - Intronic
950675060 3:14549730-14549752 TACTTCAGTCCCATGAGGCTGGG + Intergenic
950783705 3:15414601-15414623 CACCTCAGTCTCCCAAAGTTGGG + Intronic
951209996 3:19964725-19964747 TGCCTCAGCCTCCTGAGGCTGGG + Intronic
951245408 3:20335718-20335740 TACCTCAGTCCCCTGACTCTTGG + Intergenic
951803663 3:26623619-26623641 CAGCTCTGGCTCCTGAGGCGAGG + Intronic
952282178 3:31934520-31934542 TGCCTCAGCCTCCTGAAGCTGGG + Intronic
952456863 3:33480949-33480971 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
952509771 3:34041363-34041385 TGCCTCAGCCTCCTGAAGCTGGG - Intergenic
952965380 3:38617827-38617849 CACAGCAGTGTCCTGAGGCTGGG - Intronic
953863346 3:46563848-46563870 CACCTCTGTCTGCAGGGGCTTGG - Intronic
953898103 3:46819413-46819435 CACCTCAGCCTCCTGAGTACCGG - Intergenic
954000883 3:47555914-47555936 AACCTCAACCTCCTGAGGCCAGG - Intergenic
954618675 3:51983570-51983592 CACCTCACTCTCCTGTCGCTGGG - Exonic
954632124 3:52053266-52053288 GACCCGAGTCTGCTGAGGCTGGG + Intronic
954826241 3:53375972-53375994 CACCTCAGCCTCCCAAGTCTGGG - Intergenic
954859449 3:53675299-53675321 AACCTCAGTGGCCTTAGGCTAGG + Intronic
955151607 3:56372612-56372634 CACCTCAGCCTCCTGAGTAGCGG - Intronic
955392548 3:58531872-58531894 CAACCCAGCCTCCTGGGGCTGGG + Intronic
955835331 3:63048236-63048258 CACCTCAGCCTCCTGAGTGCTGG - Intergenic
956118450 3:65941903-65941925 CACCTCAGCCTCCTGAAGCTGGG + Intronic
956464607 3:69506647-69506669 TGCCTCAGCCTCCTGAGTCTGGG + Intronic
956506940 3:69951209-69951231 CACCTCAGCCTCCCGTAGCTGGG + Intronic
957803683 3:85119161-85119183 CACCTCAGCCTCCCAAGGGTTGG - Intronic
960037111 3:113112916-113112938 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
960732268 3:120740373-120740395 CACCTCAGCCTCCTGAGTAGCGG + Intronic
961256591 3:125559707-125559729 CACCTCAGCCTCCTGAGTTGGGG + Intronic
961330859 3:126137109-126137131 CTCCTCAGCCTCCTTAGGGTGGG + Intronic
961354845 3:126331043-126331065 GCCCTCAGACTCCTGAGGATAGG - Intergenic
961648706 3:128406697-128406719 CACCTCAGCCTCCTGAGTAGTGG - Intronic
961871142 3:129988999-129989021 CACCTCAGTCTCCTGACAGCTGG + Intergenic
962050319 3:131806774-131806796 CACCTCGTTCTCCAGAGGCAAGG - Intronic
962181052 3:133206874-133206896 CACTTAAGTCTGCTGAAGCTGGG + Intronic
962270784 3:133976639-133976661 GACCTCAGTCTCCTCAGCCCTGG + Intronic
963040814 3:141068519-141068541 CACATCAGACTCCAGAGCCTTGG - Intronic
963131519 3:141862669-141862691 CACTTCAGTCTCTTGAGTCCAGG - Intergenic
963543193 3:146621124-146621146 TTCCTGAGTCTTCTGAGGCTTGG + Intergenic
963791122 3:149583450-149583472 TGCCTCAGCCTCCCGAGGCTGGG + Intronic
963926610 3:150957770-150957792 TGCCTCAGCCTCCTGAGGCTGGG + Intronic
965096346 3:164232145-164232167 TGCCTCAGCCTCCTGAAGCTGGG + Intergenic
965379160 3:167966943-167966965 CACTTCAGTCTGCAGAGGTTCGG - Intergenic
965801836 3:172502474-172502496 CACCTCAGCCTCCTGAGTCATGG + Intergenic
966269464 3:178087232-178087254 GACCTGTGTCTCCTGAGGTTTGG + Intergenic
966964677 3:184978646-184978668 CACCTCAGCCTCCCAAAGCTGGG + Intronic
967019594 3:185511144-185511166 CACCTCAGCCTCCTGAGTAGTGG + Intronic
967202370 3:187083388-187083410 CACCTCAGCCTCCTAAGTATCGG - Intergenic
967730891 3:192905717-192905739 CACCTCAGACTCCTGAGTAGTGG - Intronic
968548052 4:1208501-1208523 CACCTCAGGCTACTGCGCCTTGG - Intronic
969432499 4:7163936-7163958 TGCCTCAGCCTCCTGAGTCTGGG - Intergenic
970115041 4:12685550-12685572 CACATCAGAATCCTCAGGCTGGG - Intergenic
971349762 4:25845380-25845402 CACCTCAGCCTCCTGAGTAGCGG - Intronic
971762872 4:30790807-30790829 CACCTCAGCCTCCTGAGAGCTGG - Intronic
972082740 4:35173492-35173514 CACCTCAGTGTGCTGAGAATGGG + Intergenic
972665659 4:41162739-41162761 CACCTCAGCCTCCTGAGTGCTGG - Intronic
972751386 4:41992225-41992247 CACCTCAGCCTCCTGAGTACAGG - Intronic
973896751 4:55421412-55421434 CACCTCAGCCTTCTGAGTCTGGG + Intronic
974942333 4:68484418-68484440 CACTTCAGTCTCCTGAGTAGCGG + Intronic
975872067 4:78790759-78790781 CATCTCAGCCTCCTGAGGTGTGG - Intronic
976610365 4:87024702-87024724 TGCCTCAGCCTCCTGAGGCTGGG + Intronic
976725290 4:88210301-88210323 CACCTCAGCCTCCAGTGGCTGGG + Intronic
976753220 4:88471587-88471609 CACCTCAGCCTCCTGGTGTTGGG + Intronic
977199276 4:94096756-94096778 CACCTCAGCCTCCTGGGGCCTGG + Intergenic
977582110 4:98736446-98736468 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
977599747 4:98923427-98923449 CATTTCAGCCTCCTGAGGCTAGG + Intronic
977900624 4:102418120-102418142 CACCCTAGCCTCCTGAGGCTGGG - Intronic
979512276 4:121567856-121567878 CACTTAAGTCTGCTGAAGCTGGG - Intergenic
979534625 4:121805917-121805939 CACCTCAGTCTCCTGAGTAGTGG + Intronic
979786501 4:124721744-124721766 CACCTCAGCCTCCTGAGAGCTGG + Intergenic
981721481 4:147806180-147806202 CACCTCAGTGTCCAGAGTCCAGG + Intronic
982027371 4:151264180-151264202 CACCTCAGCCTCCCAAAGCTGGG - Intronic
983265375 4:165502291-165502313 CACCTCAGCCTCCTGTAGCTAGG + Intergenic
983281815 4:165690391-165690413 CACCTCAGCCTCCCAAAGCTGGG + Intergenic
984612673 4:181858198-181858220 CACCTCAGCCTCCTGAATTTTGG + Intergenic
984799115 4:183696643-183696665 CACCTCAGCCTCCCAAAGCTGGG + Intronic
985903156 5:2813115-2813137 CCCCACAGTCTCCAGAGGATGGG + Intergenic
986328915 5:6703118-6703140 CACTGCAGCCTCCTGAGCCTGGG + Intergenic
986378498 5:7159415-7159437 TGCCTCAGCCTCCTGAAGCTGGG + Intergenic
987472841 5:18353799-18353821 CACCTCAGTCTCTCGAGTATCGG + Intergenic
988498964 5:31768203-31768225 CACCAGAGTCTCCAAAGGCTGGG + Intronic
988578743 5:32450685-32450707 TACCTCAGCCTCCTGTAGCTGGG - Intergenic
988842303 5:35094939-35094961 CACCTCAGCCTCCTGAGTAGTGG + Intronic
990316167 5:54585176-54585198 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
991333691 5:65522677-65522699 CACCTCAGTCTCCTAAAGTGCGG + Intronic
992004039 5:72460825-72460847 CTCCTCGCTCTCCTGGGGCTCGG + Exonic
992042838 5:72853325-72853347 CACCTCAGCCTCCTGAGTAGCGG - Intronic
992732315 5:79684368-79684390 CACCTCAGCCTCCTGAGTGCTGG + Intronic
992798414 5:80273844-80273866 CACCTCAGTCTCCTGTAGCTGGG + Intergenic
992810972 5:80388191-80388213 CACCTCAGCCTCCTGTAGCTAGG - Intergenic
992863213 5:80933016-80933038 CATCTCAGGCTCCTGAGGATAGG + Intergenic
993630516 5:90280759-90280781 CACATCACTCTCCTGAACCTTGG - Intergenic
993746112 5:91598940-91598962 CACCTCATTCTTCTAAGACTGGG + Intergenic
994092309 5:95820235-95820257 CACCTCAGCCTCCCGTGGCTGGG - Intronic
994617781 5:102127942-102127964 CACCTGAGTCACCTGAGGTCAGG - Intergenic
994785436 5:104155335-104155357 CACCTCAGTCTCCTAAAGCCTGG + Intergenic
995502912 5:112828147-112828169 CACTTCAGCCTCTCGAGGCTGGG + Intronic
995576808 5:113545494-113545516 CACCTCAGCCTCCAGAGCTTTGG + Intronic
995741774 5:115363534-115363556 CACTGCAGTCTGCTGAGGCAAGG - Intergenic
997475825 5:134141876-134141898 AGCCACAGGCTCCTGAGGCTGGG + Intronic
997708420 5:135981212-135981234 CACCTCAGCCTCCTGAGTGCTGG + Intergenic
997945613 5:138198071-138198093 CGCCTCAGTCTCCTGAGTAGAGG + Intronic
998076080 5:139237508-139237530 CACCTCAGCCTCCTGAGTAGCGG + Intronic
998552498 5:143090894-143090916 CTCCTGAGTCTCCTAAGACTGGG - Intronic
998558799 5:143151840-143151862 TGCCTCAGCCTCCTGAGCCTGGG - Intronic
999450573 5:151674642-151674664 CACCTCTGTCTCATCAGGCAGGG + Exonic
999999827 5:157127140-157127162 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1000308094 5:160014587-160014609 CACCTCAGCCTCCTGAGTGGTGG - Intronic
1000312961 5:160062690-160062712 CACATCAGACTCCTGAGGAGGGG - Intronic
1000536634 5:162486115-162486137 AATCTCAGTCCCCTGAGCCTTGG - Intergenic
1001605119 5:172954317-172954339 CACCTCAGCCTCCCGGTGCTGGG - Intergenic
1001808053 5:174605821-174605843 CACCTCAGCCTCCTAAGTGTTGG - Intergenic
1001819938 5:174702567-174702589 CACCTCAGCCTCCTGTAGCTGGG + Intergenic
1002180245 5:177427402-177427424 GCCCTCAGTGTCCTGAGGCACGG - Intronic
1002480646 5:179498551-179498573 CACCCCTGTCTCCCGAGGCCAGG - Intergenic
1002544179 5:179927700-179927722 TGCCTCAGTCTCCTGAGTATGGG + Intronic
1002556636 5:180046749-180046771 CAACTCAGTCTTAGGAGGCTGGG - Intronic
1003008788 6:2407108-2407130 CACCTTAGTCTCCCGAGACTAGG - Intergenic
1004338355 6:14784621-14784643 CACCACATTCTCCTAAGACTTGG - Intergenic
1004420516 6:15465335-15465357 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1004516062 6:16323268-16323290 CGCCTCAGCCTCCTAAAGCTGGG - Intronic
1004976675 6:20974863-20974885 CACCTCAGCCTCCTGAGTAGGGG - Intronic
1005054876 6:21720120-21720142 TGCCTCAGCCGCCTGAGGCTGGG - Intergenic
1005103735 6:22200972-22200994 CACCTCAGCCTCCCAAAGCTAGG + Intergenic
1005771385 6:29076343-29076365 CAGGTCAGTATCCTGGGGCTTGG - Exonic
1006113426 6:31762551-31762573 CACCGGAGTCTCAGGAGGCTGGG - Exonic
1006963732 6:37960959-37960981 CACCTCAGCCTCCTGACTATAGG - Intronic
1007385020 6:41514662-41514684 CACCTCAGTGTCCTCAGGTCTGG + Intergenic
1007485900 6:42180459-42180481 CACCTTAGCCTCCTGAGTATTGG - Intergenic
1007510145 6:42368325-42368347 AAACTCAGTCTCCTGATGGTTGG + Intronic
1007819195 6:44548064-44548086 CACCTCAATCTCCTGACTATAGG - Intergenic
1008758884 6:54830490-54830512 CACCTCATCCTCATGATGCTTGG + Intergenic
1010173745 6:73002007-73002029 CACCTCAGCCTCCTGAGAGCTGG - Intronic
1010227600 6:73505667-73505689 TGCCTCAGTCTCCTGAGTCTGGG + Intronic
1010345394 6:74804250-74804272 CACCTCAGACTCCTGAGTAGCGG - Intergenic
1011668250 6:89656811-89656833 CACCTCATTCTTTTGTGGCTTGG - Intronic
1013354285 6:109333581-109333603 AACCTCAGCCTCCTGAAGCTAGG + Intergenic
1014401569 6:120996596-120996618 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1014898503 6:126933539-126933561 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1015525675 6:134174029-134174051 AAGCTCAGGCTCCTGAGGTTGGG + Exonic
1016203348 6:141441226-141441248 CACCTTAGTCTCCTCTGGTTTGG + Intergenic
1017472512 6:154753236-154753258 CAGGTCAGTCACCTGAGGTTGGG + Intronic
1018345253 6:162892870-162892892 CACCTCAGCCTCAGGAGCCTCGG + Intronic
1018345264 6:162892910-162892932 CACCTCAGCCTCAGGAGCCTCGG + Intronic
1018345274 6:162892953-162892975 CACCTCAGCCTCAAGAGCCTCGG + Intronic
1018345286 6:162892996-162893018 CACCTCAGCCTCAGGAGCCTCGG + Intronic
1019807879 7:3141931-3141953 CACCTCAGCCTCCTGAGGCTGGG - Intronic
1019969302 7:4527386-4527408 CACTTCAGCCTCCTCAGCCTTGG + Intergenic
1020290764 7:6720818-6720840 CACCCAGGTCTCCTCAGGCTCGG + Intergenic
1020945561 7:14601145-14601167 CACCTCTGTCTCCTGAAGGGTGG + Intronic
1021490723 7:21217629-21217651 CACCTATGTCTCTAGAGGCTTGG - Intergenic
1021627589 7:22609607-22609629 CACCTCAGTCTCCTAAATGTTGG + Intronic
1021745089 7:23732195-23732217 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1023050878 7:36250106-36250128 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1024910259 7:54439475-54439497 CAGCTCTGTCTCCTGAGGTGGGG - Intergenic
1025970029 7:66314397-66314419 CACCTCAGCCTCCTGCAGCTGGG - Intronic
1026150011 7:67779971-67779993 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
1026530755 7:71195327-71195349 CGCCTCAGTCTCCTATAGCTGGG + Intronic
1026888743 7:73969887-73969909 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1027245307 7:76363101-76363123 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1027257319 7:76439366-76439388 CACCTCGGTCACCTGGGGATGGG + Intronic
1027281528 7:76612675-76612697 CACCTCGGTCACCTGGGGATGGG - Intronic
1028569294 7:92268589-92268611 CACCTCAGGCTCCCGTAGCTGGG + Intronic
1028759570 7:94480473-94480495 CACCTCAGCCTCCTGAGTAATGG + Intergenic
1028759816 7:94483460-94483482 CACCTCAGCCTCCTGAGTAATGG + Intergenic
1028926016 7:96357870-96357892 CACCTCAGCCTCCGGAAGCTGGG + Intergenic
1029155260 7:98512887-98512909 CACGTCAGCCTCCTGAGGTATGG + Intergenic
1029422627 7:100479036-100479058 CACATCAGTCTCCAGACCCTTGG - Exonic
1029498576 7:100912642-100912664 CACCTCAGCCTCCCAATGCTGGG - Intergenic
1029796333 7:102898537-102898559 CACCTCAGTCTCCCGAAGTGTGG + Intronic
1030014168 7:105201729-105201751 CATCTCAGCCTCCTGAGTCTTGG - Intronic
1030014176 7:105201768-105201790 CATCTCAGCCTCCTGAGTCCTGG - Intronic
1030497963 7:110323523-110323545 CACATCAGCCTCCTGAGTATGGG + Intergenic
1030647714 7:112081992-112082014 CACATGAGTATTCTGAGGCTGGG - Intronic
1030683042 7:112452274-112452296 CTCCTCAGCCTCCTGTAGCTAGG + Intronic
1030940746 7:115646114-115646136 CACCTCAGCCTCTTGAAGCTGGG - Intergenic
1032198568 7:129803948-129803970 CCACTCAGTCTCCTGAGGTACGG - Intergenic
1032380394 7:131473898-131473920 CACCTCAGCCTCCTGAAGTGCGG - Intronic
1033137406 7:138796829-138796851 CATCTCAGTCTCCAGTGCCTAGG + Intronic
1033230930 7:139596856-139596878 CACCTCGGTCACCTGTGGGTGGG - Exonic
1033239468 7:139665149-139665171 CACCTCAGCCTCCTGAGTAGCGG + Intronic
1033369244 7:140694168-140694190 TGCCTCAGCCTCCTGAGACTGGG - Intronic
1033876252 7:145822467-145822489 CAGCTCAGGCTCCTGGGGATGGG + Intergenic
1034559674 7:151872028-151872050 CACCACAGTCCTCTGAGGCTGGG + Intronic
1036388857 8:8307274-8307296 CACCTCAGCCTCCCAAAGCTGGG + Intergenic
1036611684 8:10355806-10355828 AACCTCAGTCCCCTGAGGGCTGG - Intronic
1037110973 8:15164278-15164300 AACCTCAGAATCCTGAGGGTGGG + Intronic
1038566849 8:28626774-28626796 CACCTCAGTCTTCAGAGGCAAGG - Intronic
1038699541 8:29836872-29836894 CAGATCAGTCTCCCAAGGCTTGG - Intergenic
1038913094 8:31989131-31989153 TGCCTCAGCCTCCTGAGTCTGGG - Intronic
1039048874 8:33474692-33474714 CACCTCAGCCTCCTGAGTGGCGG - Intronic
1040427838 8:47307332-47307354 TGCCTCAGCCTCCTGAGGCTGGG + Intronic
1040447346 8:47508774-47508796 CACCTCTGTGTCCTGATGGTGGG - Intronic
1040494101 8:47950732-47950754 CACCTCAGTCTCCAAAGCATTGG - Intronic
1040743056 8:50604300-50604322 CACCTCAGCCCCCTGTAGCTGGG - Intronic
1041115902 8:54536573-54536595 CACCTCAGCCTCCTGAGTAGGGG + Intergenic
1041926144 8:63238638-63238660 TGCCTTAGCCTCCTGAGGCTGGG + Intergenic
1042226399 8:66518263-66518285 CACCTCAGTCTCCTGAAAGCTGG + Exonic
1042251906 8:66764582-66764604 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1042673289 8:71287720-71287742 CACATCAGCTTCCTGAGGCCAGG + Intronic
1043376430 8:79654866-79654888 CACCTGGGCCTCCTGAGACTGGG - Exonic
1043475343 8:80600338-80600360 CACCTCAGTCCCCTGTAGCTGGG + Intergenic
1043932627 8:86108253-86108275 CACCTCAGCTTCCTGAGTATGGG + Intronic
1045308845 8:100982860-100982882 CACCTCAGCCTCCCAACGCTGGG - Intergenic
1046099440 8:109597598-109597620 CACCTCAGTCACCTGAGTAGTGG - Intronic
1046194583 8:110843508-110843530 CACCTCAGTCTCCTGAGTAGTGG + Intergenic
1046275904 8:111959315-111959337 CACTTCAGCCTCCTGTAGCTGGG + Intergenic
1046983694 8:120364086-120364108 CCCATGAGTCTCCTGAGTCTCGG + Intronic
1046997660 8:120542403-120542425 CACCTCAGCCTCCAAAAGCTGGG - Intronic
1047614301 8:126550575-126550597 CACCTCAGCCTCCTGAGTGCTGG + Intergenic
1048012052 8:130465764-130465786 CATCTCTGACTCCTGAGTCTGGG - Intergenic
1048017851 8:130513380-130513402 CACCTCAGCCTCCCAAGGCTGGG - Intergenic
1048685105 8:136896150-136896172 CACCTCAGCCTCCTGAGAGTTGG + Intergenic
1048752228 8:137692034-137692056 GACCTCAGACTCCCCAGGCTTGG + Intergenic
1049220014 8:141424869-141424891 CCCCTCAGTCCCCTGGGGCAGGG - Intronic
1049571396 8:143371817-143371839 CACCTTTGTCTCCAGAGGGTGGG + Intronic
1050193733 9:3057850-3057872 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1050302443 9:4273477-4273499 CACCTCAGCCTCCTGAGTAGTGG - Intronic
1050456304 9:5837971-5837993 CACCTCAGCCTCCTGAGTACAGG - Intergenic
1050990876 9:12150173-12150195 CACCTCAGGCTCCTGAGTGCTGG + Intergenic
1051521387 9:17992556-17992578 CACTTGAGTCATCTGAGGCTAGG + Intergenic
1051673115 9:19532194-19532216 TACCTCAGCCTCCTGAGGTAGGG + Intronic
1051871045 9:21738079-21738101 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1052456414 9:28705028-28705050 CACCTCAGCCTCCTGTATCTGGG + Intergenic
1053023449 9:34711358-34711380 CACCTCAGTCTCCTGAGTAGTGG + Intergenic
1053052049 9:34970174-34970196 CCACTAAGTCTCCTCAGGCTAGG + Intronic
1053130927 9:35615290-35615312 CACCCCAGTCCCCTTAGGCGTGG + Intronic
1054151387 9:61608609-61608631 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1054724185 9:68633934-68633956 CACCTCAGCCTCCTGAGTACTGG - Intergenic
1056103651 9:83325438-83325460 CACCTCAGCCTCCTATAGCTAGG + Intronic
1057616625 9:96596743-96596765 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1058436127 9:104965120-104965142 CACCTCAGCCTCCCAAAGCTGGG + Intergenic
1058450276 9:105090061-105090083 CAAGTCAGCCTCCTGAGGGTTGG + Intergenic
1058457983 9:105155947-105155969 CACCTCAGCCTCCTGAGTAGTGG - Intergenic
1058789669 9:108430121-108430143 CACCTCAGCCTCCAGTAGCTTGG - Intergenic
1059173795 9:112151046-112151068 TGCCTCAGCCTCCTGGGGCTAGG + Intronic
1059740222 9:117142862-117142884 CATCTGTGTCTCCAGAGGCTGGG + Intronic
1060106202 9:120875075-120875097 AACCTCAGCCTCCTGAGACAGGG - Intronic
1060177023 9:121504680-121504702 CACCTCAGCCTCTTGAGTATTGG + Intergenic
1060470829 9:123946815-123946837 CACCTCAGCCTCCTGAGCTACGG - Intergenic
1060647157 9:125290876-125290898 TACCTCAGCATCCAGAGGCTGGG - Intronic
1060648244 9:125301181-125301203 CACCTCAGCCTCCTGAGTGCTGG + Intronic
1060665695 9:125430946-125430968 GGCCTCAGCCTCCTGAGTCTAGG + Intergenic
1060804636 9:126566968-126566990 CACTTCAGCCTCTTGAGGTTGGG + Intergenic
1060932740 9:127498941-127498963 TGCCTCAGCCTCCTGAGTCTGGG - Intronic
1061042773 9:128149529-128149551 CCCCTAGGTCTCCTGTGGCTGGG + Exonic
1061502896 9:131013867-131013889 CAGCTGGGTCTCCTGAGCCTTGG + Intronic
1062477643 9:136736600-136736622 CACCTCAGCCTCCTGAGGAGCGG + Intergenic
1062599862 9:137314850-137314872 CACGTGAGTCTCCGGAGGCCGGG + Intronic
1185504362 X:620274-620296 CTCCTCGCTCTCCGGAGGCTCGG + Intergenic
1186420081 X:9418733-9418755 CACCTCAGTCTCCTGGGTAGTGG + Intergenic
1187318429 X:18219790-18219812 CACCTCAGCCTCCTGAGGAGCGG - Intronic
1187343362 X:18441299-18441321 CACCTCAGCCTCCTGAGTAGCGG - Intronic
1187663890 X:21582063-21582085 CATCTCTGTCTACTTAGGCTGGG + Intronic
1188331843 X:28882392-28882414 CACCTCAGCCTCCCAAAGCTGGG - Intronic
1189589115 X:42493197-42493219 CCCCTCAGTGGCCTGGGGCTTGG + Intergenic
1190078019 X:47332978-47333000 CACCTCAGCCTCCTGAGTAGCGG + Intergenic
1190226155 X:48546951-48546973 CACATGAGTTTCCTGAGGCTGGG - Intronic
1190509576 X:51162094-51162116 CACCTCAGTCTCATGAGTCATGG - Intergenic
1190824165 X:54001664-54001686 CACCTCAGACTCCTTTTGCTGGG - Intronic
1191734528 X:64375236-64375258 CTCCTCAGTCTCCTGAGTAGCGG - Intronic
1192116432 X:68416154-68416176 CACCTCAGCCTCCTGAGTAGTGG + Intronic
1192150699 X:68710615-68710637 CACCTCCCTCCCCTGATGCTAGG - Intronic
1192153468 X:68726225-68726247 CCCCTAAGCCTCCTGGGGCTGGG - Intergenic
1192154207 X:68731696-68731718 CATCTCAGCCTCCTGTAGCTAGG + Intergenic
1192367206 X:70483858-70483880 CACCTCAGTCTGCCCAGCCTAGG + Intronic
1192677112 X:73209626-73209648 CACCTCAGCCTCCTGAGTAGCGG - Intergenic
1193118055 X:77794643-77794665 CACCTCAGCCTCCTGAGTGCTGG - Intergenic
1193976758 X:88129740-88129762 CACCTCAGCCTCCTGAGTACTGG - Intergenic
1196909120 X:120468388-120468410 CCCCTTAGTCTCCAGAGGTTGGG + Intronic
1196950926 X:120875210-120875232 CACCTCAGCCGCCTGATGGTGGG - Exonic
1198134386 X:133732976-133732998 CACCTCAGCCTCGTAAAGCTGGG + Intronic
1198708613 X:139477021-139477043 CCCCTCTTTCTCCTGAAGCTAGG + Intergenic
1199769516 X:150965536-150965558 CACCTTAGCCTCCTAATGCTGGG + Intergenic
1199995782 X:153025302-153025324 CACCTCAGCCTCCTGAGAAGTGG + Intergenic
1200781084 Y:7216328-7216350 CACCTCAGCCTCCTGAGTAGGGG + Intergenic
1201265098 Y:12198691-12198713 CACCTCAGCCTCCTGAGTAGTGG + Intergenic
1202065540 Y:20935830-20935852 CACCTCAGTCTCCAAAGTGTTGG - Intergenic