ID: 1105325880

View in Genome Browser
Species Human (GRCh38)
Location 13:19370416-19370438
Sequence CCTGGAAAGCAGACTCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 1, 2: 4, 3: 28, 4: 318}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105325874_1105325880 6 Left 1105325874 13:19370387-19370409 CCCAGTGGGAGAAATGTTAGGTC 0: 2
1: 0
2: 2
3: 9
4: 143
Right 1105325880 13:19370416-19370438 CCTGGAAAGCAGACTCTGGATGG 0: 1
1: 1
2: 4
3: 28
4: 318
1105325875_1105325880 5 Left 1105325875 13:19370388-19370410 CCAGTGGGAGAAATGTTAGGTCA 0: 2
1: 0
2: 1
3: 8
4: 143
Right 1105325880 13:19370416-19370438 CCTGGAAAGCAGACTCTGGATGG 0: 1
1: 1
2: 4
3: 28
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105325880 Original CRISPR CCTGGAAAGCAGACTCTGGA TGG Intergenic
900345866 1:2210013-2210035 CCTGGAATGCAGCCTCAGGGTGG + Intronic
901217618 1:7563474-7563496 CCTGGACAGCAGGCTCTAGTGGG - Intronic
901608013 1:10474780-10474802 CCTGGAAAGCAGAGTCTTAACGG + Intronic
901943686 1:12683708-12683730 CCTGGGGAGAAGACTCTGGTTGG - Intergenic
904313762 1:29646562-29646584 TCTGGAAAGCAGACCTTGGCAGG + Intergenic
905276194 1:36819688-36819710 TGGGGAAAGCAGACCCTGGAAGG + Intronic
905862029 1:41358247-41358269 ACTGGGAAGCAGGCTCTGGCGGG + Intergenic
905879446 1:41454169-41454191 CCTGGAATGCATATTCTGGAAGG - Intergenic
908015954 1:59836300-59836322 CAGGAAAAGCAGACTTTGGAAGG + Intronic
908530100 1:65026165-65026187 TCTGGAAAGCAAACACTGGCTGG - Intergenic
908798667 1:67856349-67856371 CCCGGAAGCCAGCCTCTGGATGG - Intergenic
910592434 1:88940735-88940757 GGTGGAAAGGAGACTCTGGTTGG - Intronic
910667137 1:89738002-89738024 ACTGTAAAGCAGCCTCAGGAAGG - Intronic
910820457 1:91339315-91339337 CCTAGAATTCAGAATCTGGATGG + Intronic
910982831 1:92975640-92975662 CCTAGAAAACAGTCTTTGGAAGG + Intergenic
911235505 1:95407636-95407658 CCGGGCAAGCAGACGCTGCAGGG - Intergenic
911300510 1:96167098-96167120 AATGGAAACCAGATTCTGGATGG - Intergenic
912214712 1:107595339-107595361 CCTTGAAAGCAGAAACTGAAAGG - Intronic
913243625 1:116852250-116852272 CCTGAAAAGCAGACTCTGAAAGG + Intergenic
915982202 1:160427241-160427263 CCTGGAAAACAGGGCCTGGATGG + Exonic
916747062 1:167692857-167692879 CCAGGACAGCAGAGTCTGGCTGG + Intronic
917257016 1:173126411-173126433 CCTGGAAAGCTGTCTCTTGTGGG - Intergenic
918403316 1:184186772-184186794 AATTGAAAGCAGAATCTGGATGG + Intergenic
919915823 1:202138448-202138470 ACTGGAAAGAAGACTCAGAATGG + Exonic
920077850 1:203350145-203350167 CCTAGAAAGCTGAGTCTGAAGGG - Intronic
920117116 1:203628878-203628900 CTTGGGGAGCAGACTCTGGGAGG + Intronic
920531035 1:206702752-206702774 CCTGGAAGGCAAAGTGTGGAAGG - Intronic
920900519 1:210106136-210106158 CCTGGGAAGCAGACTCTGAGAGG + Intronic
921226962 1:213030183-213030205 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
921931211 1:220755672-220755694 CTGGGAGTGCAGACTCTGGATGG + Intronic
922117527 1:222628853-222628875 CCTGGAGAGCAGATTTTGGAAGG + Exonic
922976112 1:229784894-229784916 CCTGGCACACAGACCCTGGAAGG - Intergenic
1062930270 10:1348284-1348306 CGTGGAAAGCTGATTCAGGAAGG + Intronic
1064016076 10:11773291-11773313 CCTGAACAGCAGACATTGGATGG - Intergenic
1064388339 10:14919679-14919701 CCTGGAAAGCAGTGTTTGCAGGG + Intronic
1065918509 10:30371388-30371410 CCTGGAAGGCAGAGGCTGCAGGG + Intronic
1066163954 10:32765344-32765366 ACTGGAAAGGAAACTATGGAGGG + Intronic
1067212048 10:44267426-44267448 CCAGGAAAACAGGGTCTGGAGGG + Intergenic
1068956554 10:62823750-62823772 CCTAGAAAGCATCCTCTGAAGGG + Intronic
1069160360 10:65084639-65084661 CCTCAGAAGCAGATTCTGGAGGG + Intergenic
1069416691 10:68206817-68206839 CCAAGAAATCAGACGCTGGATGG + Exonic
1069708936 10:70477124-70477146 CCTGGAATGCATCCTCAGGATGG + Intergenic
1070766932 10:79062134-79062156 CCTGGAAGGCAAGCTCTGGTGGG - Intergenic
1071996151 10:91151362-91151384 CCTGGGAAGCAGACTCCAAAAGG - Intergenic
1072843154 10:98796993-98797015 CCTGGAAAGCATTCTCAAGAAGG + Intronic
1073930916 10:108575637-108575659 ACTGGAAAGTACACTCTGAAGGG - Intergenic
1075512196 10:123081524-123081546 CCTGGACAGCAGAACCTGGCTGG - Intergenic
1076067509 10:127460424-127460446 CATGAAAAGCAAACTTTGGAAGG + Intergenic
1077109074 11:854202-854224 CCTGGGGAGCAGCGTCTGGAAGG - Intronic
1078400045 11:11017957-11017979 AATGGAAAGTGGACTCTGGAAGG + Intergenic
1078562259 11:12383251-12383273 TCTGGCAAGTAGACTCTGAAAGG - Intronic
1078648119 11:13161167-13161189 CCTGGAAAGAAGAGTCTGGGTGG - Intergenic
1078903581 11:15663963-15663985 CTTGGAAAGGAGGCTCTGAAGGG - Intergenic
1079532995 11:21477560-21477582 CCTGGAAAGCCTTCTCAGGAAGG + Intronic
1079814455 11:25038619-25038641 ACTGGAATTCAGAATCTGGATGG - Intronic
1080523328 11:33087838-33087860 ACTGAAAAGAAGACTGTGGATGG - Intronic
1082812864 11:57489170-57489192 CCTGGAAGGCAGGTGCTGGATGG + Intronic
1084084271 11:66847747-66847769 GCAGGAAATCAGCCTCTGGATGG - Intergenic
1084365479 11:68694809-68694831 CCTGCAAAGCTGACTCTTGTGGG + Intergenic
1084925751 11:72510221-72510243 CCTGGGAAGCATGCTCTGGGAGG + Intergenic
1085050210 11:73376522-73376544 CGCGGAGAGCAGACTCTGGATGG - Intronic
1086523236 11:87696474-87696496 CATAGAAATCAGAATCTGGATGG - Intergenic
1088748350 11:112823094-112823116 CCTGGACTGCGGACTTTGGATGG - Intergenic
1088784367 11:113167373-113167395 TTTGGGCAGCAGACTCTGGAAGG - Intronic
1088896112 11:114079726-114079748 CTCGGAAGGCAGATTCTGGAAGG + Intronic
1089127758 11:116189409-116189431 GCTGGAAAGGAGAGGCTGGATGG - Intergenic
1089268827 11:117287147-117287169 CCTGGAAAGCCCACTCTTGCAGG + Exonic
1090142398 11:124278332-124278354 CATGGAATTCAGAATCTGGATGG + Intergenic
1090964814 11:131589456-131589478 CCTGGACTGCAGTTTCTGGATGG - Intronic
1091386149 12:96478-96500 CCTGGAAAGCTGTCTCTTGTGGG - Intronic
1091613654 12:2032939-2032961 CCTCGAAAGCAAGCACTGGAGGG - Intronic
1091777479 12:3193983-3194005 CCTGGAAAGCAGGCTATCCAAGG - Intronic
1091786997 12:3249094-3249116 CCTGGGAAGCAGACTCTGGCAGG - Intronic
1092238251 12:6822746-6822768 CCTGGAGAGGAGGCTTTGGAGGG - Intronic
1093179765 12:15953714-15953736 CCTGGAAAGGAGACGCTAAAGGG + Intronic
1093191673 12:16081996-16082018 CCAGGAAAGCAGACTATACAAGG + Intergenic
1094813536 12:34163724-34163746 CCTGGGAAGGAGACTCTGCCAGG + Intergenic
1096492952 12:52023086-52023108 CGTGAAAAGCAGACTCCGGCAGG - Intronic
1096957879 12:55545643-55545665 CCAGGAAAACAGGGTCTGGAGGG - Intergenic
1098088197 12:66871183-66871205 TCTGGAATGCAGACTGTTGAAGG + Intergenic
1098301280 12:69056449-69056471 AATGGAGACCAGACTCTGGAAGG + Intergenic
1099065532 12:77973634-77973656 CCTGGAAAAGATACCCTGGAAGG - Intronic
1101076393 12:101133773-101133795 CCTGGGAAGCAGACTCTAATAGG - Intergenic
1103783597 12:123415753-123415775 CCTTCAAAGCAGACTGAGGAGGG - Exonic
1104530576 12:129566638-129566660 CCTGCAAAGCTGTCTCTGGTGGG + Intronic
1105325880 13:19370416-19370438 CCTGGAAAGCAGACTCTGGATGG + Intergenic
1105767179 13:23573166-23573188 GTTGGAAAGCAGACCCTGCATGG - Intronic
1105782368 13:23715958-23715980 CCTGGACTCCAGACTCTAGAGGG + Intergenic
1105867627 13:24474678-24474700 CCTAGAAAGCAGACTCTGGATGG - Intronic
1106193593 13:27475030-27475052 CCTGGAACACAGACCCAGGAAGG + Intergenic
1106771739 13:32967995-32968017 CATGTAAGGCAGACCCTGGAAGG + Intergenic
1106910792 13:34461513-34461535 TCTGCAAAGCAGAACCTGGAAGG - Intergenic
1106942122 13:34791017-34791039 CCTGGTTTGCAAACTCTGGATGG + Intergenic
1107275813 13:38678099-38678121 CCAGGGAAGGAGACTTTGGAAGG - Intergenic
1109181695 13:59221608-59221630 CCTGGGAAGCTGACTCTGAGTGG - Intergenic
1110966977 13:81712602-81712624 CATGGAATTCAGAGTCTGGATGG - Intergenic
1113440530 13:110324696-110324718 CCTAGAAGACAGCCTCTGGAGGG + Intronic
1114245741 14:20911455-20911477 CCAGGAAAACAGGGTCTGGAGGG + Intergenic
1114938440 14:27574126-27574148 CATGGAATTCAGAATCTGGATGG + Intergenic
1117441407 14:55762840-55762862 CCTGAAAAGCAGATTCGTGAGGG + Intergenic
1117904920 14:60574896-60574918 CGGGGAAGGGAGACTCTGGATGG + Intergenic
1118169004 14:63366983-63367005 CCTGAAAAGCATATTCTGGAGGG + Intergenic
1119415152 14:74464964-74464986 CCTGGAAAGCAGGTTCTTGGAGG + Intergenic
1120723388 14:87911719-87911741 CCCTGAAGGCAGACTCTGGAAGG - Intronic
1122357473 14:101132310-101132332 CCTGGCAAGCAGCCACGGGAGGG - Intergenic
1123805597 15:23869189-23869211 CCTGAAAAGCTGAATCTGAAAGG - Intergenic
1125687821 15:41573824-41573846 CCTGGGAAGGGGGCTCTGGAAGG + Intronic
1126740913 15:51775263-51775285 GCTGGGAACTAGACTCTGGATGG - Intronic
1127646947 15:60968232-60968254 CCTGCTGAGCTGACTCTGGAAGG + Intronic
1127648563 15:60983404-60983426 CCTGCAAAGCTGTCTCTGGTGGG + Intronic
1127972780 15:63974748-63974770 CCTGCAAAGCTGACTCTTGTGGG - Intronic
1128381349 15:67115379-67115401 CCATCAAAGCAGACTGTGGAGGG - Intronic
1128712702 15:69884184-69884206 CCTGGAAAGAAGACTCACCAAGG + Intergenic
1129210442 15:74065001-74065023 CCTGGAAAAGAGAGGCTGGAAGG - Intergenic
1129294396 15:74591929-74591951 CCTGGAAGGCAGAACCTGGAGGG - Intronic
1129727636 15:77909632-77909654 CCTGGAAAACAGGGGCTGGAAGG - Intergenic
1130048933 15:80467493-80467515 GCTGGAATGCAGACTCTAGGTGG + Intronic
1131040922 15:89266102-89266124 CTTGGGAAGCAGAGGCTGGAGGG - Intronic
1131319635 15:91374786-91374808 ACTGGAAAGCAGAATCTGAGTGG - Intergenic
1133864222 16:9626793-9626815 CCTGCAAGGGAGACACTGGATGG + Intergenic
1136088968 16:27904670-27904692 GCTGGAAAGGAGCCTCAGGAAGG - Intronic
1136711450 16:32240408-32240430 CCTGGCAAGCATACTGTGGTGGG - Intergenic
1137609943 16:49811446-49811468 CCTGCTAAGCACACTCTGGGTGG - Intronic
1137791674 16:51180133-51180155 CCTGGATACCAGTTTCTGGAAGG - Intergenic
1138753968 16:59459596-59459618 CCTGGGAAGCAGATTATGGAAGG + Intergenic
1140995755 16:80258230-80258252 CATGGACAGCAGACACTGGAGGG + Intergenic
1141344187 16:83230330-83230352 CCGGGAAAGCAGGCACAGGAAGG + Intronic
1142321933 16:89388788-89388810 CCTGGGAAGAAGGTTCTGGAAGG + Intronic
1143544371 17:7587920-7587942 CCTGGAAGACTGAGTCTGGACGG + Exonic
1143726515 17:8850612-8850634 TCTGGGGAGCAGACTCTGGGAGG - Intronic
1145910498 17:28539363-28539385 CCTGGAGAGTGGTCTCTGGATGG + Intronic
1146825838 17:36022828-36022850 CCAGGCAAACAGAGTCTGGAGGG - Intergenic
1147270676 17:39268426-39268448 CCTGGAGACCTGACTCTGCATGG - Intronic
1148384437 17:47223870-47223892 CCAGGAGAGCAAGCTCTGGAAGG + Intergenic
1148777058 17:50101817-50101839 CCTGGAAAGCAGGGTTTGGGTGG + Intronic
1148887936 17:50787043-50787065 CCTGGGATCCAGACTGTGGAGGG - Intergenic
1149703816 17:58677312-58677334 ACTGGAAATCAAACTCAGGAAGG - Intronic
1149883070 17:60312162-60312184 GCTGGAAAGCAGCCCCTGGGTGG + Intronic
1149990206 17:61379001-61379023 CCTGGAGAGGGGACTCTGAAGGG - Intronic
1150554257 17:66239589-66239611 GCTGAACAGCTGACTCTGGAGGG - Intronic
1151320312 17:73348846-73348868 CCTGGAAGGCAGACCCAGGAAGG - Intronic
1153490893 18:5646758-5646780 TTTGGAAAGCAGAGTCTGGCCGG - Intergenic
1154170410 18:12047016-12047038 CCCGGACTCCAGACTCTGGAAGG - Intergenic
1155083326 18:22431569-22431591 CTTGGAAAACAGGGTCTGGAAGG - Intergenic
1156470323 18:37373720-37373742 GCTGGAAAGCAGCCTGGGGAGGG + Intronic
1157225603 18:45860479-45860501 ACTGGAAGGAAGGCTCTGGATGG + Intronic
1157402473 18:47400012-47400034 ACTGGAACCCAGTCTCTGGATGG - Intergenic
1158537485 18:58321331-58321353 GCTGGACAGCTGACTCTGGATGG - Intronic
1160327767 18:77966670-77966692 AATGGAATGCAGACACTGGATGG - Intergenic
1160451395 18:78968740-78968762 ACTGGGAAGCAGGCTCAGGAGGG - Intergenic
1160835110 19:1121226-1121248 CCAGGAAAGCAGTCTGAGGAAGG + Intronic
1161584106 19:5095875-5095897 CCTGGGAATCAGACCCTGGCAGG + Intronic
1164438291 19:28251403-28251425 CCAGGAGAGCAGACCCTGGTGGG - Intergenic
1165692032 19:37871090-37871112 CCTGCAAAGCTGACTCTTGTGGG - Intergenic
925823577 2:7824353-7824375 CCTGGACACCAGGATCTGGAAGG + Intergenic
926134256 2:10325587-10325609 CCTGCTAAGCAGGCCCTGGAGGG + Intronic
926330441 2:11821214-11821236 CCTGGAAAAGAGCCTCTGGCAGG + Intronic
926556666 2:14365614-14365636 ACTTGAAAGCAGATTCTGGTTGG + Intergenic
929032085 2:37658614-37658636 CCAGGAAAGCATAGTTTGGAAGG - Intronic
930284758 2:49413874-49413896 CCTGGAAAGCTGGGTCTGAATGG + Intergenic
933280781 2:80330678-80330700 CCTGGAAGGCAGCTTCTGAAGGG - Intronic
935320243 2:101880297-101880319 GCTGTAAAGCAGATTCTAGAAGG - Intronic
935387853 2:102519993-102520015 CCTTGAAAACAGTCTCTGAAGGG + Intronic
936234489 2:110731866-110731888 CCAGCAAAGTAGCCTCTGGAAGG + Intergenic
936969313 2:118161651-118161673 CCTGCAAAGCTGTCTTTGGAGGG - Intergenic
937093205 2:119220324-119220346 CATGGAAAGCAGAATCTGTGAGG + Intergenic
937499519 2:122462809-122462831 CATGGGAACCAGATTCTGGAGGG + Intergenic
938114891 2:128596256-128596278 CCTGGCAGGAAGAATCTGGAGGG + Intergenic
938998264 2:136703697-136703719 ACTGGAAAACAGGCACTGGATGG - Intergenic
939113127 2:138031214-138031236 CCTGGAAAACACAGTCTGCAGGG + Intergenic
940151053 2:150601092-150601114 CCTGGAAATCAGACTAGGTATGG - Intergenic
942329228 2:174804483-174804505 AGTGGAAAACAGACTGTGGAAGG + Intronic
942412836 2:175729522-175729544 CTTGGAGAGGAGACTCAGGAAGG - Intergenic
942743459 2:179205825-179205847 GATGGAAAGGAGACTCTAGAAGG - Intronic
943528913 2:189053948-189053970 CCTAGAAAGCAGATTTTAGATGG + Exonic
945155553 2:206833885-206833907 GCTGGAAAGTAGACTCTGGATGG + Intergenic
947617647 2:231568715-231568737 CCTGGAAGGCTAACTCTGGAAGG - Intergenic
948143752 2:235693106-235693128 CTTGGGAAGGAGGCTCTGGAAGG + Intronic
948526707 2:238575167-238575189 CCGGGAAAGAAAACTCAGGAAGG - Intergenic
1169873590 20:10272553-10272575 TCTAGAAAACAGACACTGGAAGG - Intronic
1171985120 20:31654809-31654831 CCTGGAAAACAAACTGTAGAGGG - Intergenic
1174159084 20:48537679-48537701 CCTGCAAAGCTGTCTCTGGTGGG - Intergenic
1174276453 20:49407956-49407978 CCTGGAAAGCGGAGGCTAGAGGG - Intronic
1174670527 20:52303453-52303475 CCTGAAAAACAGACTTCGGAAGG - Intergenic
1174794406 20:53510363-53510385 CCTGGGAAGCAGACCAAGGAGGG - Intergenic
1175303016 20:57956314-57956336 CCTGGGAAGGAGACTGTGGCAGG - Intergenic
1176024211 20:62977587-62977609 CCTGGAAAGCAGGGCCCGGAGGG + Intergenic
1176033054 20:63023133-63023155 CCTGGGAAGGAGACTCAGGACGG - Intergenic
1177649490 21:23941972-23941994 CCTGCAAAGCTGACTCTTGTGGG + Intergenic
1178287368 21:31336888-31336910 TCAGGAAAGCTGACTCTGGCGGG + Intronic
1179046810 21:37852101-37852123 CCTGGAAAGCAAAGGCTGGGTGG + Intronic
1181088941 22:20458884-20458906 CCTGGACTGCAGGCTCTGTAAGG + Intronic
1181556639 22:23675235-23675257 CCTTGAGAGAAGAATCTGGAGGG - Intergenic
1181697750 22:24602348-24602370 CCTTGAGAGAAGAATCTGGAGGG + Intronic
1181988354 22:26817653-26817675 GTTGGAAAACAGACTGTGGAAGG + Intergenic
1182416643 22:30225570-30225592 CCTAGAAATCGGGCTCTGGAAGG - Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1183290338 22:36998227-36998249 ACTGGAAGGCAGGATCTGGAAGG + Intronic
1184455144 22:44605906-44605928 CCTGGAGGGGAGGCTCTGGACGG + Intergenic
1185191310 22:49438241-49438263 CCTGGACAGCAGCCTCAGAAAGG + Intronic
951066037 3:18266629-18266651 CCTGCAAGGCAGACTCTAAATGG + Intronic
953443565 3:42941783-42941805 CCTGGGAAGAAGAGTCAGGATGG - Intronic
953588051 3:44222965-44222987 CGTGGGAAGCAGACTCAGTAGGG - Intergenic
954540315 3:51389394-51389416 ACTGGAAAGCAGAAACTGGTAGG - Exonic
954923320 3:54210751-54210773 CCTGGATGGCAGACTCTTCAGGG - Intronic
955380121 3:58431697-58431719 AGTGGGAAGCAGACCCTGGAGGG - Intronic
955478069 3:59360066-59360088 CCAGGCAAACAGAGTCTGGAGGG - Intergenic
956153444 3:66267929-66267951 ACTGGGAAGGAGACTTTGGAGGG - Intronic
957014604 3:75048277-75048299 CCTGGATAGCATACTCATGATGG - Intergenic
957254912 3:77824813-77824835 CATGGAATTCAGAATCTGGATGG - Intergenic
957804679 3:85132485-85132507 CCAGGGAAGCACCCTCTGGAAGG - Intronic
959116202 3:102181741-102181763 CTTGGGAAGCAGACTCTAGGTGG - Intronic
959494308 3:107031278-107031300 CATGGAATTCAGAATCTGGATGG + Intergenic
959883744 3:111475164-111475186 CTGGGAAAGCAGGCTCAGGATGG - Intronic
961422593 3:126818070-126818092 CCTGTAAAGCAAAGTCTGGCAGG + Intronic
963442265 3:145355463-145355485 ATTGGAAGGCAGAGTCTGGATGG + Intergenic
963590692 3:147254349-147254371 CCTGGAAGTCAGAGTCAGGAGGG - Intergenic
966651015 3:182301161-182301183 CCTGGAAAGCAGCCCCAGGTAGG + Intergenic
968638453 4:1696257-1696279 CCAGCAAATCAAACTCTGGAAGG - Exonic
968822408 4:2864709-2864731 CCTGGAGAGTAGACTCCAGAGGG - Intronic
969505162 4:7581773-7581795 CCTAGCATCCAGACTCTGGACGG - Intronic
970517403 4:16846515-16846537 CATGGAAATCAGACTTTTGAAGG + Intronic
971372061 4:26027759-26027781 GCTGGAAGGCAGAGTCTGGTTGG + Intergenic
972752775 4:42008641-42008663 CCTGCAAAGCAGACTTGAGAAGG + Intronic
973261269 4:48166247-48166269 CATGGAAAGCTGGCTCTGGGGGG - Intronic
973696971 4:53499704-53499726 CCTGAAAAGCAGAGTCTTTAAGG - Intronic
973803190 4:54498582-54498604 CCTGGACATCATATTCTGGAGGG - Intergenic
976975860 4:91165581-91165603 CCTGGGAAGCTCACACTGGATGG - Intronic
977731852 4:100363244-100363266 CAGGGAAAGCCCACTCTGGAAGG - Intergenic
978168590 4:105640501-105640523 ACTGGACTGGAGACTCTGGAAGG - Intronic
979960119 4:127008954-127008976 CCTGGAAAGCCTACCATGGAAGG + Intergenic
980146222 4:128987203-128987225 CGTGGAAAGCCCACTCTAGAAGG + Intronic
983238969 4:165209477-165209499 GTGGGAAAGCAGCCTCTGGAGGG + Intronic
984256655 4:177397681-177397703 CCTAGAAAGCAGAATTTGAATGG - Intergenic
984640955 4:182163715-182163737 ACTGAAAAGTAGACTCTGGGAGG - Intronic
984956301 4:185049421-185049443 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
985991263 5:3563852-3563874 CCTCTCCAGCAGACTCTGGAAGG - Intergenic
987928897 5:24377540-24377562 CCAGAAAAGCATCCTCTGGATGG - Intergenic
988342152 5:29986427-29986449 CCTGGGAAGCAGAGGCTGAAGGG + Intergenic
990555861 5:56935044-56935066 TCTGGAAAGAAAACTCTTGAGGG - Intronic
992720525 5:79556672-79556694 CCTAGGAAGCAAAATCTGGAAGG - Intergenic
997522791 5:134534034-134534056 CTTGACACGCAGACTCTGGAAGG + Intronic
997640392 5:135445110-135445132 CCTGCCAAGGAGACCCTGGAGGG - Exonic
997803301 5:136888652-136888674 CCTGGAGAGAAAACTCTGAATGG - Intergenic
998761698 5:145439463-145439485 CCTGTAAAGCAGACACTGACTGG - Intergenic
999381344 5:151123641-151123663 CATGGAAAGGAGGCTCAGGAGGG + Intronic
999536885 5:152527415-152527437 GCTGGTAAGCAGACTCTTGCAGG + Intergenic
1000617606 5:163446084-163446106 CCTGTAAAGTAGACACTGCAAGG + Intronic
1001067211 5:168545797-168545819 CCTAGCAAGCAGACTCAGAAGGG - Intergenic
1001943288 5:175755881-175755903 CCTGGGAAGCAGAGGCTGCAGGG + Intergenic
1001975415 5:175994745-175994767 GCTGGGAAACAGACTCAGGAGGG + Intronic
1002078941 5:176726501-176726523 CCTGGAAGGCCGCCTCTGAATGG + Intergenic
1002242018 5:177849025-177849047 GCTGGGAAACAGACTCAGGAGGG - Intergenic
1003807288 6:9739322-9739344 CCTGGCAAACCCACTCTGGAGGG + Intronic
1005445059 6:25914445-25914467 CCTCTAAATCAGACTCTGGTAGG - Intronic
1007159348 6:39776273-39776295 ACTAGAAGGCAGACTCAGGAGGG - Intergenic
1007703157 6:43775953-43775975 TCTGGAAAGCAGACCTTGGAGGG + Intronic
1007816766 6:44530514-44530536 CCTGGGAAGCAGACTCTGAGAGG + Intergenic
1009323704 6:62323381-62323403 ACTGGAAAGCAGAATATGGCAGG + Intergenic
1009327868 6:62376148-62376170 CTTGAAAAGCAGTCCCTGGATGG + Intergenic
1009831259 6:68938998-68939020 GCTGGGAAGTAGACTCTGAATGG - Intronic
1013085919 6:106857602-106857624 CCTGGAAAACAGATTCTGAGAGG + Intergenic
1013298322 6:108780202-108780224 GCTGGGTAGCTGACTCTGGAGGG + Intergenic
1013824764 6:114197965-114197987 CATGGAATTCAGAATCTGGATGG + Intronic
1014624697 6:123711241-123711263 TCTGATAAGCAGATTCTGGATGG - Intergenic
1018145072 6:160878047-160878069 CATGGAATTCAGAATCTGGACGG + Intergenic
1018252042 6:161881168-161881190 CCTGGAAAACAGATGTTGGAGGG + Intronic
1018504158 6:164445797-164445819 ACAGGAATGCAGTCTCTGGATGG + Intergenic
1018839095 6:167506186-167506208 CCCAGAAAGGAGACTCAGGATGG - Intergenic
1018911294 6:168101907-168101929 CCTGGACAGCACACTCGGAACGG + Intergenic
1020718985 7:11717456-11717478 CATGGAAAGCAGAAAATGGAGGG - Intronic
1021549559 7:21855324-21855346 CCTGGCCAGCAGACTCTTTAAGG + Intronic
1021568478 7:22038717-22038739 CCTGAAAAGCAGAAGCTGCAGGG - Intergenic
1024452627 7:49564732-49564754 CATAGAATGCAGAATCTGGATGG + Intergenic
1024507593 7:50175389-50175411 CCAGATAAGCAGACTCTGGCTGG - Intergenic
1024670383 7:51588723-51588745 CCTGGAAAGCAGACTCATCCTGG + Intergenic
1024801697 7:53087187-53087209 CCTGGGAAGAATACTTTGGAGGG + Intergenic
1026501313 7:70945480-70945502 CCTGCAAAGCTGTCTCTTGAGGG + Intergenic
1026506136 7:70985749-70985771 CCTTTAAAGCATAGTCTGGATGG - Intergenic
1026894696 7:74003258-74003280 CCTGGAGATAAGATTCTGGAAGG - Intergenic
1026894713 7:74003335-74003357 CCTGGAAATAAGATTCTGGAAGG - Intergenic
1026894732 7:74003413-74003435 TCTGGAAAGAAGATTCTGGAAGG - Intergenic
1026894747 7:74003490-74003512 CCTGGAAAGAAGATTCTGGAAGG - Intergenic
1027826236 7:83119541-83119563 CCTGGAAAGCATTCTCAAGAAGG + Intronic
1029617166 7:101666214-101666236 CCCGGGATGCAGACTCTGGATGG - Intergenic
1031883322 7:127220858-127220880 CCTAGAAAGCAGATTCTGGGAGG - Intronic
1032401806 7:131629240-131629262 GCTGGGGAGCAGACTCTGCAGGG + Intergenic
1032804195 7:135339332-135339354 CCTGGAAGGGAGACTCTTCATGG - Intergenic
1033064764 7:138144136-138144158 CTGGGAAAGGAGACTCTGAAAGG + Intergenic
1033915632 7:146321845-146321867 AATGGAAAGCAGCCTCTGTATGG + Intronic
1034718729 7:153267649-153267671 CCTGGAAAGGAGACCCTTGCAGG - Intergenic
1035449601 7:158967996-158968018 CCTGCAAAGCTGTCTCTGGTGGG - Intergenic
1035545391 8:478237-478259 CCAGGAAAGGAGACTCTAGAGGG + Intergenic
1035646064 8:1222051-1222073 CATGGAATTCAGAATCTGGATGG - Intergenic
1036225710 8:6955855-6955877 ACTGGAAAACAGATTGTGGATGG - Intergenic
1036827583 8:11990004-11990026 CCTGCAAAGCTGTCTCTTGATGG + Intergenic
1037046552 8:14312509-14312531 CTTGGAAAGCTGAGTCAGGAGGG + Intronic
1037487412 8:19361282-19361304 GCTGGAAAGAAGACTCGGAATGG + Exonic
1038458222 8:27692553-27692575 CCTGCAAAGCTGTCTCTGGTGGG + Intergenic
1038610938 8:29059818-29059840 CCAGGGAGGAAGACTCTGGAGGG - Intronic
1038727994 8:30098714-30098736 CATGGAACTGAGACTCTGGAGGG - Intronic
1040578259 8:48673537-48673559 CTTGGATAGCTTACTCTGGAAGG + Intergenic
1043728708 8:83647335-83647357 TCTGGAAAGCAGGGACTGGAGGG - Intergenic
1043865885 8:85375308-85375330 CCTGGAAAGAAGGCTTCGGAGGG + Intronic
1044092300 8:88016829-88016851 CCTGGGCAGCAGAATCTTGATGG - Intergenic
1046524070 8:115361511-115361533 TCTGGAAAGGTGACTGTGGATGG - Intergenic
1046553804 8:115751187-115751209 GCTGCACAGCAGATTCTGGAGGG - Intronic
1047628285 8:126678819-126678841 GCTGGCAAGCAGAGGCTGGACGG - Intergenic
1047681071 8:127254580-127254602 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1048831850 8:138485348-138485370 CCTTGAATGGAAACTCTGGATGG - Intronic
1049570597 8:143368706-143368728 CCAGGAAGGCGGGCTCTGGACGG - Intergenic
1050416006 9:5418549-5418571 GCTGGACAGCAGCCTCTGCAAGG - Intronic
1051209236 9:14724038-14724060 CCTGGAAAACAGACTCCAGTGGG - Intergenic
1055343538 9:75310519-75310541 CCTGGGATGGAGCCTCTGGAGGG - Intergenic
1055550644 9:77429369-77429391 CCTGGATACCAGACTCAAGAGGG + Intronic
1055819846 9:80248498-80248520 CCTGGAAAGGACACAGTGGATGG + Intergenic
1056935495 9:90912581-90912603 CCTGGGAAGCTGGCTCTGGGAGG - Intergenic
1057518633 9:95742354-95742376 CCTCTAACGCAGACTCTGGCTGG + Intergenic
1057906195 9:98985557-98985579 CCTGGGAAGCAGTCTCTGCAGGG - Exonic
1058531824 9:105913515-105913537 CCTGCAAAGCTGACTCTTGTGGG + Intergenic
1060016672 9:120092631-120092653 TCTGGGAACCAGACTCTGGAAGG + Intergenic
1060628117 9:125131661-125131683 CTGTGAAAGCAGACTCTGCAGGG - Intronic
1060878756 9:127102958-127102980 CCTTGAAGGCTGACTCAGGATGG + Intronic
1061364294 9:130163388-130163410 CCTGGGAAGCAGAGGCTGCAGGG - Intergenic
1061500392 9:130998336-130998358 CCCAGAAAGCAGCCTCGGGAAGG + Intergenic
1061509565 9:131052338-131052360 CCTGCACAGCAGACCCTGCAGGG - Intronic
1062514021 9:136923054-136923076 CTTGGAAAGCAGCCTCTGCCGGG + Intronic
1185433467 X:23220-23242 GATTGAAAGCAGAGTCTGGAAGG + Intergenic
1185442673 X:235288-235310 GATTGAAAGCAGAGTCTGGAAGG + Intergenic
1185464974 X:349057-349079 CCAGGAAACCAGAATCAGGAGGG + Intronic
1186090184 X:6038385-6038407 CCTGGAGAACAGACTCTAGCTGG + Intronic
1187084750 X:16030214-16030236 CCTGGAAAGCAAATTCTGTGAGG - Intergenic
1187303176 X:18071506-18071528 TTTAGAAAGAAGACTCTGGAAGG + Intergenic
1187590840 X:20715471-20715493 CCTGGCAAGAACACTCAGGAGGG - Intergenic
1187824920 X:23325179-23325201 CCTGAAAAGCAGAGTCGGGCAGG - Intergenic
1188947525 X:36325514-36325536 CCTGGGAAGAAGACTCTGAAAGG + Intronic
1188954496 X:36418155-36418177 CCAGGCAAACAGAGTCTGGAGGG - Intergenic
1189586906 X:42471075-42471097 TCTGGAAAGTAGACTCTGGGTGG - Intergenic
1189616008 X:42784951-42784973 CCAGCAAAGCAGACTCTAAAAGG + Intergenic
1190602559 X:52107809-52107831 CCTGGAAAGCCTACCCAGGAAGG - Intergenic
1190831738 X:54064949-54064971 CCTTGAAAGTAGACTCTTGGTGG + Intergenic
1191898651 X:66019269-66019291 CCTAGATAGGAGACTCTGGGAGG - Intergenic
1192209366 X:69117857-69117879 CCTGGAAGACAGTCTCTGAAGGG - Intergenic
1193979791 X:88168359-88168381 CCTAGAATTCAGAATCTGGATGG - Intergenic
1195842844 X:109192864-109192886 CCAGGAAAACAGTGTCTGGAGGG + Intergenic
1197640849 X:128966519-128966541 CTTCCAAAGCAGACTCTGGTTGG - Intergenic
1199156271 X:144552035-144552057 CCTGGAAAGCAGTCCCAAGAAGG + Intergenic
1201784875 Y:17764286-17764308 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1201816677 Y:18141701-18141723 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1202048015 Y:20753485-20753507 CCTGCACAGCTGACTCTGCATGG - Intergenic
1202344692 Y:23909107-23909129 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1202526076 Y:25760976-25760998 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic