ID: 1105326776

View in Genome Browser
Species Human (GRCh38)
Location 13:19377514-19377536
Sequence AAATACCTACGTATTTCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105326773_1105326776 6 Left 1105326773 13:19377485-19377507 CCTATGTGAGTTGGTAAATGTTT 0: 2
1: 0
2: 1
3: 22
4: 260
Right 1105326776 13:19377514-19377536 AAATACCTACGTATTTCCCTAGG 0: 1
1: 1
2: 0
3: 17
4: 117
1105326772_1105326776 9 Left 1105326772 13:19377482-19377504 CCTCCTATGTGAGTTGGTAAATG 0: 2
1: 0
2: 2
3: 6
4: 93
Right 1105326776 13:19377514-19377536 AAATACCTACGTATTTCCCTAGG 0: 1
1: 1
2: 0
3: 17
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105326776 Original CRISPR AAATACCTACGTATTTCCCT AGG Intergenic
901359672 1:8686313-8686335 GAATTTCTACGTAATTCCCTAGG - Intronic
903073769 1:20745302-20745324 AAATAATTACATATTTCCCTAGG - Intronic
906101317 1:43265028-43265050 AAATACCTATGTTTTTAACTTGG - Intronic
908443202 1:64176214-64176236 TCATACCAACGTATATCCCTAGG - Intronic
911168330 1:94744928-94744950 AATTACCTATTTATTTCCCTAGG - Intergenic
913544295 1:119852018-119852040 AGATACATACTTATTTTCCTGGG + Intergenic
913602490 1:120435331-120435353 AGATACATACTTATTTTCCTGGG - Intergenic
914084558 1:144441176-144441198 AGATACATACTTATTTTCCTGGG + Intronic
914190570 1:145406442-145406464 AGATACATACTTATTTTCCTGGG + Intergenic
914363662 1:146958963-146958985 AGATACATACTTATTTTCCTGGG - Intronic
914488013 1:148128163-148128185 AGATACATACTTATTTTCCTGGG + Intronic
914588376 1:149083316-149083338 AGATACATACTTATTTTCCTGGG + Intronic
923264603 1:232302239-232302261 ATATAGCTACGTAATTTCCTTGG - Intergenic
923936995 1:238773241-238773263 AAAAACCTCTGTATTTCACTAGG - Intergenic
1063627520 10:7704444-7704466 AAATACCTACATTTTTAACTTGG + Intronic
1064750691 10:18525314-18525336 AAAAACCTTCTCATTTCCCTAGG + Intronic
1068302904 10:55168499-55168521 AAATAGCTAGATATTCCCCTAGG + Intronic
1068948520 10:62754401-62754423 AAATATCTAGAAATTTCCCTAGG + Intergenic
1072211392 10:93249691-93249713 TAATACCTGCGTAATTCACTCGG + Intergenic
1073549497 10:104384759-104384781 AAATACCTTGATATTTGCCTTGG + Intronic
1073603145 10:104866464-104866486 AAAAACCTAGGTACTTCCTTAGG + Intronic
1073605643 10:104893213-104893235 AAATACCTGCCCATTTTCCTTGG - Intronic
1074887869 10:117708648-117708670 AAATGCCTACCCATTCCCCTGGG + Intergenic
1077492045 11:2865907-2865929 AAATAGCCATATATTTCCCTTGG - Intergenic
1080697385 11:34614479-34614501 AAATGCCTAAGGATCTCCCTGGG + Intergenic
1081349713 11:42035743-42035765 ACATACCTAATTATTTCCCTAGG + Intergenic
1086918804 11:92562373-92562395 AAATCCGTACGTATTTATCTTGG - Intronic
1087940941 11:104096033-104096055 AAGTGCCTAAGTAATTCCCTTGG - Intronic
1093364118 12:18271400-18271422 AAATACTCATGTTTTTCCCTAGG + Intronic
1093657976 12:21719446-21719468 TAATACTTACACATTTCCCTGGG + Intronic
1098523219 12:71457253-71457275 AAATATGTAGGTATTTCCCACGG - Intronic
1098580202 12:72090655-72090677 AAATATCTACCTATATCCCTGGG - Intronic
1098850916 12:75594739-75594761 AAAAACCTACCTATTATCCTTGG - Intergenic
1105326776 13:19377514-19377536 AAATACCTACGTATTTCCCTAGG + Intergenic
1105866756 13:24467778-24467800 TAATACTTACATATTTCCCTAGG - Intronic
1106028832 13:25980013-25980035 AAATACATACGGTTTTCCCTGGG - Intronic
1106320060 13:28629410-28629432 AAATACCTAAGCATTTCCTCTGG - Intergenic
1108174811 13:47781525-47781547 ATATACATATGTATTTCTCTTGG - Intergenic
1109239121 13:59861968-59861990 AAAAATATACGTATTTGCCTTGG + Intronic
1112448397 13:99488043-99488065 AAATGCCTACCAATTTTCCTTGG - Intergenic
1112489648 13:99850044-99850066 ATATACCTATGTCTTTCTCTAGG - Intronic
1112764900 13:102730814-102730836 AAATACCTTCGTTTTCTCCTGGG - Exonic
1114010518 14:18361531-18361553 AAATAAGTACGTATTTCCAGTGG + Intergenic
1121360065 14:93248719-93248741 AAATACATGCTTTTTTCCCTTGG - Intronic
1126969649 15:54096064-54096086 ACATACCTACATATCTTCCTTGG - Intronic
1127425455 15:58851326-58851348 ATCTTCCTAAGTATTTCCCTTGG - Intronic
1130880511 15:88051658-88051680 AAATACTTACGTAAAGCCCTTGG + Intronic
1138627844 16:58266654-58266676 AAATCACTGCGTCTTTCCCTTGG + Intronic
1142092067 16:88219708-88219730 AAATTCCAACCTACTTCCCTGGG + Intergenic
1144383043 17:14721850-14721872 AAATACCTAGGTGTATTCCTAGG + Intergenic
1145856144 17:28160018-28160040 AACTGCCTACCTATTTCCCCTGG - Intronic
1147411169 17:40253627-40253649 AAATAAAAAGGTATTTCCCTTGG + Intronic
1148819660 17:50353288-50353310 AAATATCTACGTGTGTCCCAAGG - Intronic
1150866235 17:68853243-68853265 GAATACATACGTATATGCCTCGG - Intergenic
1153290800 18:3499637-3499659 AAATACCCACTTCCTTCCCTTGG - Intronic
1154947987 18:21181140-21181162 AAATACATACCGATTTCCATGGG - Intergenic
1157354381 18:46918937-46918959 AAATACCTACATAATTACCATGG - Intronic
1158177711 18:54676442-54676464 AAATATCTACTTATCTCCTTTGG - Intergenic
1164232591 19:23303212-23303234 AAACACCCAAGTATTTGCCTTGG - Intergenic
927606287 2:24490318-24490340 ATATACCTATGTCTCTCCCTGGG - Intergenic
929303914 2:40337696-40337718 ATATTCCTACTTATGTCCCTAGG + Intronic
930207224 2:48599909-48599931 AATTATCCACATATTTCCCTAGG + Intronic
930574704 2:53132091-53132113 ATACTCCTAGGTATTTCCCTAGG - Intergenic
934513613 2:94969424-94969446 AAATACCTCAGTATTTCCATAGG - Intergenic
940006389 2:149012622-149012644 AACTACCAAAGCATTTCCCTTGG - Intronic
945440116 2:209868218-209868240 AAATAACTGCTTATTTCCATTGG + Intronic
948636566 2:239341686-239341708 AAATACCTATGAGTTTTCCTAGG - Intronic
1169649718 20:7853531-7853553 AAATATCTACCTATTTCCTCTGG - Intergenic
1172398622 20:34629438-34629460 AAATACCTAAGTCTGTCCCCTGG + Intronic
1179612027 21:42558487-42558509 AAATATCTACGTATGTAACTAGG - Intronic
1180435011 22:15292332-15292354 AAATAAGTACGTATTTCCAGTGG + Intergenic
949195305 3:1298568-1298590 AAATACCTACATTTTTGCATGGG + Intronic
949748286 3:7321457-7321479 AAAAAACTACCTATTTCCTTAGG - Intronic
950953294 3:17024047-17024069 AAATACCTAGGCCTTTCTCTGGG - Intronic
951194234 3:19805731-19805753 AAATACCTAGGAATATGCCTAGG + Intergenic
951194235 3:19805736-19805758 AAATACCTAGGCATATTCCTAGG - Intergenic
952106209 3:30072325-30072347 AGATACCTATGTATTTCCATAGG - Intergenic
952547724 3:34439163-34439185 AAATACCTATGTTTTTCCAGTGG - Intergenic
952950993 3:38525350-38525372 AAATATATACCTATTTCCATGGG + Exonic
955215385 3:56981109-56981131 ACATACCAATGTATTTCCCCAGG - Intronic
956896818 3:73669307-73669329 AAATACATAAATATTTTCCTTGG + Intergenic
957271855 3:78040690-78040712 AAATTCTAACTTATTTCCCTTGG + Intergenic
961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG + Intronic
963321891 3:143817675-143817697 AAATACCTATGAATTTTCCTAGG - Intronic
973027333 4:45289136-45289158 AAATACCTAGGAATATACCTAGG - Intergenic
973067463 4:45814578-45814600 AAATACAGACGTGTTTACCTTGG - Intergenic
973336863 4:48965484-48965506 AATTAACTACTTATTTCCTTGGG - Intergenic
974629067 4:64459208-64459230 AACTACCTACCAATTTCCTTTGG - Intergenic
976979879 4:91214272-91214294 AAATACCTACATATTTATGTGGG - Intronic
979939424 4:126741470-126741492 AAATGCCAACTTATTACCCTAGG + Intergenic
979967942 4:127098499-127098521 AAATACCTACTTTTTTCCCAAGG + Intergenic
980623010 4:135333804-135333826 AACTACCCACCTTTTTCCCTCGG - Intergenic
980731911 4:136834754-136834776 AAATATGTACATATTTACCTAGG - Intergenic
980951765 4:139386282-139386304 AAATACCCAATTATTTCTCTTGG - Intronic
987485526 5:18521045-18521067 AAAAAACTAGGTTTTTCCCTTGG - Intergenic
989636399 5:43540452-43540474 AAATACCTACATAATTGACTAGG + Intronic
995930068 5:117430867-117430889 AAATGCTTCCATATTTCCCTTGG - Intergenic
996911133 5:128658214-128658236 ATATATTTAAGTATTTCCCTAGG - Intronic
999216847 5:149942491-149942513 AAATACCCAGGTATTTCTCATGG - Intronic
999398472 5:151246312-151246334 AAATGCCTACCAATTTTCCTTGG - Intronic
999950096 5:156639767-156639789 AAATACATACTTCTTTCTCTTGG + Intronic
1000172747 5:158719372-158719394 AAATACCTAACTATTTCCAAGGG - Intronic
1001263198 5:170250720-170250742 AAATCCTTACCTCTTTCCCTCGG + Exonic
1002471012 5:179436179-179436201 AGGTACCTACGTATTTCTCTTGG - Intergenic
1003312562 6:4982457-4982479 ATATGCCTACGACTTTCCCTCGG + Intergenic
1010526902 6:76912072-76912094 AAATACCTAAGAATTTACCAGGG + Intergenic
1011819692 6:91236753-91236775 AAATACATACCTATTTCCACTGG + Intergenic
1013040912 6:106432534-106432556 AATAACCTACTGATTTCCCTTGG - Intergenic
1019010844 6:168842417-168842439 AAATACCTACTTATTTCCACTGG + Intergenic
1022915839 7:34951615-34951637 ACAGAGCTAAGTATTTCCCTTGG + Intronic
1027267726 7:76503487-76503509 TAATACCTCCATCTTTCCCTGGG - Exonic
1027319537 7:77003349-77003371 TAATACCTCCATCTTTCCCTGGG - Intergenic
1034377128 7:150655973-150655995 AAATACCTACCAATTTTCCCTGG - Intergenic
1036039764 8:5063038-5063060 AAATGCCTAGGCATTTCACTGGG + Intergenic
1036398011 8:8385448-8385470 AAATAACTGCGGAATTCCCTAGG + Intronic
1039512678 8:38104563-38104585 CAATATCTACGTATTTCCCATGG + Intergenic
1041005185 8:53491310-53491332 AAATACCCATCAATTTCCCTCGG + Intergenic
1043685675 8:83083711-83083733 AAATTACTACGTATCTCCCTGGG + Intergenic
1046479430 8:114796407-114796429 AAAAACCTAGGTATTTTCTTTGG + Intergenic
1046870925 8:119205293-119205315 AAACACCTGGGTGTTTCCCTTGG - Intronic
1047479030 8:125263265-125263287 ACATACCTACATAGATCCCTGGG - Intronic
1047821083 8:128521561-128521583 AAATATCTACGTTTTTGTCTGGG + Intergenic
1048584259 8:135757996-135758018 AAAAACCTAAGTATTTAGCTTGG + Intergenic
1050885628 9:10761733-10761755 AAATACCTATTTATTTCTCTGGG - Intergenic
1052963578 9:34320710-34320732 AAATAGCTACAGATCTCCCTTGG + Intronic
1053108575 9:35436777-35436799 AAGAACCTACCTATTTCCTTAGG - Intergenic
1058004133 9:99897273-99897295 AAATACCTATATCTTTCTCTAGG - Intergenic
1059070601 9:111131985-111132007 ACATTCCTAATTATTTCCCTAGG - Intergenic
1186696699 X:12041772-12041794 GAATACCAACGTATTTCCATGGG - Intergenic
1188820218 X:34765856-34765878 AAATACCCCAGAATTTCCCTTGG - Intergenic
1189335562 X:40168786-40168808 TAATAGCTACATATTTGCCTGGG - Intronic
1196984700 X:121255430-121255452 ACATACCTATGTGTTTCTCTTGG - Intergenic
1199872149 X:151908881-151908903 AAATACCTAAGGATTTGTCTAGG - Intergenic
1199895546 X:152123669-152123691 AAATACCTAAGGATTTGTCTAGG + Intergenic
1201322994 Y:12721023-12721045 AAATACCTACCTATTTGTCTAGG - Intronic
1202605034 Y:26632085-26632107 AAATACCTATGTATTTCCCTAGG - Intergenic