ID: 1105332737

View in Genome Browser
Species Human (GRCh38)
Location 13:19433126-19433148
Sequence CGTTGTGAACAGCTTGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 3, 1: 2, 2: 1, 3: 7, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105332737_1105332743 19 Left 1105332737 13:19433126-19433148 CCTGGGGCAAGCTGTTCACAACG 0: 3
1: 2
2: 1
3: 7
4: 55
Right 1105332743 13:19433168-19433190 TTCAAGGTATTGAAGAGCTCTGG 0: 4
1: 0
2: 2
3: 12
4: 158
1105332737_1105332739 3 Left 1105332737 13:19433126-19433148 CCTGGGGCAAGCTGTTCACAACG 0: 3
1: 2
2: 1
3: 7
4: 55
Right 1105332739 13:19433152-19433174 CTCCCCTGAATCTTTCTTCAAGG 0: 4
1: 0
2: 3
3: 20
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105332737 Original CRISPR CGTTGTGAACAGCTTGCCCC AGG (reversed) Intronic
900790798 1:4679060-4679082 CTTGGTCAGCAGCTTGCCCCTGG - Intronic
902842402 1:19083419-19083441 GGTTGTGTACAGCTCACCCCGGG - Intronic
907148273 1:52256864-52256886 CTTTGTGAACAGCTGGACACTGG + Intronic
907211855 1:52830659-52830681 TGATGTGAACAGCTTTTCCCAGG - Intergenic
919887008 1:201942011-201942033 CGTTGGCTACAGCTTGCCCAGGG + Intronic
1063499275 10:6538288-6538310 GGTTATGAACAGGTTGGCCCAGG - Intronic
1071094359 10:81956250-81956272 CTTGGTGAATGGCTTGCCCCAGG - Intronic
1079284503 11:19117009-19117031 CGCTGTGAACAGCTCGCCAGAGG - Intergenic
1083742927 11:64720711-64720733 GGTGCTGAACACCTTGCCCCAGG - Intronic
1085479875 11:76812546-76812568 TGATGTGAACAGCTTTTCCCAGG - Intergenic
1089185009 11:116608804-116608826 AGTTGGGAGCAGCTTGCCCAGGG + Intergenic
1093421971 12:18984005-18984027 CATTGTGAACAGCACGCCCAAGG - Intergenic
1103699900 12:122843665-122843687 AGTTGTGAGCAGGTGGCCCCTGG + Intronic
1105332737 13:19433126-19433148 CGTTGTGAACAGCTTGCCCCAGG - Intronic
1105878951 13:24586653-24586675 CGTTGTGAACAGCTTGCCCCAGG + Intergenic
1105920887 13:24962397-24962419 CGTTGTGAACAGCTTGCCCCAGG - Intergenic
1107408111 13:40134132-40134154 CTGTTTGTACAGCTTGCCCCTGG + Intergenic
1108626077 13:52229995-52230017 CACTGTGAACAGCTTGCCCTAGG - Intergenic
1108659986 13:52576484-52576506 CACTGTGAACAGCTTGCCCTAGG + Intergenic
1108758851 13:53538219-53538241 AGTTGTGAACAATTTGACCCTGG + Intergenic
1112190807 13:97175493-97175515 CATGGAGAACAGATTGCCCCTGG + Intergenic
1112379817 13:98878173-98878195 CCATGTGCACAGCTTGACCCAGG + Intronic
1112785575 13:102947795-102947817 CGTTGTCTACAGTTTTCCCCAGG - Intergenic
1119393876 14:74311268-74311290 AGCTGTGAACAGCTTGGCTCTGG - Intronic
1122986978 14:105216984-105217006 CTCTGTGCACAGCTTGCCGCTGG - Intronic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1127265197 15:57355333-57355355 GGTTGTGAACAGTTAGCCACGGG - Intergenic
1132897810 16:2237239-2237261 CTTTGTGAGCAGCCAGCCCCTGG + Exonic
1138716553 16:59029667-59029689 TGCTCTGAACAGCCTGCCCCTGG - Intergenic
1143110361 17:4549366-4549388 CATTGTGGACAGCCTGCACCTGG - Exonic
1148445912 17:47736991-47737013 CGTTGGGAAGAGCATGCCACTGG - Intronic
1151705447 17:75764801-75764823 CGTGGGGAACAGCCTGTCCCGGG + Intronic
1161594098 19:5142449-5142471 CGTTGTGAAAAGCGTGCCCCCGG - Intronic
1164557713 19:29266415-29266437 CTTTGTGAACTGCTCACCCCAGG - Intergenic
1164721788 19:30437915-30437937 CAGTGAGAACAGCTTGCCCCTGG - Intronic
1168410921 19:56140046-56140068 CTTTGTGACCAGTTTGCCCACGG - Intronic
927764329 2:25791252-25791274 CCTTGTGATCTGCTTGCCTCGGG - Intronic
928071086 2:28217535-28217557 TGTTTTAAACAACTTGCCCCAGG + Intronic
933706998 2:85298805-85298827 TGCTGTGAACATCCTGCCCCTGG + Intronic
943366725 2:186973634-186973656 AGTTTTGAACATCTTGCCACAGG + Intergenic
948284399 2:236772588-236772610 GGTTGTGAAGATCCTGCCCCAGG + Intergenic
948791094 2:240377173-240377195 CTGGGTGAACAGCTTGCCCCGGG - Intergenic
1169341462 20:4799701-4799723 CTTTGTGGACAGATTTCCCCAGG - Intronic
1172993425 20:39052375-39052397 CCTGATGAACAGCTTGCCCCTGG - Intergenic
1176042524 20:63072824-63072846 CGGGGTCAACAGCTTCCCCCAGG - Intergenic
1176177982 20:63737626-63737648 CGCTGTGCACAGCCTGCCGCAGG + Exonic
1176740285 21:10595416-10595438 TGTTGTGAACAGCTTGCCCCAGG + Intronic
1178381838 21:32116657-32116679 CGATGTGTACAGCATGCCTCAGG - Intergenic
1180643566 22:17319083-17319105 AGGTGTGAACAGCTTGACCCAGG + Intergenic
953453155 3:43020761-43020783 CCGTGAGAAGAGCTTGCCCCAGG - Intronic
967426850 3:189337558-189337580 GGTTGTGAATAACTTGCCCAAGG - Intergenic
970225518 4:13852615-13852637 TGCTGTGAACACCATGCCCCAGG - Intergenic
972631222 4:40843665-40843687 CATTGTGATCAGCATGCCCCAGG + Intronic
977570646 4:98626087-98626109 TGTTGTCAACAGCCAGCCCCAGG - Intronic
978056403 4:104273662-104273684 CACTTTGATCAGCTTGCCCCAGG + Intergenic
1010144857 6:72656247-72656269 TGTTATGAACTGGTTGCCCCAGG + Intronic
1017256640 6:152340798-152340820 CGTGGAGAACGGCTTGCCACAGG + Intronic
1019020348 6:168912823-168912845 CATTGTGATCAGCATGCCCTGGG + Intergenic
1032958463 7:137001402-137001424 ACTTATGAACAGCTTGCCTCTGG - Intronic
1038401927 8:27290062-27290084 GGTTGTTACCTGCTTGCCCCGGG + Intronic
1042173008 8:66010513-66010535 CATTAAGAAGAGCTTGCCCCAGG + Intergenic
1048886501 8:138914029-138914051 CGCTGAGGCCAGCTTGCCCCTGG - Intergenic
1057479711 9:95434978-95435000 CTTTGGGTACAGCTTGACCCGGG + Intergenic
1062013161 9:134277660-134277682 CGTTGAACACAGCTTGCCTCAGG - Intergenic
1187925880 X:24249744-24249766 CCTTGTGATCCGCCTGCCCCGGG + Intergenic
1197823703 X:130566764-130566786 GGTTTTGAACCGCTGGCCCCAGG - Intergenic
1199673897 X:150168579-150168601 AGTTGTCTACAGATTGCCCCAGG - Intergenic
1202598570 Y:26569290-26569312 TGTTGTGAACAGCTTGCCCCAGG + Intergenic