ID: 1105342550

View in Genome Browser
Species Human (GRCh38)
Location 13:19541046-19541068
Sequence TGTCCTCTTCTAAGCTCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 2, 1: 1, 2: 3, 3: 31, 4: 296}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105342547_1105342550 5 Left 1105342547 13:19541018-19541040 CCAGACTGTGGTCCTTTTTAAAA 0: 3
1: 2
2: 4
3: 37
4: 376
Right 1105342550 13:19541046-19541068 TGTCCTCTTCTAAGCTCAGGTGG 0: 2
1: 1
2: 3
3: 31
4: 296
1105342548_1105342550 -7 Left 1105342548 13:19541030-19541052 CCTTTTTAAAACTTAGTGTCCTC 0: 2
1: 0
2: 4
3: 44
4: 442
Right 1105342550 13:19541046-19541068 TGTCCTCTTCTAAGCTCAGGTGG 0: 2
1: 1
2: 3
3: 31
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105342550 Original CRISPR TGTCCTCTTCTAAGCTCAGG TGG Intergenic
902059849 1:13632956-13632978 TGTCATCTCGTAAGCTGAGGAGG - Intergenic
903918312 1:26780480-26780502 TGTCCTCTAGGAAGCCCAGGAGG - Exonic
904841010 1:33371909-33371931 TGTGTTCTTCTCAGCTAAGGAGG + Intronic
905245267 1:36608579-36608601 GGTCCTCTTCCAAGCTCACGTGG - Intergenic
905331769 1:37208027-37208049 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
905350674 1:37344274-37344296 TGTCCCCTTCTGAGCCCTGGGGG + Intergenic
906880637 1:49585545-49585567 AATCCTCTTCTAAGCTCATTAGG - Intronic
907281715 1:53351356-53351378 TGTGCTCTTTTTAGCACAGGAGG - Intergenic
908045334 1:60162332-60162354 TGTCATTTTGTAAGCTGAGGAGG - Intergenic
909090167 1:71215917-71215939 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
909254871 1:73407554-73407576 TGTCATCTCATAAGCTGAGGAGG + Intergenic
909886289 1:80946145-80946167 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
909977278 1:82059851-82059873 TTTCCTCTCCTAAGCCCAGAAGG - Intergenic
910356188 1:86359120-86359142 TGTAGTCTTCAAAGCTCAAGTGG - Intronic
910911351 1:92237618-92237640 TGCTCTCTTCAAAGCTCAGATGG + Intronic
911678104 1:100682446-100682468 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
911932403 1:103922090-103922112 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
912128517 1:106571191-106571213 TTTCCTCTTATTTGCTCAGGTGG - Intergenic
912725164 1:112052765-112052787 GGTCCTCTTCCAAGCTCATGTGG + Intergenic
913694835 1:121314817-121314839 TGCTCTCTTCAAAGCTCAGATGG + Intronic
913989594 1:143598514-143598536 TCTACTCTTCTAGGCTCAGCAGG - Intergenic
914142725 1:144965240-144965262 TGCTCTCTTCAAAGCTCAGATGG - Intronic
914888998 1:151606356-151606378 GATCCTCTTCTAAGTTCATGTGG + Intergenic
915022191 1:152790609-152790631 TGTACTCTGCTAATCCCAGGTGG - Intronic
919190035 1:194204319-194204341 TGTCATCTTGTAAACTGAGGAGG - Intergenic
920270435 1:204759047-204759069 TGTCCTTTTCTTGGCTCAGATGG + Intergenic
920482164 1:206333200-206333222 TGCTCTCTTCAAAGCTCAGATGG + Intronic
921896732 1:220409718-220409740 TCTTCTCCTCCAAGCTCAGGAGG + Intergenic
922083681 1:222324629-222324651 GGTCCTCTTCCAAGCTCATATGG + Intergenic
922694569 1:227722506-227722528 TGTCATCTCATAAGCTGAGGAGG + Intergenic
922848204 1:228707408-228707430 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
922907292 1:229183938-229183960 TGTTCTCATGTAAGCTCTGGGGG - Intergenic
923523076 1:234751081-234751103 TGTCCTCCTCTAAACACAGGGGG + Intergenic
1063554279 10:7063425-7063447 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
1063562032 10:7137540-7137562 TGCTCTCTTCAAAGCTCAGCTGG - Intergenic
1064144305 10:12815518-12815540 TGTGCTCCTCTGAGCTCAGAAGG - Intronic
1064300067 10:14115517-14115539 TGTCCCCTTTTAATCTCATGTGG + Intronic
1066144817 10:32546843-32546865 AATCCTCTTCCAAGCTCAAGTGG + Intronic
1066184438 10:32995455-32995477 GGTCCTCTTCCAAGCTCATTTGG - Intronic
1066818436 10:39451876-39451898 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
1067240527 10:44488208-44488230 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
1067785823 10:49246225-49246247 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1067972208 10:50985720-50985742 GGTCCTCTTCCCAGCTCATGTGG + Intergenic
1068202314 10:53797734-53797756 TGCTCTCTTCGAAGCTCAGATGG + Intergenic
1068642688 10:59427560-59427582 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
1068662632 10:59638150-59638172 TGTCATCTCGTAAGCTGAGGAGG - Intergenic
1069893590 10:71666817-71666839 TGCACTCTTGTAAGCTCTGGGGG - Intronic
1071676033 10:87657201-87657223 TGTCCTCTCCTAAGAGCAAGAGG + Intergenic
1071884908 10:89939286-89939308 TGTCCTCTCCAAATCTCATGTGG + Intergenic
1073793952 10:106967724-106967746 TCTCCCCTTCTAAGCACTGGAGG - Intronic
1074023114 10:109605536-109605558 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1075461583 10:122620012-122620034 TGTCCTCTTCTCAGCTACGAAGG - Intronic
1075944803 10:126423561-126423583 TTTCCTATTCTAAGCAGAGGTGG - Intergenic
1075997552 10:126890875-126890897 TGTCATCTTGTAAGCTGAGGAGG + Intergenic
1078711765 11:13799227-13799249 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
1080180159 11:29416214-29416236 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1080600165 11:33814845-33814867 GGTCTTCTTCCAAGCACAGGTGG - Intergenic
1080731905 11:34965199-34965221 GGTCCTCTTCCAAGCTCATGTGG + Intronic
1082137583 11:48567091-48567113 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
1083508450 11:63183814-63183836 TGTCCTCTTCTTTGCTCAGGTGG - Exonic
1085026288 11:73238437-73238459 GGGCCTCTTCTAACCTCAGGGGG - Intergenic
1087397899 11:97625773-97625795 TGTCCTGTCCTAAGCTCATGTGG + Intergenic
1087631242 11:100653108-100653130 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1088040535 11:105375823-105375845 TGGCCTCTTTTAGGCACAGGTGG + Intergenic
1088967300 11:114736645-114736667 TGTCATCTTGTAAGCTGAGGAGG - Intergenic
1088990925 11:114952823-114952845 AGCCTACTTCTAAGCTCAGGAGG + Intergenic
1089628898 11:119771176-119771198 GGTCCTCTTTCAAGCTCATGTGG + Intergenic
1089757612 11:120697938-120697960 TGGCCTCTTCTATGAGCAGGAGG - Intronic
1090540967 11:127704041-127704063 TGTCTTCTTCCAATCTTAGGGGG + Intergenic
1090655950 11:128845726-128845748 TGCCCTCTTCTATGCCCATGAGG - Intronic
1092628139 12:10349834-10349856 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
1095087105 12:38069045-38069067 TGTCATCTCATAAGCTGAGGAGG + Intergenic
1096957921 12:55545892-55545914 TGCTCTCTTCAAAGCTCAGTTGG + Intergenic
1097528364 12:60766849-60766871 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
1100217999 12:92472970-92472992 TGTCCGTTTCTAAGATCAGAGGG + Intergenic
1100239488 12:92696992-92697014 GGTCCTCTTCCAATCTCATGTGG - Intergenic
1101712314 12:107279686-107279708 GGTTCTCTTCTAAGTTCATGTGG - Intergenic
1101908435 12:108845248-108845270 GGTCCTCTTTTAAGCTCACGTGG - Intronic
1104349617 12:128033686-128033708 CTTCCTCCTCTAAGCCCAGGAGG - Intergenic
1105342550 13:19541046-19541068 TGTCCTCTTCTAAGCTCAGGTGG + Intergenic
1105817589 13:24051224-24051246 TGTCCTCTTGGAAGGTCAGGTGG - Intronic
1106082474 13:26511843-26511865 CTTCCTCTTCAAAGCCCAGGAGG - Intergenic
1107474569 13:40722968-40722990 TGTCCTCTTCTAAGTTCAGGTGG + Intergenic
1108091558 13:46855066-46855088 TGGCCTCTTCTTAGCTCTGGGGG - Intronic
1108137221 13:47378737-47378759 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1108891903 13:55272304-55272326 TGTCCTCTCCAAAACTCATGTGG + Intergenic
1110606915 13:77443380-77443402 TGCTCTCTTCTGAGCTCAGCTGG + Intergenic
1110698595 13:78520524-78520546 AGTCCTCTTCTAAGCTCACATGG + Intergenic
1110882931 13:80595307-80595329 TGTCCCCTTCAAGGCTCAGTTGG - Intergenic
1111529543 13:89518810-89518832 TGTCCTCATCTAATCTCTTGAGG - Intergenic
1112667701 13:101595442-101595464 TGTCCTCTCCAAATCTCACGTGG - Intronic
1114796514 14:25721074-25721096 TGTTCCCTTCAAAGCTCAGTGGG + Intergenic
1114995563 14:28347551-28347573 TGTCCTAATCAAAGCTCATGGGG + Intergenic
1116378712 14:44236681-44236703 TGTCTTCTTCCAAGCTAATGTGG + Intergenic
1118446899 14:65860361-65860383 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1118996443 14:70840734-70840756 TGTCCTCTCCAAAACTCATGTGG - Intergenic
1124650387 15:31469575-31469597 TGCCTTCTTCGAAGCACAGGAGG + Intergenic
1125407787 15:39371058-39371080 TGTCATCTCATAAGCTGAGGAGG - Intergenic
1126677553 15:51173590-51173612 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1128401669 15:67288768-67288790 GGTACTCTTCTAAGCACTGGAGG + Intronic
1128827139 15:70729742-70729764 TGCTCTCTTCAAAGCTCAGATGG - Intronic
1128858364 15:71041027-71041049 AGTCCTCTTCTAAGCCTAAGTGG - Intronic
1129969219 15:79762558-79762580 TGTCATCTTGTAACCTGAGGAGG - Intergenic
1130306678 15:82716438-82716460 TGTCGTCTCTTAAGCTGAGGAGG + Intergenic
1130313537 15:82775059-82775081 TTTCCTACTCAAAGCTCAGGGGG + Intronic
1130796059 15:87210689-87210711 TTTCCTCTTCTGACCTCAGCTGG - Intergenic
1131477800 15:92755233-92755255 TGCTCTCTTCAAAGCTCAGTTGG - Intronic
1132189115 15:99833466-99833488 TACCCTCTTCAAAGCTCAGTTGG + Intergenic
1134049032 16:11124030-11124052 TGTCTTCTTCTATGCTATGGGGG - Intronic
1138772530 16:59683048-59683070 GGTCCTCTTCCAGGCTCAAGTGG + Intergenic
1139052914 16:63147758-63147780 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1140913692 16:79476181-79476203 GGTCTTTTTCTAAGCTCACGTGG - Intergenic
1141015736 16:80447469-80447491 TGTCCTCTTCCAAGGGCAAGGGG - Intergenic
1141868170 16:86765427-86765449 TGTACTTTTCGAAGCTGAGGTGG - Intergenic
1143147650 17:4786995-4787017 TGTCTTCTTCTAAGGTAGGGAGG - Intergenic
1147630655 17:41928985-41929007 GGTCCTGTTCTAAGTTAAGGTGG - Intronic
1147754507 17:42759808-42759830 TGTCCTCCTCTATGGTCAAGAGG - Intronic
1148945833 17:51260812-51260834 TGTCCTCCTCCAGCCTCAGGCGG - Exonic
1150447315 17:65237001-65237023 TGTCATCTTGTAAGCTGAGGAGG + Intergenic
1151213911 17:72564473-72564495 GCTCTTCTTCGAAGCTCAGGGGG + Intergenic
1153796057 18:8623113-8623135 TGTCATCTTGTAAGCCGAGGAGG - Intronic
1154299754 18:13182766-13182788 TGTCCCCCTCTAGGCTCAGATGG - Intergenic
1154404745 18:14079196-14079218 TGTCCACTCCTCAGCACAGGAGG + Intronic
1155127413 18:22891994-22892016 GGTCCTCTTCCAAGTTCATGTGG - Intronic
1155854466 18:30815723-30815745 TGTCATCTCGTAAGCTGAGGAGG + Intergenic
1156377201 18:36525365-36525387 GGTCCTCTTCCAAGCTCATGTGG - Intronic
1157703001 18:49776456-49776478 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
1158640310 18:59197978-59198000 TGGCCCCTTCGAAGTTCAGGTGG - Intergenic
1158865588 18:61635241-61635263 TGTCATTTTATAAGCTGAGGAGG - Intergenic
1159574182 18:70155958-70155980 TGTCATCTCGTAAGCTGAGGAGG + Intronic
1159850216 18:73517792-73517814 TGTCATCTCATAAGCTGAGGAGG - Intergenic
1160225715 18:77009327-77009349 TGTCCTCACCTGAGCTCAGCTGG - Intronic
1161363728 19:3867155-3867177 GGGCCTCTGCTGAGCTCAGGGGG - Intronic
1161510307 19:4666937-4666959 GGTCCTCTTCCAAGCTCTTGTGG + Intronic
1161835571 19:6643862-6643884 AGTCCTTTTCCAAGCTCAGCTGG + Intergenic
1162333452 19:10045185-10045207 TGTCCTGTTCTAAGCCCTGATGG - Intergenic
1163230248 19:15997042-15997064 TTTCCTCTTGTAAACTCAAGAGG - Intergenic
1164003510 19:21128881-21128903 TATTCTCTTCTAACTTCAGGGGG - Intergenic
1164910034 19:32002612-32002634 GGTCCTCTTCCAAGCCCAGGTGG + Intergenic
1167348719 19:48962405-48962427 TGTCCTCAGCCCAGCTCAGGAGG - Intergenic
925629470 2:5875395-5875417 GGTGCTCTTCTAAGCTCATGTGG + Intergenic
926270945 2:11365557-11365579 TGTCCCCCTCTGACCTCAGGAGG + Intergenic
926432507 2:12802774-12802796 TTTCCTATTCTAAGCTCTGAAGG + Intergenic
926542521 2:14199197-14199219 GATCCTCTTCTAAGTTCATGTGG + Intergenic
926869647 2:17399811-17399833 GATCCTCTTCTAAGTTCAAGTGG - Intergenic
927195777 2:20545563-20545585 TGTCATCTCGTAAGCTGAGGAGG - Intergenic
927409548 2:22808440-22808462 GGTCCACTTCTAAACTCATGTGG - Intergenic
927876050 2:26655807-26655829 TATCCTTATCTAAGCTGAGGTGG - Intergenic
929307227 2:40377292-40377314 GGTCCTCTTCAAAACTCATGTGG - Intronic
929524062 2:42683326-42683348 TGACCTCTGCTAAGCACAGTAGG + Intronic
930009853 2:46928423-46928445 AGCCCTCTTTCAAGCTCAGGTGG + Intronic
930255143 2:49082103-49082125 TGCTCTCTTCAAAGCTCAGATGG - Intronic
931311071 2:61081366-61081388 TGTCCTCTTTTAAGGTAAGAAGG + Intronic
933912694 2:86957248-86957270 TGTCTTCATTTAAGATCAGGAGG + Intronic
934010301 2:87812642-87812664 TGTCTTCATTTAAGATCAGGAGG - Intronic
934188228 2:89764321-89764343 TCTCCTCTGTTAGGCTCAGGTGG + Intergenic
934701138 2:96441193-96441215 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
935649726 2:105371965-105371987 AGGCCTCTTCTAAGATCATGTGG - Intronic
935773865 2:106453362-106453384 TGTCTTCATTTAAGGTCAGGAGG - Intronic
935906198 2:107842551-107842573 TGTCTTCATTTAAGGTCAGGAGG + Intronic
935992665 2:108735074-108735096 TGTCTTCATTTAAGGTCAGGAGG + Intronic
936116069 2:109704211-109704233 TGTGCTGTGCAAAGCTCAGGGGG - Intergenic
936127985 2:109807716-109807738 TGTCTTCATTTAAGGTCAGGAGG + Intronic
936216712 2:110563769-110563791 TGTCTTCATTTAAGGTCAGGAGG - Intronic
936425851 2:112418350-112418372 TGTCTTCATTTAAGGTCAGGAGG - Intronic
936686812 2:114837096-114837118 TGTCATCTTGTAAACTGAGGAGG - Intronic
938667524 2:133554016-133554038 GGTCCTCTCCCAAGCTCATGTGG + Intronic
940003549 2:148990991-148991013 TGTCCCCTTCTTTGCTCAGTTGG + Exonic
941121534 2:161536271-161536293 TGCTCTCTTCAAAGCTCAGATGG - Intronic
941805709 2:169710203-169710225 GGTCCTCTTCCAAGATCAAGTGG - Intronic
941887712 2:170546616-170546638 TGTCGTTTTCTAAGATCAAGGGG - Intronic
942506653 2:176648681-176648703 TGTACTCTTCTAAGGTAAAGAGG + Intergenic
943091136 2:183376147-183376169 TGTCCTCATCTAACTTCAAGAGG - Intergenic
943237451 2:185340277-185340299 TGCTCTCTTCAAAGCTCAGTTGG + Intergenic
943873974 2:193037898-193037920 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
944886742 2:204070821-204070843 TGTACTCTTCCAAGGTTAGGGGG + Intergenic
945471806 2:210235588-210235610 TGTCTTCCTTTATGCTCAGGAGG + Intergenic
948209994 2:236185816-236185838 TGTCCTCTCCAAATCTCATGTGG + Intergenic
948373861 2:237507985-237508007 TGTCCTCCTCCAAGCTCATCAGG + Intronic
948490653 2:238310472-238310494 AGTCCTCCTCCAAGCTCCGGCGG - Intergenic
1171213445 20:23334684-23334706 GGTCCTATTCTTAGGTCAGGGGG + Intergenic
1171357289 20:24557824-24557846 TGCTCTCTTCAAAGCTCAGATGG + Intronic
1176124002 20:63467085-63467107 TGTCCTGTTAAAGGCTCAGGCGG - Intronic
1177646119 21:23901635-23901657 GGTCCTCTTCTGAGCTCATGTGG - Intergenic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
1179840435 21:44069240-44069262 TGTACTCTTCCAAGCTGCGGAGG - Intronic
1181132134 22:20738214-20738236 TGTCCTCCTGTGGGCTCAGGAGG - Intronic
1181481366 22:23201286-23201308 GGTTCTCTTCTAAGCTCACCTGG + Intronic
1182456760 22:30456676-30456698 TGTCCCCTCCAAATCTCAGGAGG - Intronic
1183175844 22:36224168-36224190 TCTCCTCTTCCTAGTTCAGGAGG - Intergenic
1184131261 22:42518041-42518063 AGTCCTCTTCTGAGGCCAGGTGG + Exonic
1184141483 22:42580253-42580275 AGTCCTCTTCTGAGGCCAGGTGG + Intergenic
949859914 3:8495643-8495665 GGTCCTCTTCCAAGCTCACGTGG + Intergenic
950319089 3:12033272-12033294 TGCTCTCTTCAAAGCTCAGATGG + Intronic
951145874 3:19226706-19226728 TGTGCTCTGCTAAGCTCAGTTGG + Intronic
951301337 3:21000936-21000958 TGTCCTCTGCTATGCTCACCTGG - Intergenic
952193634 3:31049640-31049662 TTGCCTCTTCTAGCCTCAGGTGG + Intergenic
953579917 3:44144639-44144661 TGTCCCCTTGCAGGCTCAGGTGG - Intergenic
954237798 3:49270296-49270318 CTTCCTCTTATTAGCTCAGGAGG + Exonic
956131381 3:66056856-66056878 TGTCATCTCGTAAGCTGAGGAGG - Intergenic
959098849 3:101987390-101987412 TGTACTCTCCTGAGGTCAGGTGG + Intergenic
960374293 3:116879236-116879258 TGTCATCTCATAAGCTAAGGAGG - Intronic
961413730 3:126742487-126742509 TGTCCCCTTCAAAACTCATGTGG + Intronic
961922643 3:130444293-130444315 TGTCATCTCGTAAGCTGAGGAGG - Intronic
961923712 3:130453140-130453162 TGTCATCTCGTAAGCTGAGGAGG - Intronic
962290445 3:134131871-134131893 TGTCATCTCGTAAGCTGAGGAGG - Intronic
962483854 3:135822589-135822611 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
964658075 3:159090319-159090341 TGCTCTCTTCAAAGCTCAGATGG + Intronic
966287635 3:178316108-178316130 GGTCCTCTTCCTAGCTCATGTGG - Intergenic
971935825 4:33145746-33145768 GGTCCTCTTCCAAGCTCATGTGG + Intergenic
973597264 4:52504866-52504888 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
974202760 4:58662724-58662746 TCTCCTTTTCTAGGCTCTGGAGG + Intergenic
974591485 4:63953592-63953614 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
975750615 4:77519308-77519330 TGTTCTCTTCAAAGCTCAGATGG + Intronic
977473461 4:97473066-97473088 TGTCATCTCGTAAGCTGAGGAGG + Intronic
977541183 4:98320521-98320543 TGCTCTCTTCAAAGCTCAGATGG - Intronic
978157432 4:105505880-105505902 TGTGTTCTTCTTAGCTCAAGGGG + Intergenic
978997283 4:115172463-115172485 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
980648564 4:135679147-135679169 TGTCATCTTCTAATCTTAAGGGG - Intergenic
983326616 4:166266014-166266036 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
985640360 5:1060802-1060824 TGTCATTGTCTATGCTCAGGGGG + Intronic
986478362 5:8159151-8159173 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
988717691 5:33844124-33844146 TGTCATCTCGTAAGCTGAGGAGG + Intronic
989318864 5:40111951-40111973 TGTCATCTTGTAAGCCAAGGAGG + Intergenic
989583308 5:43053731-43053753 TGCTCTCTTCAAAGCTCAGTTGG - Intergenic
991112586 5:62917862-62917884 CATCCTCTTCTAAGCCCAGAAGG - Intergenic
992010852 5:72525994-72526016 AGTCCTCTTCTAACCCTAGGGGG - Intergenic
992201899 5:74393165-74393187 GATCCTCTTCAAAGCTCAGGGGG + Intergenic
992955132 5:81900764-81900786 TGTCATCTTATAAGCTAAGGAGG + Intergenic
992998671 5:82357766-82357788 TGTTTTTTGCTAAGCTCAGGTGG + Intronic
993847066 5:92957232-92957254 TGTCATCATCTAAGCATAGGTGG + Intergenic
995674155 5:114643534-114643556 TGTCATCTCGTAAGCTGAGGAGG + Intergenic
998246978 5:140515539-140515561 TGCTCTCTTCAAAGCTCAGATGG - Intronic
998585226 5:143420237-143420259 TGTCATCTCCTAAACTGAGGAGG - Intronic
998939972 5:147271342-147271364 TGTCATCTCGTAAGCTGAGGAGG + Intronic
999058725 5:148610277-148610299 TGCTCTCTTCAAAGCTCAGATGG - Intronic
999078050 5:148815874-148815896 GGTCCTCTTGTAAGCTCATGGGG - Intergenic
1002577508 5:180183213-180183235 TGTCTTCTTCCAAGCTCATGTGG - Intronic
1003166754 6:3686197-3686219 TGTCCTTTTCTATGCTTAGCAGG + Intergenic
1003745198 6:8993319-8993341 TGAACTCACCTAAGCTCAGGAGG - Intergenic
1004202911 6:13566295-13566317 TTTCCTCTCTAAAGCTCAGGTGG + Intergenic
1005656433 6:27943375-27943397 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1005904328 6:30247972-30247994 TGCTCTCTTCAAAGCTCAGACGG - Intergenic
1007241700 6:40431399-40431421 TGTTCTGTTCTAAGCCCAGTTGG - Intronic
1007964520 6:45991412-45991434 AGTCTTCTTCCAAGCTCTGGTGG - Intronic
1008100439 6:47384949-47384971 TGTCATCTCCTAAGCCGAGGAGG + Intergenic
1008123202 6:47641151-47641173 TATTCTCTTCAAAGCTCAGTTGG + Intergenic
1008495821 6:52133087-52133109 TGTCCTCTTCTAAAATCCAGAGG - Intergenic
1008723390 6:54386418-54386440 AGCCCTCTTCCAAGCTCACGTGG + Intronic
1008771285 6:54981853-54981875 GGTTCTCTTCCAAGCTCATGTGG + Intergenic
1010236078 6:73575813-73575835 TGTCATCTCGTAAGCTGAGGAGG + Intergenic
1010513947 6:76751031-76751053 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
1010737541 6:79460133-79460155 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1011004833 6:82632853-82632875 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1011078728 6:83466315-83466337 TCTCCTCCTCTGAGCTGAGGAGG + Intergenic
1012216551 6:96592539-96592561 TGTCATCTCGTAAGCTGAGGAGG - Intronic
1013176360 6:107680670-107680692 TATCCTTTTCTAAGCTCACCAGG - Intergenic
1013755358 6:113455428-113455450 AGTCCTCTTCCAAGCTCAGGTGG + Intergenic
1013889456 6:115009064-115009086 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1014145741 6:117996404-117996426 TGCTCTCTTCAAAGCTCAGACGG - Intronic
1015180880 6:130361104-130361126 TGTCATCTCGTAAGCTGAGGAGG - Intronic
1015605582 6:134952049-134952071 TGTCCTCTTCTACTGTCACGTGG - Intergenic
1016112370 6:140241438-140241460 GGCCCTCTTCTAAACCCAGGTGG + Intergenic
1016231447 6:141810161-141810183 TGTCCTTTTCTAGGTTCTGGTGG - Intergenic
1017995394 6:159527675-159527697 TCTCCTGTTCTAAGCCCAGATGG - Intergenic
1019314239 7:377208-377230 TGTCCTCTGCCACACTCAGGGGG - Intergenic
1019764848 7:2843161-2843183 GCTCTTCTTCTAAGCTCAGCCGG + Intronic
1020749930 7:12127947-12127969 TATCTTCTCCTAAGCTCTGGAGG - Intergenic
1020909382 7:14109344-14109366 TGTCATCTCGTAAGCTGAGGAGG - Intergenic
1022820019 7:33950521-33950543 GGCCCTCTTCTAAGCTCACGTGG + Intronic
1024130042 7:46341844-46341866 TGCTCTCTTCAAAGCTCAGTGGG + Intergenic
1025116706 7:56264388-56264410 TGTCATCTTGTAAACTGAGGAGG + Intergenic
1025600198 7:62987075-62987097 TGTCATCTTGTAAGCCAAGGAGG - Intergenic
1025609046 7:63060830-63060852 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1027500152 7:78939977-78939999 TCTCCTCTTCTAAGCTCAAGTGG - Intronic
1027792918 7:82656078-82656100 TGTCTTCTTCCAAGCTCATGTGG - Intergenic
1028137595 7:87238748-87238770 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1028355575 7:89902288-89902310 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
1029693631 7:102199051-102199073 TGCCCTCTCCCAAGCACAGGCGG + Intronic
1033473925 7:141672552-141672574 TATCCACCTCTAAGATCAGGTGG - Intronic
1035487342 7:159236346-159236368 GCTCCTGTTCTAAGCTCTGGTGG - Intergenic
1035884369 8:3276313-3276335 TGCTCTCTTCAAAGCTCAGATGG + Intronic
1036427770 8:8662084-8662106 GGTTCTCTTCCAAGCTCATGTGG - Intergenic
1037416831 8:18660280-18660302 TCGCCTCTTCTAACCTCTGGTGG - Intronic
1038624214 8:29174964-29174986 TGTCCTCTACTAAGCTACTGGGG + Intronic
1039286578 8:36048269-36048291 GGTGCTCTTCCAAGCTCATGTGG + Intergenic
1039431504 8:37528689-37528711 TGTCATCTTCTATGCACAGCTGG - Intergenic
1042402187 8:68362501-68362523 TGCTCTCTTCAAAGCTCAGATGG - Intronic
1043428321 8:80170960-80170982 TGCCTTCTTCTAAGTTCAGGTGG - Intronic
1044066822 8:87708454-87708476 TGTCATCTTGTAAGCTGAGGAGG - Intergenic
1044466566 8:92513513-92513535 TGTCCTCCTGTAAGCACAGCTGG + Intergenic
1044846094 8:96383371-96383393 GGTCATCTTCCAAGCTCATGTGG + Intergenic
1047129956 8:122008043-122008065 TGTCCTCTCTAAATCTCAGGTGG - Intergenic
1047447561 8:124933182-124933204 TGTCATCTTGTAAGCCGAGGAGG + Intergenic
1047768799 8:128013577-128013599 TGTCCTCTTCAAAGTTCAAATGG - Intergenic
1047837726 8:128712471-128712493 TGCTCTCTTCAAAGCTCAGATGG + Intergenic
1048825766 8:138424155-138424177 TGTCATCTCATAAGCTGAGGAGG - Intronic
1054851395 9:69849849-69849871 TGTCTTATTCTAAGCTTAGTGGG + Intronic
1056523831 9:87424440-87424462 TTTCCTCTTATCAGCTCAGGAGG - Intergenic
1056700925 9:88907551-88907573 TGCTCTCTTCAAAGCTCAGTTGG - Intergenic
1057889255 9:98856147-98856169 GGTCCTCTTCTAGGCTCACTGGG + Intergenic
1058922577 9:109631464-109631486 TGTCATCTTGTAAGCTGAGGAGG + Intergenic
1059064511 9:111068892-111068914 TGTTCCATTATAAGCTCAGGAGG - Intergenic
1059165075 9:112069617-112069639 TCTCCTCTTCTCAGCCAAGGTGG + Intronic
1060688392 9:125633205-125633227 TGTCCTCTACCAAGCTCTGTTGG - Intronic
1061949211 9:133926828-133926850 TGTGCTCTGCTTAGCTCAGCTGG - Intronic
1062319546 9:135984110-135984132 TGTCCTCCTCTGAGGACAGGAGG - Intergenic
1185841338 X:3394541-3394563 TGTCCTCTCCAAAACTCAAGTGG + Intergenic
1186016994 X:5208512-5208534 TGTCCTTTAATAACCTCAGGAGG + Intergenic
1186414067 X:9368304-9368326 GGTTCTTTTCCAAGCTCAGGTGG - Intergenic
1186790852 X:12997067-12997089 GGTCATCTTCCAAGCTCAAGTGG + Intergenic
1186932778 X:14412965-14412987 TCTCCTCTTCTCTCCTCAGGTGG - Intergenic
1188359410 X:29234037-29234059 GGTGCTCTTCCAAGCTCATGTGG - Intronic
1190509491 X:51161629-51161651 GGTTCTCTTCTAATCTGAGGTGG - Intergenic
1191148353 X:57192894-57192916 TGTCATCTCATAAGCTGAGGAGG + Intergenic
1192256408 X:69463930-69463952 TGCTCTCTTCAAAGCTCAGACGG + Intergenic
1192390246 X:70718819-70718841 TGTCCTCAGCTAAGGTCAGAGGG - Intronic
1193554770 X:82940131-82940153 TTTCTTCTTTTAAGTTCAGGGGG + Intergenic
1195099530 X:101540949-101540971 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1196249678 X:113446052-113446074 TGCTCTCTTCAAAGCTCAGATGG - Intergenic
1196794933 X:119494683-119494705 TGTCCTGTTCTATGATCACGAGG + Intergenic
1197823474 X:130564608-130564630 AGTCCTATTCTGAGCCCAGGAGG - Intergenic
1198508334 X:137324023-137324045 AGTCTTCTTCCAAGCTCACGTGG - Intergenic
1198895354 X:141448488-141448510 TGCTCTCTTCAAAGCTCAGCTGG - Intergenic
1199875042 X:151922232-151922254 TCCCCTGTTCTTAGCTCAGGGGG + Intronic
1200825498 Y:7635150-7635172 TTTACTCTTCTAAGCTTAGTTGG + Intergenic
1200957438 Y:8965380-8965402 TTTACTCTTCTAAGCTTAGTTGG - Intergenic
1202193332 Y:22268454-22268476 TTTACTCTTCTAAGCTTAGTTGG + Intergenic
1202202127 Y:22364409-22364431 TTTACTCTTCTAAGCTTAGTTGG - Intronic
1202234559 Y:22695945-22695967 TTTACTCTTCTAAGCTTAGTTGG - Intergenic
1202308600 Y:23500223-23500245 TTTACTCTTCTAAGCTTAGTTGG + Intergenic
1202562201 Y:26170363-26170385 TTTACTCTTCTAAGCTTAGTTGG - Intergenic
1202589791 Y:26470621-26470643 TGTCCTCTTCTAAGCTCAGGTGG - Intergenic