ID: 1105344735

View in Genome Browser
Species Human (GRCh38)
Location 13:19561673-19561695
Sequence CTCGCTTGCCGAAGTCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 52}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105344735_1105344744 2 Left 1105344735 13:19561673-19561695 CCCCAGGGACTTCGGCAAGCGAG 0: 1
1: 0
2: 1
3: 2
4: 52
Right 1105344744 13:19561698-19561720 ATTGAACCCTGCCCCGGGGCGGG 0: 1
1: 2
2: 0
3: 6
4: 89
1105344735_1105344751 14 Left 1105344735 13:19561673-19561695 CCCCAGGGACTTCGGCAAGCGAG 0: 1
1: 0
2: 1
3: 2
4: 52
Right 1105344751 13:19561710-19561732 CCCGGGGCGGGCTGGATCGGAGG 0: 1
1: 1
2: 2
3: 19
4: 169
1105344735_1105344743 1 Left 1105344735 13:19561673-19561695 CCCCAGGGACTTCGGCAAGCGAG 0: 1
1: 0
2: 1
3: 2
4: 52
Right 1105344743 13:19561697-19561719 GATTGAACCCTGCCCCGGGGCGG 0: 1
1: 2
2: 0
3: 6
4: 75
1105344735_1105344742 -2 Left 1105344735 13:19561673-19561695 CCCCAGGGACTTCGGCAAGCGAG 0: 1
1: 0
2: 1
3: 2
4: 52
Right 1105344742 13:19561694-19561716 AGGGATTGAACCCTGCCCCGGGG 0: 1
1: 0
2: 1
3: 12
4: 212
1105344735_1105344745 6 Left 1105344735 13:19561673-19561695 CCCCAGGGACTTCGGCAAGCGAG 0: 1
1: 0
2: 1
3: 2
4: 52
Right 1105344745 13:19561702-19561724 AACCCTGCCCCGGGGCGGGCTGG 0: 1
1: 2
2: 1
3: 21
4: 233
1105344735_1105344753 30 Left 1105344735 13:19561673-19561695 CCCCAGGGACTTCGGCAAGCGAG 0: 1
1: 0
2: 1
3: 2
4: 52
Right 1105344753 13:19561726-19561748 TCGGAGGCCCAACCCTGACCCGG 0: 1
1: 1
2: 1
3: 7
4: 103
1105344735_1105344748 11 Left 1105344735 13:19561673-19561695 CCCCAGGGACTTCGGCAAGCGAG 0: 1
1: 0
2: 1
3: 2
4: 52
Right 1105344748 13:19561707-19561729 TGCCCCGGGGCGGGCTGGATCGG 0: 1
1: 2
2: 2
3: 11
4: 156
1105344735_1105344740 -4 Left 1105344735 13:19561673-19561695 CCCCAGGGACTTCGGCAAGCGAG 0: 1
1: 0
2: 1
3: 2
4: 52
Right 1105344740 13:19561692-19561714 CGAGGGATTGAACCCTGCCCCGG 0: 1
1: 0
2: 2
3: 6
4: 77
1105344735_1105344741 -3 Left 1105344735 13:19561673-19561695 CCCCAGGGACTTCGGCAAGCGAG 0: 1
1: 0
2: 1
3: 2
4: 52
Right 1105344741 13:19561693-19561715 GAGGGATTGAACCCTGCCCCGGG 0: 1
1: 0
2: 1
3: 9
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105344735 Original CRISPR CTCGCTTGCCGAAGTCCCTG GGG (reversed) Intergenic
900679343 1:3907735-3907757 CTTGCCTACCGAGGTCCCTGCGG + Intergenic
900938840 1:5784765-5784787 CTCTCTTGCTGATGGCCCTGTGG - Intergenic
905107608 1:35573713-35573735 CTCAGCTGGCGAAGTCCCTGCGG - Intronic
908151812 1:61310447-61310469 CTCGCTTGTCAAAATGCCTGGGG + Intronic
909881734 1:80888465-80888487 ATTGGTTGCCGAACTCCCTGTGG - Intergenic
912509696 1:110180488-110180510 CTCACTTGCCTGACTCCCTGAGG - Intronic
915708197 1:157867308-157867330 CTTGATTGCCTAAGCCCCTGTGG - Intronic
917001992 1:170370324-170370346 CTCGCTTCCCCTAGCCCCTGTGG - Intergenic
923373083 1:233332155-233332177 CTGGCTTGCCAGTGTCCCTGAGG - Intronic
1065637692 10:27746802-27746824 CGCTCTCGCCGAAGGCCCTGTGG + Intergenic
1065824282 10:29555795-29555817 GTAGCTTGCCGATGGCCCTGTGG - Intronic
1069921189 10:71816704-71816726 CTAGCTCTCCGAAGGCCCTGCGG - Exonic
1070835513 10:79445017-79445039 CTCGCCGCCCGAAGTCCCCGGGG - Intronic
1078432282 11:11297494-11297516 CTCCCTTGCCCACCTCCCTGGGG + Intronic
1081527605 11:43937186-43937208 CTGGCATGCAGAGGTCCCTGTGG - Intronic
1083663883 11:64264480-64264502 CCCGCCTGCCGCAGGCCCTGGGG - Intronic
1083672273 11:64306030-64306052 CGCATTTGCCGAAGTCCCTGGGG + Intronic
1104659783 12:130602539-130602561 CACGCTTACAGGAGTCCCTGGGG - Intronic
1105344735 13:19561673-19561695 CTCGCTTGCCGAAGTCCCTGGGG - Intergenic
1105535305 13:21259894-21259916 CGCACTTGCCGAAGTCCCTGGGG + Intergenic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1117132863 14:52703566-52703588 CTCGCTTGGATAACTCCCTGTGG - Intergenic
1124167772 15:27343239-27343261 TTGGCGTGCAGAAGTCCCTGTGG + Intronic
1124589424 15:31040330-31040352 CAAGCTGGCCGAAGTCTCTGGGG + Exonic
1129376830 15:75138779-75138801 CTGGCGTGCCTCAGTCCCTGAGG + Intergenic
1133866805 16:9651660-9651682 CTCACTAGCCAAAGTCCCAGAGG + Intergenic
1139165637 16:64562221-64562243 CTGGCTTGCACAGGTCCCTGAGG + Intergenic
1143492285 17:7291430-7291452 CTCCCTTTCTGAAATCCCTGAGG - Intronic
1160790692 19:921925-921947 CTCGCCTCCAGAAGTCCCAGAGG + Intergenic
925178697 2:1802588-1802610 CTGCCCTGCCGAGGTCCCTGGGG + Intronic
926303272 2:11618838-11618860 CCCGGTTGCCGTAGTCCATGTGG - Exonic
933496348 2:83054347-83054369 CTTGCTAGCCGACGTCCCTTGGG - Intergenic
935334145 2:101999460-101999482 CTCTCTTGCCGAAGTCCCCATGG - Intronic
942743387 2:179204812-179204834 CTAGCTTTCAGGAGTCCCTGAGG - Intronic
1174302252 20:49591254-49591276 CCCACTTGCCGCAGACCCTGTGG + Intergenic
1181719818 22:24764927-24764949 CTCGCTTGCCCTCGTGCCTGGGG + Intronic
1183289320 22:36989800-36989822 CTGGCTTGTCAATGTCCCTGTGG - Intergenic
1184339457 22:43878225-43878247 CTGGGTTGGCGACGTCCCTGAGG + Intergenic
1184472252 22:44702516-44702538 CTCTCTTGCCCAGGTCACTGAGG - Exonic
949688817 3:6610477-6610499 CTCGCTAGCAGAATTCACTGTGG - Intergenic
962129670 3:132659792-132659814 CTCGAGTGCCGAAGTCCTTCAGG + Exonic
979756972 4:124352935-124352957 TTTGGTTGCCAAAGTCCCTGGGG + Intergenic
983886277 4:172983961-172983983 CTTGCTTACTGAAGTCCATGGGG + Intronic
985488167 5:163354-163376 CTGGCTGGCAGGAGTCCCTGGGG - Exonic
1005085025 6:21996952-21996974 CAGGCTTGCTGAACTCCCTGCGG - Intergenic
1021823471 7:24521510-24521532 GTAGCTTGCAAAAGTCCCTGAGG - Intergenic
1034734131 7:153413018-153413040 TTCGCTGGCACAAGTCCCTGTGG - Intergenic
1036722796 8:11192727-11192749 CTCCCTGGCCCAACTCCCTGAGG + Intronic
1040387214 8:46921634-46921656 GTCTCTTGCCGATGTCCCAGAGG + Intergenic
1041133329 8:54727446-54727468 CATGCTAGCCGAAATCCCTGGGG + Intergenic
1049355394 8:142185489-142185511 GTCGCTTGCCCAAGGCCATGTGG - Intergenic
1052914974 9:33918035-33918057 CCCGCTTGCCCCACTCCCTGGGG - Exonic
1056737523 9:89222778-89222800 CTCACTTGCAGAGGTCTCTGGGG - Intergenic
1059555781 9:115278649-115278671 CTGGCTTGCCGATTTGCCTGGGG + Intronic
1062526215 9:136978979-136979001 GTCGCTCGCCGCAGTTCCTGGGG + Exonic
1062630209 9:137459922-137459944 CTCCCGGGCCGAGGTCCCTGTGG - Intergenic