ID: 1105351449

View in Genome Browser
Species Human (GRCh38)
Location 13:19619910-19619932
Sequence ATGTCTCTATGGGAGAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105351445_1105351449 -2 Left 1105351445 13:19619889-19619911 CCATATGATGTTGTTAAGTTGAT 0: 1
1: 0
2: 0
3: 12
4: 212
Right 1105351449 13:19619910-19619932 ATGTCTCTATGGGAGAATGAGGG 0: 1
1: 1
2: 1
3: 15
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105351449 Original CRISPR ATGTCTCTATGGGAGAATGA GGG Intergenic
902706995 1:18212553-18212575 TTGTGTCCATGGCAGAATGAGGG + Intronic
904043236 1:27596078-27596100 ATGCCCCTCTGGGAGAATGAAGG + Intronic
907642776 1:56208048-56208070 ATGCCTCTATGAGAGGATGGAGG + Intergenic
911283326 1:95958596-95958618 ATGTATCCAGGGGAGGATGACGG + Intergenic
911971743 1:104447224-104447246 AGATTTCTATGGGAGCATGAAGG - Intergenic
912170537 1:107093914-107093936 AAGTCTTTAAGTGAGAATGATGG + Intergenic
913397259 1:118385675-118385697 ATGTCTCTATTGGAGCATTATGG - Intergenic
915019591 1:152766453-152766475 ATGTCTGTATGGGAGATTTTTGG - Intronic
915141993 1:153773590-153773612 ATGGCTCTTTGGGAGACTGGGGG - Exonic
915445930 1:155974985-155975007 ATGTCTCTTTGGGAGAGGGTGGG - Intronic
917352001 1:174088071-174088093 ATGTATCTATAATAGAATGAGGG + Intergenic
917644721 1:177018695-177018717 CTGTCCATATGGCAGAATGAAGG + Intronic
918147445 1:181769999-181770021 TTGTCTCTCAGGGAGAATGGAGG - Intronic
921094746 1:211876597-211876619 AGATCTCTATGGGAGAAGGGAGG + Intergenic
922244388 1:223780705-223780727 ATGTCTCTAGAAGAGAATGAAGG - Exonic
923098718 1:230795505-230795527 GTGCCTCTGTGGGAGGATGATGG + Intronic
924046336 1:240035421-240035443 ATGTCTCTCTTGGAAAATTAGGG + Intronic
924190229 1:241543800-241543822 TTGTTTTTATGGGAGAATAAGGG - Intronic
1065130881 10:22618986-22619008 GTGTCTTATTGGGAGAATGAGGG + Intronic
1065650486 10:27884272-27884294 ATGTTTCCATAGGAGAATGAGGG - Intronic
1067052641 10:43031386-43031408 GTGTTTCTATGGGGGAATGAAGG - Intergenic
1067328334 10:45291267-45291289 ATGTCTGGATGGGAGTATGAAGG + Intergenic
1069972264 10:72182128-72182150 ATATGTCCATGGGGGAATGAGGG - Intronic
1071222476 10:83485449-83485471 ATGTCTCTGAGGCAGAAAGAGGG + Intergenic
1077644218 11:3909228-3909250 ATGTCTCCAGGGTAAAATGAGGG + Intronic
1077722372 11:4641573-4641595 ATGTGTCTACGTGAGAATGCTGG + Intergenic
1078426630 11:11256277-11256299 ATGTCTCTATTGGAGGAGAAGGG + Intergenic
1083098414 11:60277684-60277706 AAAACTATATGGGAGAATGAGGG + Intergenic
1083106598 11:60364321-60364343 CTGTCACTATAGGAGAAGGAAGG + Intronic
1083189599 11:61040466-61040488 CTGTTTTTAAGGGAGAATGAGGG - Intergenic
1088622891 11:111704688-111704710 ATGTCTACATGAGACAATGATGG + Intronic
1089916056 11:122157872-122157894 ATGTTTCTATGTCAGAATCAAGG - Intergenic
1095938633 12:47711399-47711421 ATTTCACTTTGGGGGAATGAGGG + Intronic
1095980779 12:47973548-47973570 ATGTTTCTAGGGGAGAAAAAAGG + Exonic
1097902595 12:64888377-64888399 ATGAGTCTATGGGATAGTGAAGG + Intergenic
1098545966 12:71711457-71711479 GTGACTCTGTGGGAGAAGGAGGG - Intergenic
1099946749 12:89253899-89253921 GTGTCTCTGTGGAAGATTGATGG - Intergenic
1101317589 12:103643552-103643574 ATGTGTCTATGAGAGAATTTAGG + Intronic
1102206683 12:111095845-111095867 ATGTCTCAAAGCCAGAATGAAGG + Intronic
1105351449 13:19619910-19619932 ATGTCTCTATGGGAGAATGAGGG + Intergenic
1105610938 13:21969453-21969475 AGGTCTCTATGGGACAAGAATGG + Intergenic
1106388516 13:29312159-29312181 ATTTCTCTCTGGGAGCATGGAGG - Intronic
1109259962 13:60133314-60133336 ATGTATCTGTCTGAGAATGAGGG + Intronic
1111914514 13:94346800-94346822 AGGTCTTGATGGGAGAGTGAAGG + Intronic
1112045611 13:95594346-95594368 ATGTATCTATAGAAGCATGATGG + Intronic
1112667264 13:101590044-101590066 ACGTGCCTATGGGAGAATAAAGG + Intronic
1113256199 13:108508850-108508872 GTGTCTTTTTGGGAGAGTGAGGG + Intergenic
1113822000 13:113221325-113221347 AGGTCACTCTGGCAGAATGATGG + Intronic
1116016867 14:39417846-39417868 ATGTTTCTATGGGAGAGCAAAGG + Intronic
1116274970 14:42821703-42821725 ATGTCACCATGTGAGAATTAGGG - Intergenic
1118001751 14:61529355-61529377 ATGGCTCATTGGGTGAATGATGG + Intronic
1120951546 14:90046310-90046332 AAACCTCAATGGGAGAATGATGG - Intergenic
1121449713 14:93999320-93999342 AGGTATCTGGGGGAGAATGAAGG - Intergenic
1121991520 14:98562260-98562282 ATCTCTCTTTGGGAGGCTGAGGG - Intergenic
1123847042 15:24313207-24313229 ATGTCCCTATGCCAGAATAAGGG - Intergenic
1127169964 15:56290884-56290906 GTTTTTTTATGGGAGAATGAAGG + Intronic
1128598320 15:68973936-68973958 GTGTCTCTATGTGTGTATGAGGG + Intronic
1128934325 15:71732439-71732461 ATTTCTCTACCGGAGGATGATGG + Intronic
1129241317 15:74253815-74253837 ATCTCTACATGGAAGAATGAGGG + Intronic
1131531169 15:93193335-93193357 ATGTCTGTGTGGGAGAGTCACGG + Intergenic
1131688803 15:94803869-94803891 ATGTCTCTAATGGGGATTGAGGG + Intergenic
1132495974 16:263596-263618 ATGTGGCCATGGGAGACTGAGGG + Intronic
1133884251 16:9810861-9810883 ATTTCTCTATGGGAGGAAGGAGG + Intronic
1134827959 16:17299623-17299645 AAGTCTCTATGGCAGAGTCAAGG - Intronic
1136091235 16:27921544-27921566 ATGTCTCTTTTGGGGAATGGTGG - Intronic
1137039658 16:35599157-35599179 CTGGCTCTATGTGAGAAAGAGGG - Intergenic
1137087447 16:36144284-36144306 ATTTCTCTGTGTGAGAAAGATGG - Intergenic
1137925547 16:52537578-52537600 ATGTCACAATGAGAGAATGTGGG - Intronic
1140450588 16:75067692-75067714 ATGAATCAATGGGAGAAGGATGG + Intronic
1140601073 16:76475672-76475694 ATGTCACTGAGGGAAAATGAAGG + Intronic
1146200508 17:30853391-30853413 ATGTCTCTATAGCAGAAGGTAGG - Intronic
1146835693 17:36108770-36108792 CTGTGTCAATGGGAGCATGATGG - Intergenic
1146850324 17:36216039-36216061 CTGTATCAATGGGAGCATGATGG - Intronic
1147898324 17:43767145-43767167 AAGTCTCTGTGGGGGCATGAGGG - Exonic
1149232952 17:54555856-54555878 ATTTCTATATGGGAGCAAGATGG - Intergenic
1149692742 17:58591560-58591582 ATGTATGTAAGGGAAAATGAAGG - Intronic
1153575981 18:6522406-6522428 ATGTCTCTGTGGCAGAAGGAGGG + Intronic
1153791455 18:8583420-8583442 ATGTCTTTATGGGAGCACGTGGG - Intergenic
1154188578 18:12208502-12208524 CTGTCTCTATGGGCTTATGAGGG + Intergenic
1154321137 18:13353922-13353944 ATGTTTCTTTGGGTGAATGAGGG + Intronic
1157083885 18:44557204-44557226 AGATCTCTGTGAGAGAATGAAGG - Intergenic
1157377537 18:47180106-47180128 GTGTTTCAAAGGGAGAATGAAGG - Intergenic
1158149223 18:54348417-54348439 ATGTATCTGTGGAATAATGAAGG - Intronic
1158351567 18:56569775-56569797 ATGTAGAAATGGGAGAATGATGG + Intergenic
1159771088 18:72545648-72545670 TTCTCTCTATGGTGGAATGATGG - Intronic
1159953155 18:74499887-74499909 CTGTCTCTAGTGGAGACTGAGGG - Exonic
1161802420 19:6423857-6423879 CTGTCTCTTTGGGGGAAAGAAGG - Intronic
1165174220 19:33915453-33915475 ATGTTTCTATGGAACTATGAGGG - Intergenic
1167412796 19:49355087-49355109 AGGTCTCTGTGGGAGTGTGAGGG + Intronic
925036697 2:692558-692580 CTGTCTCTATAGGAGGAAGAGGG + Intergenic
925331293 2:3060710-3060732 AGGCCCCTATGGGAGAAGGAGGG + Intergenic
930719083 2:54621565-54621587 ATGAGTGCATGGGAGAATGAGGG - Intronic
933239039 2:79898621-79898643 ATTTCTCATTAGGAGAATGAAGG + Intronic
933286185 2:80386984-80387006 ATGTGTTTATGGTAGGATGAGGG + Intronic
933329792 2:80879512-80879534 TTGTCTCTACCGGAAAATGAAGG + Intergenic
934912244 2:98269777-98269799 GTGTCTCTGTAGGGGAATGAGGG + Intronic
934998050 2:98984689-98984711 ATTTCTCTATGGGATAAGTAAGG - Intergenic
936613926 2:114029160-114029182 ATGTCTCAGTGGTAGAAGGAAGG + Intergenic
937077348 2:119116903-119116925 AGGTCACTCTGGGAGAAGGAGGG + Intergenic
939262048 2:139822804-139822826 ATGTCTTTGTGGGAGATTTAAGG + Intergenic
939314302 2:140528072-140528094 AATTCTCTATGGGAGATTGGAGG - Intronic
939364094 2:141210440-141210462 TTGTCTTTATGGAAGAAAGAAGG - Intronic
939669055 2:144987177-144987199 GTGTTTCCATAGGAGAATGAGGG + Intergenic
940083029 2:149826260-149826282 ATGTTTCTACAGGAGGATGAGGG + Intergenic
940436495 2:153662343-153662365 AAGTTTATGTGGGAGAATGAAGG - Intergenic
940733919 2:157427694-157427716 AAGTCACTATGTGACAATGATGG + Intronic
941226896 2:162861341-162861363 ATATCTCTATGGCAGATTGCTGG + Intergenic
942651738 2:178175991-178176013 CTGTCTCTATGGCAGAACCAGGG - Intergenic
946678765 2:222190863-222190885 TTGTCTATATGATAGAATGATGG - Intergenic
1170498248 20:16947896-16947918 ATGTCTCTATGGGCTAAGGAAGG + Intergenic
1171069137 20:22049415-22049437 ATGTGTGTATAGGAGAAGGATGG - Intergenic
1171085022 20:22230534-22230556 CAGTGTGTATGGGAGAATGAAGG + Intergenic
1171162215 20:22937803-22937825 TTGTTTCCATGGGAAAATGAGGG + Intergenic
1173169976 20:40716106-40716128 GTGTCTCTCTGTGAGGATGAGGG + Intergenic
1173631920 20:44522562-44522584 ATGGCTCTAAGGGTGCATGAAGG + Intergenic
1174955732 20:55096052-55096074 CTTTTTCTCTGGGAGAATGATGG + Intergenic
1175131324 20:56791834-56791856 GTGTCTTAATGGGAGGATGAAGG - Intergenic
1175431248 20:58905401-58905423 AAGGCTCTGTGGGAGGATGAAGG + Exonic
1176926263 21:14753165-14753187 ATGTTTCTGTGTGGGAATGAAGG - Intergenic
1177737971 21:25116785-25116807 ATGTATGTATGGCAGAAAGAAGG - Intergenic
1178686725 21:34717422-34717444 ATGTCTAGATGAGACAATGAAGG - Exonic
1180029146 21:45191077-45191099 GGGTCTCTATGGGGGAAAGAGGG + Intronic
1181821156 22:25476699-25476721 ATGTCTCCATCTGTGAATGAAGG - Intergenic
950402523 3:12780796-12780818 ATGTTTTAAAGGGAGAATGAGGG + Intergenic
950435496 3:12976912-12976934 ATCTCTCTATGGTATAAAGAGGG - Intronic
951649798 3:24938407-24938429 ATACATCTATGGCAGAATGAAGG - Intergenic
955719738 3:61868080-61868102 ATGTGTTTAAGGGAGAATGTGGG - Intronic
956045379 3:65190521-65190543 CTGTCTCTAGGAGAGAATGGTGG - Intergenic
963683213 3:148407336-148407358 ATGGCACTTTGGAAGAATGAAGG - Intergenic
964040145 3:152251801-152251823 ATTTCTCTATTGCATAATGATGG + Intronic
967458653 3:189720210-189720232 ATTTCTGTATCTGAGAATGATGG - Intronic
967728451 3:192883830-192883852 ATGTCTCTAAAGGGGAATCAAGG - Intronic
969948012 4:10804781-10804803 ATGTTTCAAAGGGAGAATAAGGG - Intergenic
970294366 4:14612801-14612823 ATGTGTTTATGGGAGGTTGATGG + Intergenic
970781038 4:19738018-19738040 ACATCTCTATGAGAGCATGATGG - Intergenic
971118504 4:23677460-23677482 ATTTCTCAATGGAAGAATCATGG + Intergenic
972429630 4:38968265-38968287 ATGTCTCTGTGTTAGAATCATGG - Intronic
976336273 4:83891342-83891364 ATGTTTCTGTGGGGGTATGAGGG + Intergenic
979835404 4:125360734-125360756 ATGTCTTTAGGGGAGGAGGATGG + Intronic
979974101 4:127174512-127174534 ATATGTCTATGGTAGAATGCTGG + Intergenic
981742978 4:148022434-148022456 ATGACTTTATTGAAGAATGAAGG + Intronic
982130995 4:152228549-152228571 ATGCCTGTATGGGTGCATGATGG + Intergenic
983082187 4:163400183-163400205 CTCACTTTATGGGAGAATGAAGG - Intergenic
983842056 4:172469203-172469225 AGGTCTCTATTGGGAAATGATGG + Intronic
984517287 4:180756549-180756571 AAGTTTCTATGGGAGAAAAATGG + Intergenic
986265642 5:6187754-6187776 AGGTCTCTAGGGGAGGATGAGGG + Intergenic
990412516 5:55555058-55555080 AAGTCTCTATCAGAGAATGTGGG + Intergenic
991514573 5:67420477-67420499 ATGTCTTTATAGGAGAAAAATGG + Intergenic
992288581 5:75261458-75261480 ATGTCTATATTGTTGAATGAAGG + Intergenic
997051031 5:130380290-130380312 GTGTTTCTATGGGAGATTTAGGG + Intergenic
998387659 5:141767129-141767151 ATGTGTGAATGGGTGAATGAAGG + Intergenic
998842783 5:146273772-146273794 ATATCTATATGAGAAAATGATGG + Intronic
999847766 5:155504365-155504387 ATATACCTATGGGAGAATGGAGG + Intergenic
1000133222 5:158319926-158319948 ATGATTCTATGGGCAAATGAGGG + Intergenic
1000832974 5:166127064-166127086 AAGTCTCTAGGGGAGAACAATGG + Intergenic
1002388685 5:178891918-178891940 ATGTGTCTGTGGGAGAACAAGGG - Intergenic
1003953115 6:11136996-11137018 ATGTCACTATTAAAGAATGATGG + Exonic
1004470244 6:15922556-15922578 AGGTCTCCCTGGGAGAATGCAGG + Intergenic
1010634705 6:78243472-78243494 ATCTCTCTATGTGAGTCTGAAGG - Intergenic
1012294771 6:97507673-97507695 ATGTCTCTATGGCATAATACTGG + Intergenic
1012988558 6:105900617-105900639 AGGTCTCGATGGCAGAAAGATGG - Intergenic
1013371670 6:109476398-109476420 ATGTTTCTGTGGTAGATTGAAGG - Intronic
1013703995 6:112810657-112810679 ATGTCTCTGTGAAAGAATGCTGG - Intergenic
1013893715 6:115058526-115058548 GTGTCTTTATGGTAGAATGAAGG + Intergenic
1014942604 6:127460828-127460850 ATGTCTTTAAGGAAGAATCAGGG - Intronic
1015001261 6:128219316-128219338 ATTTTTCTATGGAACAATGAGGG + Intronic
1015074561 6:129140004-129140026 ATGGATGGATGGGAGAATGAAGG - Intronic
1015262744 6:131256974-131256996 ATGTCTATATGGTAGAAAAATGG + Intronic
1016494356 6:144643177-144643199 ATGTCTCTATCAGAAAATGATGG + Intronic
1016591107 6:145744226-145744248 ATTTCTCTATGTGAGAAGGTTGG + Intergenic
1019369964 7:657181-657203 ATGTGTGGATGGGTGAATGAAGG + Intronic
1019369984 7:657341-657363 ATGTGTGGATGGGTGAATGAAGG + Intronic
1019876720 7:3818731-3818753 TTGGCTCTATGAGATAATGAAGG + Intronic
1020154268 7:5709447-5709469 TTCTCTCTATGGGAAAAAGAGGG + Intronic
1021326023 7:19269940-19269962 TTTTCTCTATGGTAGAATAATGG + Intergenic
1021862577 7:24921683-24921705 ATGTCTCAGTGGGAGTAGGATGG - Intronic
1021960784 7:25871131-25871153 ATGTCTCTGTGGGGACATGAGGG + Intergenic
1022871351 7:34483147-34483169 ATGTCTCTATAGGATATAGAGGG + Intergenic
1024487875 7:49940545-49940567 ATGTTTTCATGGGGGAATGAGGG - Intronic
1027721082 7:81742343-81742365 ATTTCACTATAGCAGAATGATGG - Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1031205102 7:118746546-118746568 ATCTCTGCATGGGAGAAGGATGG - Intergenic
1032067259 7:128780970-128780992 TTGTCTCTTAGGGAGAATCATGG - Intergenic
1033910451 7:146257576-146257598 ATTTCTTTCTGTGAGAATGAAGG + Intronic
1036500152 8:9306748-9306770 ATTTCTCCATGGTAGAATTATGG + Intergenic
1038301778 8:26357319-26357341 CTATATCTGTGGGAGAATGATGG + Intronic
1038372178 8:27005311-27005333 AGGTCTCTTTGGGAGAAGGGTGG + Intergenic
1038647634 8:29374413-29374435 ATTTCTCCAAGGGAAAATGATGG - Intergenic
1040384902 8:46908053-46908075 CTGTCTTTATGTGAGAATCAAGG + Intergenic
1042566650 8:70118208-70118230 ATATCTCTATGGGAGAAAAATGG - Intronic
1042740579 8:72040332-72040354 ATATCTCTATGGAGGAAGGAGGG - Intronic
1043007630 8:74839787-74839809 ATGTATCAATGGAAGAAAGAAGG - Intronic
1043984322 8:86675717-86675739 ATATCTCTATGAAAGAATAAAGG + Intronic
1045382398 8:101640478-101640500 ATGTCTCTTATGGAGAAAGAGGG + Intronic
1046046816 8:108974564-108974586 TTGTCTCTACGGGAGAATAAGGG - Intergenic
1046514609 8:115241984-115242006 ATGTTTTAAAGGGAGAATGAGGG - Intergenic
1048955897 8:139535768-139535790 ATGTATGTATGGAAGTATGATGG - Intergenic
1049588845 8:143445880-143445902 ATGTATTTCTGGGAGAATAATGG + Intronic
1050988651 9:12117122-12117144 ATGTCATTAAGGTAGAATGAAGG - Intergenic
1052301149 9:26954003-26954025 ATGTTTTAAAGGGAGAATGAGGG - Intronic
1052988257 9:34503294-34503316 GTGCCTCCATGGGAGAAAGAGGG + Intronic
1053143756 9:35698233-35698255 ATGTTTCTATGAGAGAATTGAGG - Intronic
1053444758 9:38143744-38143766 ATGTCCTTTTGGGAAAATGAGGG - Intergenic
1057085591 9:92206951-92206973 GTGTCTCTATGGGAGAATGAGGG + Intergenic
1058360577 9:104142109-104142131 GTGTCTTAAAGGGAGAATGAGGG + Intergenic
1058469500 9:105262817-105262839 ATGTCTGAATGGGAGAAAGCTGG - Intronic
1062665678 9:137670272-137670294 AAGGATCTAAGGGAGAATGAGGG - Intronic
1186367416 X:8910143-8910165 ATGTGTCCATGGGAGACTGCTGG + Intergenic
1186807703 X:13156360-13156382 GTGTCTCTGTGGTAGAATAAAGG + Intergenic
1186877808 X:13833962-13833984 ATGTCTGTGTGGTAAAATGAAGG - Intronic
1187248552 X:17575803-17575825 ATGTCTATTTGGAAGCATGAAGG + Intronic
1187404104 X:18986843-18986865 AAGTCTCTGTGGCAGGATGATGG - Intergenic
1188791371 X:34411946-34411968 ATCTCTGTATGTGAGATTGAAGG - Intergenic
1189592742 X:42532412-42532434 ATGTCTTTTTGGTAGATTGATGG + Intergenic
1190165625 X:48071054-48071076 ATGTCTGTAAGGGTGAGTGATGG - Intronic
1192534985 X:71919648-71919670 ATGTCAGTGGGGGAGAATGAAGG - Intergenic
1192640040 X:72853275-72853297 ATGTCTCTATCAGGGAAGGAGGG - Intergenic
1192641671 X:72867530-72867552 ATGTCTCTATCAGGGAAGGAGGG + Intergenic
1193177899 X:78416330-78416352 ATATTTCTATGGGGAAATGAGGG - Intergenic
1193276347 X:79592798-79592820 ATGTCTATATGAAAGAATGCTGG + Intergenic
1194450294 X:94037578-94037600 GTGTTTCTGTAGGAGAATGAGGG + Intergenic
1194455803 X:94101529-94101551 ATGTGTCTATCTGAGAATGGTGG + Intergenic
1195551245 X:106174114-106174136 ATGAGTCTCTGGAAGAATGATGG + Intronic
1195976910 X:110536642-110536664 ATGTCGCTAAAGGAGAATGACGG + Intergenic
1196369965 X:114966546-114966568 ATGTCTCTGTTGAAGCATGATGG + Intergenic
1196606008 X:117657856-117657878 ATGTTTCTATGGGGGAATGAGGG - Intergenic
1197686177 X:129441968-129441990 ATATATCTATGGGAGGTTGATGG - Intergenic
1199206427 X:145154348-145154370 ATGAGTCTATGGGAGAATTTAGG - Intergenic
1199510101 X:148612091-148612113 AATTCTCTATGGTAGACTGAGGG - Intronic
1199673472 X:150165755-150165777 ATGCCTCTATGTGGGGATGAAGG - Intergenic
1199766573 X:150945801-150945823 ATGTCTTGATGGGGGAAGGATGG + Intergenic
1202621940 Y:56822713-56822735 AAGTGTCTATGGGAGAGAGAAGG - Intergenic