ID: 1105368468

View in Genome Browser
Species Human (GRCh38)
Location 13:19782323-19782345
Sequence CGGGGTGGCCGCGGGGTCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 263}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105368468_1105368478 3 Left 1105368468 13:19782323-19782345 CCCACGACCCCGCGGCCACCCCG 0: 1
1: 0
2: 2
3: 18
4: 263
Right 1105368478 13:19782349-19782371 GTCCTTTTGTTCCCTCGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 40
1105368468_1105368482 24 Left 1105368468 13:19782323-19782345 CCCACGACCCCGCGGCCACCCCG 0: 1
1: 0
2: 2
3: 18
4: 263
Right 1105368482 13:19782370-19782392 GGCGCCTGACACTCACCAAGCGG 0: 1
1: 0
2: 1
3: 5
4: 73
1105368468_1105368477 2 Left 1105368468 13:19782323-19782345 CCCACGACCCCGCGGCCACCCCG 0: 1
1: 0
2: 2
3: 18
4: 263
Right 1105368477 13:19782348-19782370 AGTCCTTTTGTTCCCTCGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105368468 Original CRISPR CGGGGTGGCCGCGGGGTCGT GGG (reversed) Intronic
900221453 1:1511602-1511624 AGGGGTCGCCCCGGGGTCTTGGG + Intergenic
901433994 1:9235078-9235100 CGGGGCGGCGGCGGGGCCGGCGG - Intronic
901555596 1:10029094-10029116 CGGGGTGGCTGCCGGGTGGAGGG - Intergenic
901970331 1:12902953-12902975 CGGGGTGGCTGCCGGGTGGAGGG - Intronic
902014834 1:13298816-13298838 CGGGGTGGCTGCCGGGTGGAGGG + Intergenic
904532302 1:31177128-31177150 CGGGGTGGCCGCCGGGCAGAGGG - Intergenic
904642174 1:31938766-31938788 CGGGGTGGCCGCCACGTCCTGGG + Intronic
904760924 1:32804267-32804289 CGGGGTGGCCGCCGGGCAGAGGG + Intronic
905041984 1:34967772-34967794 CGGGGTGGCCGCCGGGCGGAGGG + Intergenic
905408401 1:37752838-37752860 CGCGGTGGCCTCGGGGTGGGGGG + Intronic
906356902 1:45115172-45115194 CGGGGTGGCCGCCGGGCAGAGGG + Intronic
907011466 1:50968081-50968103 AGGGGTGGCCGCGGGGGTGGAGG - Exonic
907160922 1:52368478-52368500 CGGGGAGGCAGCGCGGTCGCGGG - Intergenic
907389056 1:54144691-54144713 CGTGGTGGCCGAGGGATCCTCGG - Exonic
907689143 1:56645245-56645267 CGGGGCGGGCGCGGGGTCCCGGG - Intronic
909629762 1:77759493-77759515 CTGGGTGGCGGCGGGTTCGCGGG - Intronic
912993412 1:114510860-114510882 GGGGGTGGCCGCGGCCTCCTCGG - Exonic
914959912 1:152196504-152196526 CGGGGTGGCTGCCGGGTGGAGGG + Intergenic
915345568 1:155195263-155195285 CGGGGAGGCCGGGGGGCCGGGGG - Intergenic
915929002 1:160046818-160046840 CGGGGGTGCCCCGGGGTGGTGGG - Intronic
916037437 1:160933620-160933642 CGGGGTGGCGGCGGGGCAGAGGG - Intergenic
916671958 1:167029765-167029787 CGGGGTGGCTGCCGGGTAGAGGG - Intergenic
917797525 1:178542735-178542757 CGGCGGGGGCGCGGGGGCGTCGG - Intronic
917869450 1:179229144-179229166 CGGGCTGCCCGAGGGGTCGGAGG - Intronic
919959445 1:202451909-202451931 CGGGGTGGCTGCCGGGTGGAGGG + Intronic
922315064 1:224434634-224434656 CGGGGCGGCTGCGGGGGCGCGGG + Intronic
923137108 1:231128732-231128754 CGGGGTGGCTGCCGGGTGGAGGG - Intergenic
923267972 1:232332017-232332039 CGGGGTGGCTGCTGGGTGGAGGG - Intergenic
1063662283 10:8043148-8043170 CGGGGTGGCCCGGGGGACGGAGG + Intergenic
1065025394 10:21535116-21535138 CGGGGTGGGGGCGGGGGCGGGGG + Intronic
1067346864 10:45443661-45443683 CGGGGTGGGCGCCGGGCCCTGGG + Intronic
1069365650 10:67691684-67691706 CGGGGTGGCTGCTGGGTGGAGGG - Intronic
1072757633 10:98031066-98031088 AGGGGTGGCCGCGGGGTCCTGGG - Intergenic
1074040007 10:109779203-109779225 CGGGGTGGCGGCGGGGGCAGGGG - Intergenic
1074592051 10:114822268-114822290 CTGGGCGGCCGCCGGGTCGTGGG + Intronic
1074618346 10:115093043-115093065 CGGGGTGGGCGCGCGCGCGTGGG + Intergenic
1076011761 10:126994924-126994946 CGGGGTGGCTGCCGGGTGGAGGG + Intronic
1077028402 11:451898-451920 CCGGGTGGCTGCGGGGCCCTCGG + Intronic
1077101478 11:824442-824464 CCGGGTGGACGCGCGGTCGGCGG - Intronic
1077188578 11:1246320-1246342 CGGGGTGGCCGTGGGGCCAGTGG - Exonic
1077189540 11:1250091-1250113 CGGGGTGGCCGTGGGGCCAGTGG - Exonic
1080503879 11:32893492-32893514 CGGGGTGGTCGCGGGTAGGTGGG + Intronic
1081528329 11:43942283-43942305 CGGGTTGGCCGCGGGGCCGCAGG - Exonic
1081928535 11:46851064-46851086 GGGGGTGGGGGCGGGGTTGTTGG - Intergenic
1081969128 11:47186219-47186241 CGGGGTGGCCGGGGGCTCCCTGG + Intronic
1083457135 11:62786814-62786836 CCGGGCGGCCGCGGAGCCGTGGG - Exonic
1084295677 11:68212638-68212660 CGCAGCGGCCGCGGGGTCGCCGG + Intronic
1084310447 11:68313215-68313237 CGGGGCGGCCGCGCGGCCGCTGG - Intronic
1085044002 11:73343090-73343112 CGGGGTGGCGGCGGGGCGGGGGG - Intronic
1085333066 11:75668772-75668794 CGGTGTGGCCGCAGGGTCCGCGG + Exonic
1088810199 11:113387140-113387162 CGGGGTGGCCACGGGGGAGGTGG - Intergenic
1089572390 11:119419226-119419248 TGAGGTGGCCGCGTGGACGTGGG + Exonic
1091286572 11:134411774-134411796 CGGGGCGCCCGCGGGGGCGCGGG + Intronic
1092743166 12:11649554-11649576 AGGGGCGGCCGCGGGGGCGCGGG - Intergenic
1095687304 12:45050730-45050752 CAGGGCGGTCGCCGGGTCGTGGG + Exonic
1096063962 12:48724818-48724840 CGGGGTGGCTGCCGGGTGGAGGG - Intergenic
1096856664 12:54488446-54488468 CGGGGTGGCTGCGGGGCGGAGGG + Intergenic
1097234391 12:57529425-57529447 CGGGGGGGCGGGGGGGTGGTGGG - Exonic
1098279172 12:68845946-68845968 GCGGGTGGCAGCGGGGTCGGGGG - Exonic
1099255546 12:80308210-80308232 CGGGGTGGCTGCTGGGTGGAGGG + Intronic
1101860002 12:108475174-108475196 CGGGGTGGGGGGGGGGTGGTGGG + Intergenic
1101875087 12:108592239-108592261 TGGGGAGGCCGAGGGCTCGTCGG - Exonic
1102186358 12:110951060-110951082 CGGGGTGGCAGCGGGGCGGAGGG + Intergenic
1102394609 12:112575374-112575396 CGCGCTGGCTGGGGGGTCGTGGG + Intronic
1103698414 12:122835223-122835245 CGGGGTCGCCGCGGGATGGGGGG + Intronic
1104228157 12:126857316-126857338 TGGGGTGGCGGTGGGGTGGTGGG - Intergenic
1104876660 12:132039571-132039593 CGGGGTGGTGGCGGGGTTGGGGG - Intronic
1104940279 12:132391972-132391994 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940318 12:132392058-132392080 CGGGGTGGCCGGAGGGTCCCTGG - Intergenic
1104940343 12:132392115-132392137 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940370 12:132392172-132392194 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940396 12:132392229-132392251 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940423 12:132392286-132392308 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940450 12:132392343-132392365 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940477 12:132392400-132392422 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940504 12:132392457-132392479 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1105368468 13:19782323-19782345 CGGGGTGGCCGCGGGGTCGTGGG - Intronic
1107133364 13:36919806-36919828 TGGGGTGGGCGCGGGGCCGGAGG - Intronic
1107831034 13:44373924-44373946 CGGGTGGGCCGCGGGGGCCTCGG + Exonic
1108062949 13:46551901-46551923 GGGGGTGGGTGCGGGGTTGTCGG - Intergenic
1108348132 13:49565690-49565712 CGGGGTGGCTGCCGGGTGGAGGG - Intronic
1108727847 13:53201346-53201368 GGTGGTGACCGCGGGGTCGTTGG + Intergenic
1111388639 13:87561889-87561911 CGGGGTGGCGGCGGGGCAGAGGG - Intergenic
1115398584 14:32934899-32934921 CGGGGCGGCCGCGGGGGTGCCGG + Intergenic
1116223211 14:42113769-42113791 CCGGGTGGCCGTGGGCTCGGCGG - Intergenic
1118890354 14:69903370-69903392 CGGGGTGGCGGCCGGGCCGAGGG - Intronic
1119259420 14:73228613-73228635 AGGGGTGGCTGCGGGGTCTGCGG + Intergenic
1121744384 14:96276788-96276810 CGGGGTGGCCTCGGGGTAGGTGG - Intergenic
1122238214 14:100344874-100344896 CGGGGTGGCTGCCGGGTGGAGGG - Intronic
1122719695 14:103715362-103715384 CCGGGCGGCAGCGGGGTCGGAGG - Intronic
1123706833 15:22956709-22956731 CGGGGCGGCAGTGGGGCCGTGGG - Intronic
1125874716 15:43133823-43133845 CAGGGTGGTCGCGGGGTTGGCGG + Exonic
1129168681 15:73794501-73794523 AGGGGTGGTCCCGGGATCGTGGG + Intergenic
1129189138 15:73927413-73927435 CGGCGTGGGCGCGGGGGCGGCGG + Exonic
1132544536 16:527302-527324 CGGGGTCGGGGCGGAGTCGTGGG + Intergenic
1132583125 16:694329-694351 GGGGGTGGCCCCGGGGCAGTTGG + Exonic
1133011052 16:2912042-2912064 CGGGGTGGCGGCGGCGGCCTGGG + Exonic
1133103931 16:3494839-3494861 CAGGGTGGCCGGGGCGTCCTTGG + Exonic
1133212668 16:4272117-4272139 CGGGGCTGCAGCGGGGTCGGGGG - Intronic
1134482694 16:14632832-14632854 CGGGGAGGTCGCGGGGTTGAGGG + Exonic
1134718009 16:16366540-16366562 CGCCGTGGCCGCGGGGCTGTTGG + Intergenic
1134956742 16:18385619-18385641 CGCCGTGGCCGCGGGGCTGTTGG - Intergenic
1136919036 16:34246029-34246051 CGGGGTGGCTGCTGGGTGGAGGG + Intergenic
1136919063 16:34246149-34246171 CGGGGTGGCTGCCGGGTGGAGGG + Intergenic
1137438978 16:48482964-48482986 CGGGGTGGCCGCCGGGCAGAGGG + Intergenic
1139574741 16:67833765-67833787 CGGGGTCGCCGCGGGGTGCGCGG + Exonic
1140602929 16:76500086-76500108 CGGGGTGGCGGCGGGGCAGAGGG + Intronic
1141869050 16:86772046-86772068 TGGGGTGGGGGCGGGGTAGTGGG + Intergenic
1142005976 16:87689802-87689824 CGGGGTGGCCGCGGGGCTGGTGG - Exonic
1142090385 16:88206825-88206847 AGGGGAGGCCGCGGGGACGGAGG + Intergenic
1142090397 16:88206850-88206872 AGGGGAGGCCGCGGGGACGGAGG + Intergenic
1142090410 16:88206876-88206898 AGGGGAGGCCGCGGGGACGGAGG + Intergenic
1142090423 16:88206902-88206924 AGGGGAGGCCGCGGGGACGGAGG + Intergenic
1142090446 16:88206951-88206973 AGGGGAGGCCGCGGGGACGGAGG + Intergenic
1142090458 16:88206976-88206998 AGGGGAGGCCGCGGGGACGGAGG + Intergenic
1142090470 16:88207001-88207023 AGGGGAGGCCGCGGGGACGGAGG + Intergenic
1142090482 16:88207026-88207048 AGGGGAGGCCGCGGGGACGGAGG + Intergenic
1142090495 16:88207052-88207074 AGGGGAGGCCGCGGGGACGGAGG + Intergenic
1142090507 16:88207077-88207099 AGGGGAGGCCGCGGGGACGGAGG + Intergenic
1142090555 16:88207178-88207200 AGGGGAGGCCGCGGGGACGGAGG + Intergenic
1142090580 16:88207229-88207251 AGGGGAGGCCGCGGGGACGGAGG + Intergenic
1142090605 16:88207280-88207302 AGGGGAGGCCGCGGGGACGGAGG + Intergenic
1142090617 16:88207305-88207327 AGGGGAGGCCGCGGGGACGGAGG + Intergenic
1142090642 16:88207356-88207378 AGGGGAGGCCGCGGGGACGGAGG + Intergenic
1142090654 16:88207381-88207403 AGGGGAGGCCGCGGGGACGGAGG + Intergenic
1142205242 16:88779805-88779827 CGCGGTGGCCGGGGGTCCGTCGG - Intronic
1142949340 17:3465078-3465100 CGGGGTGGCTGCCGGGTGGAGGG - Intronic
1143476875 17:7208100-7208122 GAGGCTGGCCACGGGGTCGTGGG - Intronic
1143590886 17:7885329-7885351 CGGGGTGGCGGCGGCGGCGGCGG - Intronic
1144454130 17:15405042-15405064 CGAGCTGGCCGCGGGGACGGAGG + Intergenic
1144489935 17:15699962-15699984 CGGGGTGGTCGCGGGGTTCTGGG + Exonic
1144911027 17:18681997-18682019 CGGGGTGGTCGCGGGGTCCTGGG - Intronic
1146888250 17:36486791-36486813 CGGGGAGGTCGCGGGGTCCAGGG + Intronic
1147250822 17:39151649-39151671 TGGGGGGGCCGCTGGGTCGGTGG + Exonic
1147709055 17:42449286-42449308 CGGGGTGGCTGCCGGGTGGAGGG - Intergenic
1148549755 17:48543443-48543465 CGGGCTGGCCGCGGGTTCCTCGG + Exonic
1148830161 17:50426057-50426079 GGGGAGGGCCGCGGGGTCGGAGG + Intergenic
1149894757 17:60421402-60421424 CGAGGTGGCCGCTGGGTGGCAGG + Intronic
1151574202 17:74943406-74943428 CAGGGTGGCCGCGGGGCTATAGG + Intronic
1152363242 17:79841968-79841990 GGGGGTGGCCGGGGGCTCCTTGG - Intergenic
1152808790 17:82371617-82371639 CGGGGCCGCAGCGGGGTCGGCGG - Intergenic
1155497602 18:26458172-26458194 CGGGCTGGCTGCTGGGTCGCAGG - Intronic
1156243066 18:35271950-35271972 CCGGGTGGGCGCGGGCTCGGCGG - Intronic
1156370810 18:36469817-36469839 GGGGGTGGCGGCGGGGTCTGCGG + Intronic
1157354079 18:46917401-46917423 CGTGGTGGCGGCAGCGTCGTTGG - Intronic
1158401026 18:57121867-57121889 CGGGGTCGCCGCGGGACCGGGGG - Intergenic
1160453518 18:78980373-78980395 CGGGGTGGCCGGGGGGTCTGGGG + Intronic
1160592343 18:79951548-79951570 CGGGGGCGGCGCGGGGTCCTCGG - Intronic
1160766026 19:808462-808484 CGGGGCGGCCCCGGGGTGGAGGG + Intronic
1160991840 19:1863319-1863341 GGGGGTGGCCCCGGGGTCCCGGG + Exonic
1162128245 19:8510882-8510904 CGCGGGGGCCGCGGGGGCGCCGG + Exonic
1162163858 19:8739490-8739512 CGGGGTGGCTGCCGGGTGGAGGG - Intergenic
1162367800 19:10259779-10259801 CGGGGTGGCCGCTGGGCCCTGGG - Exonic
1163019243 19:14473822-14473844 CGCGGTGGCCGCGGTGGCCTTGG - Exonic
1164126242 19:22321639-22321661 CGGGGTGGCCGCCGGGCGGAGGG + Intergenic
1164218650 19:23173317-23173339 CGGGGTGGCTGCCGGGTGGAGGG - Intergenic
1165427479 19:35754068-35754090 CCGGGTGGCCCCGGGGGTGTGGG - Exonic
1165723448 19:38095955-38095977 CTGGGTGGCCCTGGGGTTGTGGG - Intronic
1165914364 19:39248537-39248559 CGCAGTGGCCGCGGGGCTGTGGG - Intergenic
1165916526 19:39264402-39264424 CGCGGTGGCCGCGGGACTGTGGG + Intergenic
1166690903 19:44820793-44820815 AGGGGTGGCAGCGGGGGCTTCGG + Exonic
1167056116 19:47112462-47112484 CGGGGTGGCCGGGCGGGCGTCGG + Exonic
1168494994 19:56840467-56840489 CTGGCTTGCCGCGGGGTCTTGGG + Intronic
924962381 2:46314-46336 CCGGGTAGCCGCGGGGTCCCGGG + Exonic
925519698 2:4729962-4729984 CGGGGTGGCGGGGGGGTCTCAGG + Intergenic
927125942 2:20012530-20012552 CGGGCGGGCCACGGGGTCGGGGG + Exonic
927680295 2:25134613-25134635 TGAGGTGGCGGCGGGGTCGGGGG - Intronic
927900620 2:26815760-26815782 CGGGGGGGCCGCCGGGTGGGGGG + Intergenic
927945731 2:27134211-27134233 CAGGGTGGCCGGGGGGTCGCGGG - Intronic
929062034 2:37932979-37933001 CGGGGTGGCTGCTGGGTGGAGGG + Intronic
930124222 2:47783498-47783520 CGGGGTGGGGGTGGGGTCGAAGG + Intronic
934993186 2:98935863-98935885 CGGGGTGGGCGCGGGGGCACCGG - Intronic
935201018 2:100856707-100856729 CGGGGTGGGGGCGGGGGCGGGGG + Intronic
942079282 2:172385110-172385132 TGGGGTGGGGGCGGGGTTGTGGG - Intergenic
942970828 2:181956038-181956060 AGGGGTGGCGGCGGGGAGGTGGG - Intronic
945032944 2:205682243-205682265 CGGGGCGGGCGAGGGGTGGTGGG + Intronic
947841017 2:233208130-233208152 CTGGGTGGCCGCAGGGTGCTTGG - Intergenic
948724950 2:239928910-239928932 CCGGGTGGCCGCGGGGCGATGGG - Intronic
1170202508 20:13760507-13760529 CGGGGTGGCTGCCGGGTGGAGGG - Intronic
1170561163 20:17559810-17559832 CGGGGTGGCAGGGGGATGGTTGG - Intronic
1172907223 20:38378882-38378904 CGGGGTGGCTGCCGGGTGGAGGG - Intergenic
1172910868 20:38407801-38407823 CGGGGTGGCTGCCGGGCAGTGGG - Intergenic
1174263968 20:49318387-49318409 CGCGGTGGCCACGGGGGCCTGGG + Intergenic
1175847105 20:62065001-62065023 CGGGGCGGCGGCGGGGGCGGCGG + Exonic
1176156985 20:63626923-63626945 CGGGGGGGCCGCGGGCTCGCCGG + Intronic
1176207269 20:63895638-63895660 GGGGGCGGCCGCGGGGACCTGGG - Intronic
1177788237 21:25695504-25695526 CGGGGCGGCCGCGGGGCAGAGGG + Intronic
1178873097 21:36392452-36392474 CGGGGTGGCGGCCGGGTAGAGGG + Intronic
1179960626 21:44765377-44765399 TGGGGTGGCGGGGGGGTCGGAGG - Intergenic
1180876499 22:19177578-19177600 CGGGGTGACCGCGGGGCCCTGGG - Intronic
1181531839 22:23521604-23521626 CGGGGTCGCCGAGGGGACGCGGG - Intergenic
1183185799 22:36290979-36291001 CGGGGTGGCCGCCGGGCGGAGGG - Intronic
1183546095 22:38455467-38455489 CCGGGAGGCCGAGGGGTCGCGGG - Intergenic
1184376637 22:44117495-44117517 CGGGGTGGAAGCAGGGTAGTTGG + Intronic
1185408556 22:50671388-50671410 TGGGGTGGCAGCGGGGCAGTGGG + Intergenic
950583489 3:13878167-13878189 CGGGGAGGCCGCGGCGCCGGCGG + Intronic
952706187 3:36380396-36380418 CGAGGTGGCCGCGGGCGCGGCGG + Exonic
952892679 3:38053661-38053683 CGGGGTGGCCGCTGGGCAGAGGG - Intronic
952970943 3:38649723-38649745 CGGGCTGGGGGCGGGGTCGGGGG + Intergenic
954136466 3:48584321-48584343 CTGGGGGGCCACGGGGTCCTGGG + Exonic
954247092 3:49340378-49340400 TGGGGTGCCCGATGGGTCGTGGG - Intronic
954333508 3:49903264-49903286 CGGGAGGGCCGTGGGGTCCTGGG + Exonic
955161286 3:56467837-56467859 TGGGGTGTTCGCGGGGTCGGGGG - Intronic
956884779 3:73548129-73548151 GGGTGTGGGCGCGGGGTTGTTGG - Intronic
959201697 3:103255064-103255086 CGGGGTGGCTGCGGGGTGGAGGG + Intergenic
960007075 3:112791243-112791265 CGGGGTGGGGGCGGGGTGGCAGG + Intronic
962808836 3:138945500-138945522 CAGGCTGGCGGCGGCGTCGTCGG + Exonic
962971009 3:140402017-140402039 AGGGGTGGCGGCGGGGGAGTGGG + Intronic
965558111 3:170038028-170038050 CAGGGTCGCCGCGGGGTCCCGGG + Exonic
965650062 3:170923749-170923771 CGGGGTGGCTGCCGGGTGGAGGG - Intergenic
966762206 3:183428426-183428448 CGAGGTGGGCGCTGGGGCGTGGG - Intronic
968659509 4:1793297-1793319 CGCGGTGGCGGCGGCGTCGCGGG + Exonic
968850582 4:3075033-3075055 CCGGGTGGCGGCGGGGGCGGCGG - Exonic
971030756 4:22634813-22634835 CCGGGTGGGCGCGGGCTCGGCGG + Intergenic
975793705 4:77984004-77984026 CGGGGTGGCTGCCGGGTGGAGGG + Intergenic
979641629 4:123016325-123016347 CGGGGTGGCTGCCGGGTGGAGGG + Intronic
982709727 4:158746760-158746782 CGGGGTGGCTGCCGGGTGGAGGG + Intergenic
982770199 4:159390268-159390290 GGGGGTGGCCACGGGGTGGGGGG - Intergenic
985646063 5:1085231-1085253 CGGGATGTCCGGGGGGTCGAAGG + Exonic
985673185 5:1216878-1216900 CGCGTAGGCCGCGGGGTCGGAGG - Exonic
986330847 5:6714709-6714731 CGGGGAGGCCGCGGGGGCGGGGG + Intronic
987085168 5:14461268-14461290 CGGGGTGGCCGCACTGTCGTCGG - Exonic
989828860 5:45890688-45890710 CGGGGTGGCTGCTGGGCCGAGGG - Intergenic
996057690 5:118999130-118999152 CGGGGTGGCTGCCGGGTGGAGGG - Intergenic
998364318 5:141618932-141618954 CGGCGTAGGCGCGGGGTCGCCGG - Exonic
999251219 5:150183565-150183587 TGGGGTGGCCGTGATGTCGTGGG - Exonic
1001065055 5:168529538-168529560 GGGGGCGGCCGCGGGGGCGGCGG + Exonic
1001154009 5:169257372-169257394 CGGGGTGGGGGCGGGGAGGTTGG - Intronic
1002646508 5:180659176-180659198 GGGGGTGGCGGCGGGGACGCGGG - Intergenic
1002646521 5:180659202-180659224 GGGGGTGGCGGCGGGGACGCGGG - Intergenic
1007775717 6:44223461-44223483 CGGAGTCGCCGCGGGGTGGCAGG + Intronic
1012899593 6:104991256-104991278 CGGGGTGGCTGCCGGGTGGAGGG + Intronic
1013073789 6:106752519-106752541 CGGGGTGGCGGGGGGGTAGTGGG + Intergenic
1013530694 6:111017210-111017232 CGGGGTGGCGGCCGGGTAGAGGG + Intronic
1018472079 6:164106340-164106362 CGTGGTGGCAGCAGGGTAGTTGG - Intergenic
1019059764 6:169248654-169248676 CAGCGTGTCCGCGGGGCCGTTGG + Exonic
1019421830 7:954335-954357 CGGGGTGGGCGCGGGGTGCCGGG - Intronic
1019653446 7:2173293-2173315 CGGGGCGGCAGAGGGGTGGTGGG - Intronic
1020080373 7:5283215-5283237 CGGGGTGGCCTCGGGTTCCCGGG - Intronic
1021647380 7:22800999-22801021 CGGGGTGGCTGCCGGGTGGAGGG - Intergenic
1022104678 7:27189370-27189392 CGGGGTCGCCTCGAGGCCGTCGG + Intergenic
1023945151 7:44797002-44797024 CGGGGCGGCTGCGAGGCCGTTGG + Intronic
1025198542 7:56948964-56948986 CGGGGTGGCCTCGGGTTCCCGGG + Intergenic
1025673409 7:63627969-63627991 CGGGGTGGCCTCGGGTTCCCGGG - Intergenic
1026008011 7:66614747-66614769 CGGGGTGGCTGCCGGGTGGATGG - Intergenic
1026479330 7:70764805-70764827 CGGGGAGGCAGAGGGGTGGTGGG - Exonic
1027592561 7:80134767-80134789 GGGAGTGGTCGCGGGGTGGTGGG + Exonic
1028841559 7:95434811-95434833 CGGGGTGGCCGCGTGGTGCGGGG - Intronic
1029730141 7:102433512-102433534 CGGGGTGGAGGCGGGGCCGGGGG + Exonic
1032028704 7:128463732-128463754 CGGGGTGGCAGCCGGGCAGTGGG - Intergenic
1034425790 7:151013481-151013503 AGGGGTGGCTGAGTGGTCGTGGG - Intronic
1035435550 7:158856699-158856721 CCGGGCGGCCGCGGTGTCCTCGG - Exonic
1035612181 8:973901-973923 CGGGGTGGCGGCGGTGGCGGTGG - Intergenic
1036169037 8:6465390-6465412 CGGGGTGGACATGGGGTGGTGGG - Intronic
1036352835 8:8022824-8022846 CGGGGTGGGGGTGGGGTCGGGGG - Intergenic
1037879359 8:22565594-22565616 CGGGGCGGGCGCCCGGTCGTCGG - Intronic
1040106594 8:43545484-43545506 CGGGGTGGCCATGGAGTCCTTGG - Intergenic
1045571338 8:103371664-103371686 CGGGGAGGCGGCGGGGCCCTGGG - Exonic
1047782136 8:128118941-128118963 CGGGGTGGCTGCTGGGTGGAGGG + Intergenic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049412393 8:142479041-142479063 TGGGGTGGCCGTGGGGTAGTAGG + Intronic
1049687323 8:143944188-143944210 GGGTGTGGCCGCGGGGACGCAGG - Intronic
1049720220 8:144112181-144112203 CAGGGTGGCAGAGGGGTCATGGG - Intronic
1053902148 9:42805921-42805943 CGGGGTGGGCGTGGGGGCCTTGG + Intergenic
1054532829 9:66199604-66199626 CGGGGTGGGCGTGGGGGCCTTGG - Intergenic
1055242090 9:74197637-74197659 CGGGGTGGCTGCCGGGTGGAGGG - Intergenic
1056564415 9:87759143-87759165 CGGGGTGGCTGCCGGGTGGAGGG + Intergenic
1057313353 9:93954896-93954918 TGTGGCGGCCGCGGGGTCGCGGG - Intronic
1058763518 9:108159766-108159788 TGGGGTGGTGGCGGGGTCGGGGG + Intergenic
1058976935 9:110133651-110133673 CGGGGTGGGCGGAGGGTAGTGGG - Intronic
1059483713 9:114611528-114611550 CGGGGTGGCGGCGGCGGCGGCGG + Exonic
1060468578 9:123929690-123929712 CGGGGTGCGCGCGGGGTGGCAGG - Intronic
1061802545 9:133120422-133120444 CGGGGTGGGGGGGGGGTCGGGGG - Intronic
1061859464 9:133460463-133460485 CGGGGGGGCGGCGGGGGCGGGGG + Intronic
1061914846 9:133744763-133744785 CGGGGTGGCTGCCGGGTGGAGGG - Intergenic
1061930984 9:133833057-133833079 TGGGCTGGCCACGGGGTCCTTGG - Intronic
1062343938 9:136106181-136106203 TGGGGGGGCCGGGGGGTAGTTGG + Intergenic
1187212454 X:17244802-17244824 CGGGGTGGCCGCCGGGCAGAGGG + Intergenic
1189160590 X:38804927-38804949 CATGGTGGCCGCGCGGACGTTGG - Exonic
1190984430 X:55488530-55488552 GGGGGTGGCGGCGGGGGCGGGGG + Exonic
1191894150 X:65975237-65975259 CGGGGTGGCGGCGGGGCAGAGGG + Intergenic
1192892625 X:75407322-75407344 CGGGGTGGCTGCCGGGTGGAGGG - Intronic
1193114847 X:77766384-77766406 CGGGGTGGCAGCGGGGCAGAGGG + Intronic
1198871050 X:141177247-141177269 TGGGGGGGCCGCGGCGGCGTGGG + Intergenic