ID: 1105370903

View in Genome Browser
Species Human (GRCh38)
Location 13:19801107-19801129
Sequence CTTCATATGCACAAGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105370903_1105370910 18 Left 1105370903 13:19801107-19801129 CCTTCTGCCTTGTGCATATGAAG 0: 1
1: 0
2: 2
3: 16
4: 226
Right 1105370910 13:19801148-19801170 CCACAGCATGCAGCCTTCACTGG 0: 1
1: 1
2: 0
3: 24
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105370903 Original CRISPR CTTCATATGCACAAGGCAGA AGG (reversed) Intergenic
902236735 1:15062494-15062516 CGTCAGATGCCCAAGGCAAAGGG - Intronic
903124711 1:21239802-21239824 CATGCTATGCCCAAGGCAGAAGG + Intronic
904099391 1:28010716-28010738 CATCATATTCAGAAAGCAGAGGG - Intronic
905088837 1:35410053-35410075 CATCATATGATCATGGCAGAAGG + Intronic
905463274 1:38134968-38134990 GTTCCTATGCCCAAGGCAGGAGG - Intergenic
905488568 1:38325670-38325692 CCTCAAATGCACAGGTCAGAGGG - Intergenic
906621827 1:47287384-47287406 CTTCATATTCACTAGGAAGTTGG - Intronic
907014968 1:51003788-51003810 CTTGAGAGGGACAAGGCAGATGG + Intergenic
908457963 1:64322417-64322439 CTGAATATGAATAAGGCAGAGGG + Intergenic
908863189 1:68513931-68513953 ATTCATAATCACAAGGCAGCTGG + Intergenic
909795805 1:79734515-79734537 CTTCATTTGGACAGTGCAGATGG + Intergenic
910878312 1:91898844-91898866 CTACATATACACAACACAGATGG - Intronic
911228029 1:95328956-95328978 CTGCATCTTCACATGGCAGAAGG + Intergenic
912431287 1:109629781-109629803 CTTCATGTCCCCCAGGCAGAGGG + Exonic
912913865 1:113791620-113791642 CTTTCTATTCACAAGGCACAAGG - Intronic
916545436 1:165799796-165799818 CTTCATATGGCCAAGGTAGGAGG + Intronic
916627154 1:166570610-166570632 CTTCTCATGCACAAGGCAATGGG + Intergenic
917379997 1:174395674-174395696 ATTCATATGAACAAATCAGAAGG - Intronic
918740616 1:188126699-188126721 CTTCATCCTCACATGGCAGAAGG + Intergenic
918791371 1:188834558-188834580 CTGCATCCTCACAAGGCAGAAGG - Intergenic
919663831 1:200273353-200273375 CTTCATATTCATAAGGCACAAGG + Intergenic
921014971 1:211181245-211181267 ATTCATATGCACTAGGTATAAGG - Intergenic
1063279195 10:4606874-4606896 CTTCATATCCAGAAGAAAGAGGG + Intergenic
1064387411 10:14909036-14909058 CTTCACCTGCAAAAGGCTGATGG - Exonic
1064900335 10:20289147-20289169 ATTCAGAGGCACAAGGCTGATGG + Exonic
1065198450 10:23289657-23289679 CTTAAAATCAACAAGGCAGATGG + Intronic
1068802372 10:61156653-61156675 CTTCAATTACACAAGCCAGAAGG + Intergenic
1070363563 10:75714310-75714332 TTTCATCTGCACAAGGAACATGG - Intronic
1072258732 10:93646633-93646655 CTTCATATGGCCAGAGCAGAAGG + Intronic
1072457371 10:95588486-95588508 CTTGAAATGCCCAAGCCAGAAGG - Intergenic
1073885660 10:108036880-108036902 CCTTATATGAATAAGGCAGAGGG - Intergenic
1076197288 10:128528001-128528023 ATTCCTCTGCACAAGTCAGAAGG - Intergenic
1080722397 11:34862669-34862691 GTTCATATGCACCAGCCAGGGGG - Intronic
1081266820 11:41034262-41034284 CTTCATAATAACATGGCAGAGGG - Intronic
1083380785 11:62266922-62266944 CTTCATAGGCCCATGGCTGATGG - Intergenic
1085846457 11:80071395-80071417 CTGCATTTTCACATGGCAGAAGG - Intergenic
1086922646 11:92604945-92604967 CTTCATAAGCATCACGCAGAAGG - Intronic
1088571563 11:111228382-111228404 CTCCATCTTCACATGGCAGAAGG + Intergenic
1093301373 12:17461534-17461556 CTTAATATTCACAAGGAAGTTGG + Intergenic
1095343147 12:41116550-41116572 CTGCATCTTCACATGGCAGAAGG - Intergenic
1097708757 12:62895754-62895776 CTGCATATGCACAGATCAGATGG - Intronic
1098952026 12:76649293-76649315 AGTCATATGAATAAGGCAGAAGG - Intergenic
1102730375 12:115103849-115103871 CTTCAGTTGCAAAAGGGAGATGG - Intergenic
1105370903 13:19801107-19801129 CTTCATATGCACAAGGCAGAAGG - Intergenic
1105747536 13:23391894-23391916 CTTCATGTGCACATGGAACATGG + Intronic
1106689653 13:32100834-32100856 CTGCATCTTCACATGGCAGAAGG + Intronic
1107598061 13:41984650-41984672 CTGCATTAGCACAAGGGAGAGGG - Intergenic
1108190025 13:47928860-47928882 CTGCATATGCAGAAAGCACATGG + Intergenic
1108379486 13:49842422-49842444 CCTCACATGGAGAAGGCAGAAGG - Intergenic
1111413841 13:87912605-87912627 CGTCTTGTGTACAAGGCAGAGGG + Intergenic
1111637398 13:90923647-90923669 TTTCATATGTACAAGCCAGAAGG + Intergenic
1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG + Intronic
1115472557 14:33783394-33783416 TTTCATATTCATATGGCAGAAGG - Intronic
1118455731 14:65944451-65944473 CTTCATCTTCACATGGCAGAAGG + Intergenic
1118572644 14:67209162-67209184 CTTCCTATGCACTAGGCATTGGG + Intronic
1118743703 14:68759068-68759090 CTTCATGTGTAAAATGCAGAGGG - Intergenic
1119227671 14:72956464-72956486 CTGCATGTGCACGAGGAAGAAGG + Exonic
1120027246 14:79600396-79600418 CTTCAGATGCACAAGGTTCAAGG + Intronic
1120037026 14:79709454-79709476 CTGCATACCCCCAAGGCAGATGG + Intronic
1120573307 14:86148740-86148762 CATCTCATGCAGAAGGCAGAAGG + Intergenic
1121161281 14:91743712-91743734 CCTCCCATGCAGAAGGCAGAAGG - Intronic
1122513013 14:102285249-102285271 CTGCACCTGCACAAAGCAGATGG + Intronic
1122588377 14:102826913-102826935 CTCCATTTGCCCAAGGCACATGG - Intronic
1126415744 15:48415997-48416019 AGTCAAATGCACCAGGCAGAGGG + Intronic
1128383091 15:67127547-67127569 ATTAATATGCACAAGGGTGAAGG - Intronic
1129568868 15:76656601-76656623 TCTCATCTGCACAAGGCACATGG + Intronic
1133068427 16:3227685-3227707 CATCATCTTCACAAGGCAGCAGG - Intronic
1134243105 16:12520249-12520271 CCTCCTCTTCACAAGGCAGATGG + Intronic
1134425811 16:14143204-14143226 CTTAATATGTACAAGGGACAAGG + Intronic
1137419054 16:48315453-48315475 CTGCATCTTCACATGGCAGAAGG + Intronic
1137903335 16:52293189-52293211 CCTCATGTTCACAAGGAAGATGG - Intergenic
1138000019 16:53268529-53268551 ATTTATATGCACAAGGAGGAGGG - Intronic
1138146841 16:54620271-54620293 CTTCTTATGGAAAAGGCAGGGGG + Intergenic
1143833193 17:9669159-9669181 CTTCAGGTGCCCAACGCAGAGGG + Intronic
1146672620 17:34752171-34752193 CTTCATCATCACAAGGTAGAAGG + Intergenic
1147367020 17:39965791-39965813 CTTCCTCAGCACCAGGCAGAAGG - Exonic
1149120909 17:53162861-53162883 ATTGATATACACAAGCCAGAGGG + Intergenic
1149286073 17:55165815-55165837 CTGCATCCTCACAAGGCAGAAGG - Intergenic
1149466349 17:56882770-56882792 CTTTATTTGTACAAGGCTGAAGG - Intergenic
1151383189 17:73739622-73739644 CTTCCTATGGACACGTCAGAGGG - Intergenic
1153519925 18:5941967-5941989 CTCCCCAGGCACAAGGCAGATGG + Intergenic
1154092611 18:11379153-11379175 CTTCCTGTGCAAATGGCAGAAGG + Intergenic
1157666295 18:49489934-49489956 CTTCAAATGCAAAAGGCTAATGG + Intronic
1160128225 18:76199145-76199167 CTTCAGATTCCCAAGGCAGCAGG - Intergenic
1164052113 19:21592563-21592585 CTTCATCTGCAAAATGGAGATGG - Intergenic
1166064547 19:40349545-40349567 CTTCATCTGCAAAATGCACACGG + Intronic
1166125966 19:40715557-40715579 ATTTATATGCACAAGGAAGGAGG - Intronic
1167528981 19:50003057-50003079 CTTCATCTGCAGAGGGGAGATGG - Intronic
925844526 2:8023563-8023585 CTTCAGATGCACAAGGTATGGGG - Intergenic
926811557 2:16759405-16759427 CCTCATATGGACAAGGCAGATGG - Intergenic
926819316 2:16835166-16835188 CTTCAGGTGTCCAAGGCAGAAGG + Intergenic
927972956 2:27317094-27317116 TTTCATGCGCAGAAGGCAGAGGG + Intronic
928281819 2:29953260-29953282 CTTTCTTTGCACAGGGCAGATGG - Intergenic
928951593 2:36817909-36817931 CGTCATATGCACAGAGCAGCTGG - Intergenic
930004192 2:46882888-46882910 CTTCATGTACACAAGCCACATGG - Intergenic
930194161 2:48492641-48492663 CTTAAAATGCACAAGCCACATGG - Intronic
930319243 2:49833137-49833159 CTTCATATGAAGAAAGCAAAAGG + Intergenic
930473160 2:51846230-51846252 GTTAGTATGCACAAGGCAGATGG - Intergenic
933261303 2:80134563-80134585 ATTCAGATGCACAGGGCAAATGG + Intronic
933518093 2:83331553-83331575 CTTCATATAACCAAGGCAGAAGG - Intergenic
935277807 2:101490885-101490907 CCTCACATGTAGAAGGCAGAAGG - Intergenic
935677620 2:105609476-105609498 CTTGGGATGCACAGGGCAGAGGG - Intergenic
935841067 2:107110938-107110960 CTGCATCTTCACAATGCAGAAGG - Intergenic
936625826 2:114148490-114148512 CTTCACATGAACAAGTGAGAAGG + Intergenic
937547510 2:123040980-123041002 GTTCAAATGCTGAAGGCAGAAGG + Intergenic
938421388 2:131150125-131150147 TCTCATATGCACACGGCACAGGG - Intronic
940667313 2:156624701-156624723 CTACATTTTCACAAGGCAGAGGG + Intergenic
940887346 2:159001154-159001176 CTTCACATGCACCAGGAAAAGGG - Exonic
941380354 2:164785044-164785066 CTTCATCCTCACATGGCAGAAGG - Intronic
941734201 2:168955417-168955439 CTTCATATGACCAAAGCAGGAGG + Intronic
944920212 2:204404801-204404823 CCTCCAATGCACAAGGCAGACGG - Intergenic
945398265 2:209348203-209348225 CTTAAAATGCACAAGTCAGAAGG - Intergenic
946623605 2:221587149-221587171 CTTCATATGCACAGAGAAAAGGG + Intergenic
946841467 2:223824526-223824548 CTCCAAATGCAAAAGGCAGGTGG + Intronic
947888811 2:233597314-233597336 CTTGAAATGCAAGAGGCAGAAGG + Intergenic
948752735 2:240141861-240141883 CTGCACATGCACGAGTCAGAGGG - Intronic
1169594942 20:7187882-7187904 TTTCTCATGCACAAGGCAGGTGG + Intergenic
1172330264 20:34070979-34071001 CTTCATATGGCCAGGGCAGGAGG + Intronic
1172362937 20:34326888-34326910 CTTCTTATGGACAAAGCAGTTGG + Intergenic
1172652350 20:36512814-36512836 CTTGACATGCGCAAGGCTGAGGG + Intronic
1175974956 20:62706151-62706173 CTTGTTCTACACAAGGCAGATGG - Intergenic
1177442115 21:21139132-21139154 CTTTATAAGAAAAAGGCAGAGGG + Intronic
1178868970 21:36355520-36355542 CTACATTTGCACAAAGCAGTAGG + Intronic
1180786355 22:18549861-18549883 CTTCATAAGGTCAAGGCAGCTGG + Intergenic
1181131636 22:20735587-20735609 CTTCATAAGGTCAAGGCAGCTGG + Intronic
1181243275 22:21489414-21489436 CTTCATAAGGTCAAGGCAGCTGG + Intergenic
1181668268 22:24413095-24413117 CTCTAGATGAACAAGGCAGATGG - Intronic
1181975197 22:26723958-26723980 CTTCATCTTCACATGGCAGAAGG + Intergenic
1181975708 22:26727889-26727911 CTGCATCTTCACATGGCAGAAGG + Intergenic
1182085130 22:27556127-27556149 CTTCCTCTTCACAAAGCAGAGGG - Intergenic
1182523729 22:30902428-30902450 CTTCATGTGGACATTGCAGAAGG + Intronic
1183544316 22:38447519-38447541 CTTCACACTCACAGGGCAGAGGG + Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1185059257 22:48597514-48597536 CTGCATATGAACCAGCCAGAGGG - Intronic
949446023 3:4134581-4134603 ATTCAAAAGCAGAAGGCAGAAGG + Intronic
949661209 3:6281107-6281129 CTTGATGGGCACAAGGCAGGTGG + Intergenic
950520820 3:13496788-13496810 CTTCCTCTGCACAAGGAAGTTGG - Exonic
950950328 3:16992166-16992188 ATGCATATGAACAGGGCAGAGGG + Intronic
951800193 3:26587207-26587229 CCTCACAGGCACAAGGGAGAAGG - Intergenic
952539144 3:34347864-34347886 CTGCATATTCGCATGGCAGAAGG + Intergenic
952900833 3:38110533-38110555 CTTCTGATGGACCAGGCAGATGG + Intronic
953805391 3:46063558-46063580 CCTCAGAAGCACAAGGCAGGTGG + Intergenic
955243416 3:57201727-57201749 CCTAAGAGGCACAAGGCAGAAGG + Intronic
955317680 3:57952396-57952418 CTACAGATACACAAGGAAGATGG - Intergenic
955863222 3:63354580-63354602 CTTCAAACTCACAAGGCAAAGGG + Intronic
956125021 3:66003077-66003099 TTTCATATGTTCAGGGCAGATGG - Intronic
957245498 3:77711359-77711381 CTTTATAAGAAAAAGGCAGAGGG - Intergenic
960433285 3:117595793-117595815 CTGCATTTGCACAAAGCTGAGGG - Intergenic
960757905 3:121037497-121037519 CTTCATAAGGCCAAGGCAGGAGG - Intronic
961205877 3:125081119-125081141 CTTCATATACACAGAGGAGAGGG + Intergenic
961543326 3:127615493-127615515 CTTCATATGGAAAAGAGAGATGG - Intronic
962008598 3:131371914-131371936 CCTCATTTGCCCAAGTCAGAAGG - Intergenic
962010635 3:131387256-131387278 CCTCATTTGCCCAAGCCAGAAGG - Intronic
962082746 3:132157787-132157809 CTGCATATGGGGAAGGCAGAAGG - Intronic
964315815 3:155443244-155443266 CTTTTTTTCCACAAGGCAGAGGG - Intronic
965311905 3:167138977-167138999 ACTCATATGCCCAAGGTAGAAGG + Intergenic
968790528 4:2658197-2658219 CTTCATATGTAAACTGCAGATGG - Intronic
969122916 4:4922994-4923016 CTTCAGATGGCCAAGTCAGAAGG - Intergenic
970748024 4:19323028-19323050 CTTCAGATGAACAATGCAGCGGG + Intergenic
972750462 4:41982750-41982772 CTGCATGTGCACGAGGAAGAGGG + Exonic
973828649 4:54735939-54735961 CATCATATCCAGAAGGCAGGGGG + Intronic
974447917 4:62010340-62010362 ATTCGTATGCAGAAGGCACATGG + Intronic
976545409 4:86329658-86329680 CTGCATAAGCATATGGCAGATGG - Intronic
976549188 4:86374800-86374822 ATTCATATACACAACGTAGAAGG + Intronic
977209246 4:94199259-94199281 CTACATATGCACATGACAGGTGG - Intergenic
979233129 4:118369142-118369164 CTTCATATGCACTCAACAGACGG + Intergenic
979235723 4:118398064-118398086 CTTCAGGTGCGAAAGGCAGAGGG - Intergenic
979400185 4:120239649-120239671 GTTCATATTCATAAGGGAGAGGG + Intergenic
979865718 4:125750780-125750802 CTTAGTTTGCACATGGCAGAAGG - Intergenic
979961771 4:127029053-127029075 ATTCATATGCACATGAGAGAAGG - Intergenic
981129952 4:141147546-141147568 CTCTATGTACACAAGGCAGAGGG + Intronic
983891774 4:173037084-173037106 CTTGCTATGGGCAAGGCAGAGGG + Intronic
984140481 4:175999548-175999570 CTTCATATCCATAATGCACAAGG - Intronic
985408987 4:189663751-189663773 CTTCAAATGCACACAGCACAGGG - Intergenic
987218654 5:15766494-15766516 CTTCATCACCACAAGGCAGAGGG + Intronic
987975742 5:25012757-25012779 CTGCTTCTGCTCAAGGCAGAAGG + Intergenic
988012001 5:25500854-25500876 CTGAATATTCACATGGCAGAAGG - Intergenic
988714852 5:33815412-33815434 CTGCATCTTCACACGGCAGAGGG - Intronic
991214020 5:64140965-64140987 CTACATCTTCACATGGCAGAAGG + Intergenic
991456295 5:66807924-66807946 CATCATAGCCTCAAGGCAGAGGG - Intronic
992420230 5:76596665-76596687 CTTCACATGCCCAAAGCAGGAGG + Intronic
994797578 5:104324174-104324196 CTTCATAAGAAAGAGGCAGAGGG - Intergenic
994880082 5:105479922-105479944 CTTCGTATGCACTAGGGAAAAGG + Intergenic
1001294305 5:170488351-170488373 CCTCATCTGCACCAGGCATAAGG - Intronic
1001330819 5:170761165-170761187 CTCCATCTGTACCAGGCAGAAGG - Intergenic
1003332444 6:5141162-5141184 CTTCATAGGAATAATGCAGATGG + Intronic
1004791102 6:19027424-19027446 CTACATGTTCACATGGCAGAAGG - Intergenic
1007376241 6:41458614-41458636 CATCTTATGCACCAGGCATATGG + Intergenic
1011642646 6:89430520-89430542 CTTCTTTCTCACAAGGCAGAAGG + Intergenic
1019012364 6:168851957-168851979 TTTCATTTGCACAAAGCACAAGG + Intergenic
1020225812 7:6279122-6279144 CTTCTGATTCACAAGCCAGAAGG + Intergenic
1020402284 7:7792864-7792886 CTTCATTTTCACATGGCAGAAGG + Intronic
1023088212 7:36593605-36593627 GTTAATAGGCACAAGGAAGATGG - Intronic
1023213131 7:37830001-37830023 CTTAATAATCACAAGACAGAAGG - Intronic
1023519277 7:41034556-41034578 CTTCTTGTGCACCAGGCTGAGGG + Intergenic
1024912934 7:54466773-54466795 CTTCATATGGAAAAGGTGGAAGG + Intergenic
1026384843 7:69836299-69836321 CTCCAAACACACAAGGCAGAGGG - Intronic
1027130099 7:75584659-75584681 CTTCCTATATACAAGGCAAAGGG + Intronic
1027332906 7:77118630-77118652 CTTCATGAGCCCAAGGCAGGAGG + Intergenic
1029782878 7:102752667-102752689 CTTCATGAGCCCAAGGCAGGAGG - Intronic
1029864427 7:103611553-103611575 CTTCCTAGGTAAAAGGCAGAAGG + Intronic
1029874877 7:103739809-103739831 CTGCATATGAAGGAGGCAGAAGG + Intronic
1031146123 7:117998980-117999002 CTTCATCTTCACATGGCAGAAGG + Intergenic
1032394153 7:131576945-131576967 CTTCCTGTGCTCAATGCAGATGG - Intergenic
1033859145 7:145603667-145603689 CTTCATCTGAAAAAGGCATAGGG - Intergenic
1034048692 7:147958840-147958862 ATTCATATGCACAAGGCTTTAGG - Intronic
1034211106 7:149364041-149364063 GTTCACAGGCAAAAGGCAGAAGG - Intergenic
1035303619 7:157915949-157915971 CTTCATAAGCACAAAGCAGCTGG - Intronic
1038226506 8:25663126-25663148 CTTTAAATGCACAAGTCAGTGGG + Intergenic
1039604911 8:38872315-38872337 CTGCATTTTCACCAGGCAGAGGG + Intergenic
1040422917 8:47257513-47257535 CTGCATCTTCACATGGCAGAAGG - Intergenic
1044477465 8:92645324-92645346 CTCTGTATGCACATGGCAGAAGG + Intergenic
1045022289 8:98054151-98054173 CTTCATCTTCACAAGGCAGAAGG - Intergenic
1045745641 8:105417778-105417800 TTCCATATGCTCAAGGTAGAAGG - Intronic
1046190651 8:110790457-110790479 CTTCATATGCCCAAGCCATGTGG + Intergenic
1046470945 8:114673039-114673061 CAACATAAGCACAAGACAGATGG - Intergenic
1047193821 8:122703121-122703143 CTTCAAATGCACAAGGCACTGGG - Intergenic
1047896193 8:129369015-129369037 CTGCATACTCACAAGTCAGAAGG - Intergenic
1049328692 8:142038370-142038392 CTTCCTATGCCCAAGGGTGACGG + Intergenic
1049719351 8:144108457-144108479 CTGCACCTGCACAAGGAAGACGG + Exonic
1050208723 9:3228656-3228678 CCTCATATGTAGAAGGCATAGGG + Intronic
1052802804 9:32985734-32985756 TTTAAAAGGCACAAGGCAGAGGG + Intronic
1054911575 9:70460049-70460071 CTTAATAAGGACATGGCAGAGGG - Intergenic
1055420234 9:76132682-76132704 CTTCTTATGCACCAGGCACAAGG + Intronic
1055595910 9:77864082-77864104 CTGCTTCTGCTCAAGGCAGAAGG + Intronic
1055616876 9:78082203-78082225 CTGCATCTTCACATGGCAGAAGG - Intergenic
1056594751 9:87997787-87997809 CTTCATCCTCACATGGCAGAAGG - Intergenic
1057805426 9:98216420-98216442 CCTCATATCCACAAGGCTGTGGG + Intronic
1058924892 9:109653584-109653606 ATTCATATGCACATTGCAGTGGG - Intronic
1059691097 9:116687110-116687132 CTTCATCTGCACCAAGGAGACGG + Intronic
1060058095 9:120433187-120433209 CTTCATATGTACAAAATAGATGG - Intronic
1062109995 9:134777118-134777140 CTTCAGACGTGCAAGGCAGAGGG - Intronic
1062217697 9:135398293-135398315 AGTCAGATGGACAAGGCAGATGG + Intergenic
1187233383 X:17443702-17443724 CACCATTTGAACAAGGCAGAGGG - Intronic
1188620966 X:32223241-32223263 CTGTATCTTCACAAGGCAGAAGG + Intronic
1189255165 X:39632381-39632403 CTGCATCTTCACATGGCAGAAGG + Intergenic
1189302533 X:39962593-39962615 CTGCATCTTCACATGGCAGAAGG + Intergenic
1190024161 X:46907461-46907483 CTTCAAAGGCAAAAGGCACATGG + Intergenic
1194818002 X:98469022-98469044 CTTCATCCTCACATGGCAGAAGG + Intergenic
1195485546 X:105401031-105401053 ATTAATATTCACATGGCAGAAGG + Intronic
1195549877 X:106156161-106156183 CTGCATCTTCACATGGCAGAAGG + Intergenic
1196602011 X:117612456-117612478 TTTCATTTGCACAACACAGATGG + Intergenic
1197448901 X:126586551-126586573 GCTCATATACGCAAGGCAGATGG + Intergenic
1199497754 X:148472024-148472046 CTGCATCTTCACATGGCAGAAGG - Intergenic
1200163563 X:154021006-154021028 CTTCACATGCACATGCTAGAAGG - Intergenic