ID: 1105374135

View in Genome Browser
Species Human (GRCh38)
Location 13:19828181-19828203
Sequence GCAGAGGTGTGGGCCAGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 979
Summary {0: 1, 1: 0, 2: 5, 3: 96, 4: 877}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105374135 Original CRISPR GCAGAGGTGTGGGCCAGGTG CGG Intronic
900154122 1:1197326-1197348 GCTGAGGTGTGGGGAAGGTTGGG - Intronic
900166219 1:1245222-1245244 GGAGAGGTGTGGGGGAGGAGGGG - Intronic
900181121 1:1311406-1311428 GCACAGGGTTGGGCCTGGTGTGG - Exonic
900244202 1:1630121-1630143 GCAGAGGTGGGGCCCGGGTGCGG - Intronic
900271119 1:1789400-1789422 ACAGAGGGCTGGGCCGGGTGCGG + Intronic
900429813 1:2596240-2596262 GGTGAGGTGTGGGGCCGGTGGGG + Intronic
900508385 1:3042663-3042685 GCAGTGGTGCATGCCAGGTGCGG - Intergenic
900623698 1:3598726-3598748 GCAGAGGAGTGGGCCCCGGGGGG - Intronic
900901527 1:5519742-5519764 GCAGAGGTGTGCTGCAGGGGTGG - Intergenic
900999278 1:6140110-6140132 GCAGAGGCTCAGGCCAGGTGCGG + Intronic
901038883 1:6352334-6352356 GAAGAGGGAGGGGCCAGGTGTGG - Intronic
901419240 1:9139207-9139229 GCAGAGTTTGGTGCCAGGTGTGG + Intergenic
901542907 1:9932363-9932385 GTAGAGGGGAGGGCCGGGTGCGG + Intronic
901635638 1:10668948-10668970 CCAGAGGTCTGGGGCAGGGGCGG + Intronic
901756380 1:11443974-11443996 GAAGAGGGTTGGGCCAGCTGGGG - Intergenic
901790147 1:11649710-11649732 GCAGAGGGGAGAGCCAGCTGGGG - Intronic
901806262 1:11740539-11740561 GCAGAGGTGTGGGCCCAGCTGGG + Intronic
901877527 1:12175411-12175433 GCCCAGGTGTGGTCCAGCTGTGG + Intronic
902328548 1:15718659-15718681 GCAGAGGAGGGGGCAGGGTGGGG + Intronic
902429502 1:16352249-16352271 GGAGCGGGCTGGGCCAGGTGAGG - Exonic
902439981 1:16422870-16422892 GAGGAGGTTTTGGCCAGGTGTGG + Intronic
902578372 1:17392828-17392850 GCAGAGATTTGGGGCAGGGGTGG + Intronic
902795461 1:18798111-18798133 GCAGAGGCGAGGGGCAGGTGGGG - Intergenic
903008253 1:20312604-20312626 GCAGGTGTGTGAGCCTGGTGTGG - Intronic
903322342 1:22550671-22550693 GGAGAGGAGTGCGCCAGCTGGGG + Intergenic
903357081 1:22754839-22754861 GGGGAGGTGAGGGACAGGTGAGG + Intronic
903442525 1:23399056-23399078 GCATAGGTGTTGGCTGGGTGTGG - Intronic
903557291 1:24203104-24203126 GCAGGGGTGTGTGGGAGGTGGGG - Intergenic
903775278 1:25789390-25789412 GCAGAGGGGTGCGACAGGAGAGG + Intergenic
903859041 1:26354219-26354241 GCAGAGGTGTGGAGCTGGTTGGG + Intergenic
903875453 1:26470700-26470722 GTAGAGGGGAGTGCCAGGTGTGG - Exonic
903982143 1:27196845-27196867 ACAGCTATGTGGGCCAGGTGTGG - Intergenic
904085065 1:27900400-27900422 AAAGAGCTGTTGGCCAGGTGCGG - Intronic
904590800 1:31614378-31614400 GCCGAGGTGTGGGGTGGGTGAGG - Intergenic
904658302 1:32065938-32065960 GGACAGATTTGGGCCAGGTGTGG + Intergenic
904823464 1:33259399-33259421 GCAGGTGTGTGGGTAAGGTGGGG + Intronic
904853810 1:33479728-33479750 GCAGAGGAGTGGGTCAGGCAAGG + Intronic
905171227 1:36111008-36111030 GGAGAGTAGTGGGGCAGGTGGGG - Intronic
905209941 1:36367136-36367158 GTAGAAGAGTTGGCCAGGTGTGG - Intronic
905415923 1:37804179-37804201 GAAGGAGTGTGGGCCAGGTTTGG - Intronic
905473831 1:38212046-38212068 GCAGAGGTCTGAGGGAGGTGAGG - Intergenic
905593653 1:39186898-39186920 ACAGAAATGTGGCCCAGGTGTGG - Intronic
906017895 1:42598768-42598790 GTAAAGGTGAGGGCCAGGTGTGG + Intronic
906067433 1:42992100-42992122 GAGGAGGTGTGGGGCAGGGGTGG + Intergenic
906100992 1:43261508-43261530 TAAGAGCTGTAGGCCAGGTGTGG + Intronic
906146814 1:43565423-43565445 GCAGATATGTGTGCAAGGTGGGG - Intronic
906497097 1:46312393-46312415 ACCCAGGTATGGGCCAGGTGCGG - Intronic
906634211 1:47397414-47397436 GCAGAGCTGGGGGACCGGTGAGG - Intergenic
906813861 1:48857430-48857452 GCATAGGTATGGGCCGGGTGAGG + Intronic
907446126 1:54508905-54508927 AAAGAGGTGTGAGCCAGGCGTGG - Intergenic
907595977 1:55720311-55720333 GCAGATGGGTGGGCAAGGTTGGG + Intergenic
907937960 1:59059506-59059528 GCACAGGTGTGTCACAGGTGGGG - Intergenic
908866519 1:68554602-68554624 GCAGAGGTGTGCCACAGGGGAGG + Intergenic
909853199 1:80495579-80495601 GCAGATTTTTGGGCCGGGTGCGG - Intergenic
910653458 1:89594993-89595015 GCAGGAGTGTGTGGCAGGTGAGG - Exonic
911813914 1:102318766-102318788 GCAGAGGCGGGGGCAAGGTAAGG - Intergenic
912878727 1:113388949-113388971 GCAAAGATGTGGGCAGGGTGTGG - Intergenic
913480694 1:119286424-119286446 GCTGAGCTGTAGGCCAGGCGCGG - Intergenic
914922189 1:151854680-151854702 GAAGAGGTGTTGGCCGGGTGCGG - Intergenic
915028797 1:152858423-152858445 GCAGGCCTGTGGGGCAGGTGTGG - Intergenic
915119248 1:153618242-153618264 GCAGAGATGTGGGGCAGGAGAGG - Intergenic
915129530 1:153687161-153687183 GCAGAGGTATTGGCCAGGAGTGG - Intronic
915303588 1:154965511-154965533 GCAGAGGTGTGGGTGAGGGGTGG - Intronic
915914018 1:159930578-159930600 GCAGAGGTGCTGGCCAGCTTGGG - Intronic
917146204 1:171894246-171894268 GGAAAGGTGGGGGCCAGGTGTGG - Intronic
917994624 1:180422496-180422518 GAAAAGGGATGGGCCAGGTGTGG - Intronic
918106683 1:181421436-181421458 GCAGATATGTGGACCTGGTGAGG - Intronic
918109268 1:181441438-181441460 GCAGTGAATTGGGCCAGGTGCGG - Intronic
919794102 1:201310845-201310867 GCAGGGGAGCGGGCAAGGTGGGG - Intronic
919816405 1:201443519-201443541 GGAAAAGTGGGGGCCAGGTGGGG + Intergenic
920099591 1:203508578-203508600 GGAGAGGGGAGGGGCAGGTGAGG - Intronic
920173523 1:204086106-204086128 GGAGTGGCCTGGGCCAGGTGTGG + Intronic
920245572 1:204585155-204585177 GGGGAGGGGTGGGGCAGGTGTGG + Intergenic
920879695 1:209868079-209868101 ACAGAGGTGTGGGCAGGGTCAGG - Intergenic
920957152 1:210630129-210630151 ACAGAGGAGGAGGCCAGGTGCGG - Intronic
921031095 1:211335827-211335849 GGAGAGGTGGAGGACAGGTGGGG + Intronic
921133889 1:212243087-212243109 GCAGGGGTCTGGGGGAGGTGTGG - Intergenic
923158962 1:231301303-231301325 CCATAGGTTTAGGCCAGGTGTGG - Intergenic
923296992 1:232603654-232603676 TCAGAGGTGTGGGAGAGCTGGGG + Intergenic
924036557 1:239943953-239943975 GCAGAGGTGTGCGGCAGGGGTGG - Intergenic
924140125 1:241013351-241013373 GCAGGGATCAGGGCCAGGTGCGG - Intronic
924224532 1:241910016-241910038 TTAGTGCTGTGGGCCAGGTGTGG + Intergenic
924664702 1:246059164-246059186 GTGGAGTTGTGGGCCGGGTGCGG - Intronic
1063301624 10:4854380-4854402 GTAAAGGAGTAGGCCAGGTGCGG - Intergenic
1063652215 10:7948979-7949001 GCAGAGGTGCTGGGCGGGTGGGG + Intronic
1063809861 10:9692539-9692561 TTAGAAGTCTGGGCCAGGTGCGG - Intergenic
1064125611 10:12657858-12657880 GAACTGGGGTGGGCCAGGTGCGG + Intronic
1064196863 10:13250755-13250777 GCTGACATGTGGGCCAGGTATGG + Intergenic
1064403698 10:15041865-15041887 TCAAAGGTGTGGGCCAGTTGCGG - Intronic
1064532413 10:16323783-16323805 AAAGAGGTTTAGGCCAGGTGTGG + Intergenic
1064735733 10:18379975-18379997 GTAGAATAGTGGGCCAGGTGTGG - Intronic
1065455372 10:25901649-25901671 GCAGAGGTGTGGCCCAAGCAGGG - Intergenic
1065797612 10:29321768-29321790 GCAGGGGTGTGGGGGAAGTGGGG - Intergenic
1066240060 10:33524859-33524881 GCAGCTGTGTGGGGCAGGAGGGG - Intergenic
1066435368 10:35392652-35392674 GCAGAGGAGAGGGTCAGCTGGGG + Intronic
1066588181 10:36961209-36961231 ACAGAGGTGAAGGGCAGGTGAGG + Intergenic
1067058187 10:43064501-43064523 GCAGAGGTGTGGGCAGTATGGGG + Intergenic
1067452733 10:46392311-46392333 GCAGAGGTGTGGGCTTGATGCGG - Intergenic
1067584499 10:47467444-47467466 GCAGAGGTGTGGGCTTGATGCGG + Intronic
1067966903 10:50923406-50923428 GCAGAGGTGTGCTGCAGGGGTGG - Intergenic
1068104478 10:52596845-52596867 ACAGAAATGTTGGCCAGGTGCGG + Intergenic
1068116782 10:52744702-52744724 GCAGGAGTGTGGGCCTGGAGAGG + Intergenic
1068857598 10:61813290-61813312 GAAGAGGTGTGTGTCAGGAGAGG + Intergenic
1068866584 10:61901786-61901808 GCAGAGGTGTGGGTGAGCTGGGG - Intronic
1069813429 10:71178975-71178997 GAGGAGGGGTGGGCCAGGTATGG - Intergenic
1069975630 10:72210448-72210470 AAAGAGGTTTCGGCCAGGTGCGG - Intronic
1070494447 10:77008995-77009017 GCAGATGTGTGTGTGAGGTGAGG - Intronic
1070795786 10:79215587-79215609 GCAGTGATTTAGGCCAGGTGTGG - Intronic
1070833078 10:79432112-79432134 GCAGAGGTGGGGTTCAGGGGAGG + Intronic
1070903381 10:80050291-80050313 ACAAAGTTGTGGGCCAGGCGCGG + Intergenic
1071333476 10:84583507-84583529 GCACAGGCAGGGGCCAGGTGTGG + Intergenic
1071806075 10:89122611-89122633 GCAGAGGGGTGGGCCTTGTTAGG + Intergenic
1071972247 10:90920152-90920174 GCAGAGGTGAGAGCCATCTGTGG - Exonic
1071990557 10:91097239-91097261 GCAGAGGTGTGGTATAGGGGCGG - Intergenic
1072035777 10:91561653-91561675 GCAGAGGTGTGCTCCAGGGGTGG - Intergenic
1072614868 10:97042830-97042852 CCAGTGGGGTGGGGCAGGTGAGG - Intronic
1073258252 10:102169350-102169372 GCAGAGGTGTGCGGGAGGTGGGG + Intergenic
1073323488 10:102629504-102629526 GCAGAAGAGTGGGACAAGTGTGG - Intronic
1073355410 10:102849935-102849957 GTAAAGGTGTGGGCCAGGGTTGG + Intergenic
1073386935 10:103133549-103133571 AAAGAGGTTTAGGCCAGGTGTGG - Intronic
1073429155 10:103475098-103475120 GGAGAGGAGTCTGCCAGGTGTGG - Intronic
1073578595 10:104644042-104644064 GAAGAGGTGAGGGGCAGGTCTGG + Intronic
1074024136 10:109616103-109616125 TAAGAAGTGTGGGCCAGGTGTGG - Intergenic
1075246198 10:120824101-120824123 GGAGCGGGTTGGGCCAGGTGCGG - Intergenic
1075382485 10:122030697-122030719 GCAGAGGTCTGGGTCATGTCTGG + Intronic
1075405476 10:122192841-122192863 GCAGTGCTGGGGGCCTGGTGAGG + Intronic
1075671412 10:124266089-124266111 GCAGAGGTGTGTCCCGGGTCTGG - Intergenic
1075672664 10:124273137-124273159 GATGAGGGGTGGGCAAGGTGGGG - Intergenic
1075723946 10:124602355-124602377 GCAGAGGTGTGGGCCCATTGTGG + Intronic
1076113816 10:127881489-127881511 CCAGAGTAGAGGGCCAGGTGTGG - Intronic
1076119082 10:127921603-127921625 ACAGAGCTGGGGGCCAGGAGAGG + Intronic
1076130842 10:128012663-128012685 GCAGAGGTGGGGGCTAGCTCTGG + Intronic
1076595572 10:131623003-131623025 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076595577 10:131623014-131623036 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076595601 10:131623069-131623091 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076595606 10:131623080-131623102 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076595829 10:131623684-131623706 GCAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076595895 10:131623855-131623877 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076595900 10:131623866-131623888 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076595905 10:131623877-131623899 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076595986 10:131624073-131624095 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076596072 10:131624301-131624323 GAAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076596077 10:131624312-131624334 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076596098 10:131624367-131624389 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076596103 10:131624378-131624400 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076596119 10:131624423-131624445 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076596124 10:131624434-131624456 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076596129 10:131624445-131624467 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076596143 10:131624489-131624511 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076596148 10:131624500-131624522 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076596153 10:131624511-131624533 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076596169 10:131624556-131624578 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076596185 10:131624601-131624623 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076596190 10:131624612-131624634 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076596231 10:131624705-131624727 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076596271 10:131624798-131624820 GAAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076596276 10:131624809-131624831 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076596281 10:131624820-131624842 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076596306 10:131624888-131624910 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076596311 10:131624899-131624921 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076596342 10:131624978-131625000 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076596347 10:131624989-131625011 GGAGAGGTGGGGGAGAGGTGGGG + Intergenic
1076610930 10:131725540-131725562 GCAGAGGCCTGGGCTAGGAGGGG + Intergenic
1077061439 11:619457-619479 GCAGAGGTGCGGGGCAGGGCAGG - Exonic
1077074593 11:694644-694666 GCAGGTGTGAGGGACAGGTGTGG + Intronic
1077094295 11:792807-792829 GAAGAGGTGAGGGCGAGGGGAGG - Intronic
1077144555 11:1038890-1038912 GCACAGGTGTGGGGCGGGTGGGG + Intergenic
1077223055 11:1425846-1425868 GAAGAGGTGTGGGGCAGGGGAGG + Intronic
1077353006 11:2101406-2101428 GCTGTGGGGTGGGCCAGGTGGGG - Intergenic
1077360051 11:2136914-2136936 GCAGCGGTGCGGAGCAGGTGAGG + Intronic
1077441001 11:2569172-2569194 GAAAGGGTGTGGGCCAGGTGCGG - Intronic
1077487564 11:2846078-2846100 GGTGAGGTGTGGGCCAGGGCTGG - Intronic
1078164464 11:8870782-8870804 GCAGAGGAGCGGGGCTGGTGGGG - Intronic
1078445930 11:11404848-11404870 GCTGAGGTCTGGGTTAGGTGTGG - Intronic
1078539295 11:12200433-12200455 GCAGAGGAGTGGGAGAGATGAGG - Intronic
1078924429 11:15861205-15861227 AGAGAGGTTTGGGCCAGGTGTGG - Intergenic
1078989878 11:16635956-16635978 GCAGAGGTGTGGTCCTGGGGTGG + Intronic
1079063397 11:17269340-17269362 GCAGAAGTAGGGGCGAGGTGGGG + Intronic
1079314359 11:19395277-19395299 GCAGATGTGTGGGCCCAATGAGG - Intronic
1080503855 11:32893418-32893440 CCAGAGGTCTGGGCCGGGCGGGG + Intronic
1080645541 11:34185026-34185048 GCTGAGCTGTGGGCCAGGGTTGG + Intronic
1081543003 11:44049618-44049640 GCAGAGGTAGGTGCCAGATGGGG + Intronic
1081595940 11:44459545-44459567 GCTGAGGTGTAGGCCAGGGCGGG + Intergenic
1081989710 11:47331346-47331368 GCACAGGGGATGGCCAGGTGCGG - Intergenic
1082003437 11:47407270-47407292 GCAGTTGTATGGGCCCGGTGGGG + Intronic
1082032096 11:47612275-47612297 CCAGATGTGTGGGCCGGGCGCGG + Intergenic
1083198334 11:61104406-61104428 CCAGAGGTGAGGAGCAGGTGGGG - Intronic
1083300776 11:61738721-61738743 GCAGACGGGGTGGCCAGGTGGGG + Intronic
1083560764 11:63671371-63671393 GCAGAGGAGAGGGACGGGTGCGG + Exonic
1083597631 11:63926199-63926221 CCAGAGGTTCAGGCCAGGTGTGG - Intergenic
1083782250 11:64924655-64924677 GGGGAGGTGCGGGCCGGGTGGGG + Exonic
1083826608 11:65207488-65207510 GCAAGAGTTTGGGCCAGGTGCGG - Intronic
1083905241 11:65664831-65664853 ACAGAATTCTGGGCCAGGTGTGG - Intergenic
1083946574 11:65926788-65926810 ACAGAGGTAGAGGCCAGGTGGGG - Intergenic
1084120462 11:67066095-67066117 GGACAGGTGTGGGCCAGGAGTGG + Intronic
1084131590 11:67139992-67140014 ACACAGGAGTAGGCCAGGTGCGG - Intronic
1084372063 11:68751061-68751083 CCAGGGGAGGGGGCCAGGTGAGG + Intronic
1084372104 11:68751162-68751184 GCCGGGGTGGGGGTCAGGTGAGG + Intronic
1084372118 11:68751190-68751212 CCAGGGGAGGGGGCCAGGTGAGG + Intronic
1084372129 11:68751217-68751239 GCCGAGGAGGGGGTCAGGTGAGG + Intronic
1084468900 11:69343728-69343750 GCAGTGGAGTGGGCCAAGGGTGG - Intronic
1084480148 11:69415324-69415346 GCAGAGGTGGGGGGCAGGAGGGG + Intergenic
1084491117 11:69478962-69478984 AAACAAGTGTGGGCCAGGTGCGG + Intergenic
1084660919 11:70545827-70545849 GCAGAAGTGTGGGTCATCTGGGG - Intronic
1084668551 11:70591724-70591746 GCAGAGATGTGGGCCGGGCGCGG + Intronic
1084745366 11:71166771-71166793 AAAGAAGTGTGGGCCCGGTGTGG - Intronic
1085051604 11:73382912-73382934 GGAGCTGGGTGGGCCAGGTGTGG + Intronic
1085053717 11:73392463-73392485 GCAGTGGTGAGGCCCAGCTGGGG + Exonic
1085543463 11:77295276-77295298 GCAAAGTTGTGGGCTGGGTGTGG - Intronic
1085641799 11:78197356-78197378 GCAGAGGTGAGGGTCTGGAGAGG + Intronic
1085706354 11:78789665-78789687 ACTGAGGTGTGAGCCAGGAGAGG + Intronic
1086618982 11:88861771-88861793 TTAGAACTGTGGGCCAGGTGTGG - Intronic
1087074512 11:94116903-94116925 GCCAAGGTGGAGGCCAGGTGTGG - Intergenic
1087544284 11:99564376-99564398 ACAGAATTGTTGGCCAGGTGTGG - Intronic
1087774955 11:102248487-102248509 GCAGATGTGGGGGCTGGGTGCGG - Intergenic
1088048394 11:105480652-105480674 GCAGAGGTCTGTGGCAGGGGTGG + Intergenic
1088101888 11:106165253-106165275 GCAGAGGTGTGCTGCAGGGGTGG - Intergenic
1088635690 11:111818067-111818089 ATAGAAGTGAGGGCCAGGTGTGG - Intronic
1089051734 11:115551334-115551356 AGAGAGGTCTGGGCCAGGTGTGG - Intergenic
1089069421 11:115688014-115688036 GCAGAGGAGTGGGCCAGAAAAGG + Intergenic
1089101345 11:115965239-115965261 GCAGAGTTGTGGCAAAGGTGTGG - Intergenic
1089384250 11:118057619-118057641 GCAGTGTTGCTGGCCAGGTGTGG + Intergenic
1089534284 11:119150951-119150973 GCCTGGGTGTGGGCCAGGGGTGG + Intronic
1089555779 11:119315417-119315439 GGAGAGGGCTGGCCCAGGTGGGG - Intronic
1090355866 11:126139979-126140001 GGAGAGGTGGGGGTCAGGGGCGG + Intergenic
1090360853 11:126171767-126171789 GCAGAGGGAGGGGCCGGGTGCGG - Intergenic
1090670901 11:128944563-128944585 GGAGTGTTGGGGGCCAGGTGCGG - Intergenic
1090919003 11:131191979-131192001 GCAGTGGTGTGAGCCCTGTGAGG + Intergenic
1092064463 12:5578323-5578345 GCAGAAGGATGGGCCTGGTGGGG + Intronic
1092232158 12:6782211-6782233 GCTGAGGTGAGGGTCAGGTCTGG + Intergenic
1093946206 12:25112694-25112716 ACAGATGTGTAGGCTAGGTGTGG - Intronic
1094392746 12:29970357-29970379 GCTGAGTTCTGGGCCTGGTGGGG + Intergenic
1094553599 12:31475831-31475853 GAGGAGGTGTGGGCCGGGTGCGG + Intronic
1095245111 12:39910792-39910814 TCAGAAATGTAGGCCAGGTGTGG + Intronic
1095353672 12:41244978-41245000 ACAGTGGTGTGGGCCGGGCGCGG - Intronic
1097002063 12:55885147-55885169 GCAAAGGTGTCGGCCAGGCATGG - Intergenic
1097170721 12:57111123-57111145 GCAGAGGGGTTGCCGAGGTGAGG - Exonic
1098005142 12:65988571-65988593 CTAAAGGTTTGGGCCAGGTGCGG - Intergenic
1098303462 12:69078156-69078178 CATGAGGTTTGGGCCAGGTGTGG + Intergenic
1098628346 12:72699798-72699820 GCAGAGGTGTGCTGCAGGGGTGG - Intergenic
1098794120 12:74866658-74866680 TAAGAGGTCAGGGCCAGGTGCGG - Intergenic
1100326420 12:93543862-93543884 GCAGAAGTGTGGGTCACCTGGGG + Intergenic
1100451692 12:94712710-94712732 AAAGAGGAGGGGGCCAGGTGCGG - Intergenic
1100747477 12:97661697-97661719 GCAGAGGTGTGTTGCAGGGGTGG - Intergenic
1101514157 12:105419013-105419035 GCAGAGGTGGTGTCCAGATGTGG - Intergenic
1102004386 12:109579941-109579963 GCAGAGGTGTGTGCGTGGTCTGG + Exonic
1102116498 12:110407130-110407152 ACAGTGATGTGGGTCAGGTGTGG + Intergenic
1102192664 12:111000627-111000649 GTAAAGTTGTAGGCCAGGTGTGG - Intergenic
1102299868 12:111763468-111763490 AAAGAGGTTTAGGCCAGGTGCGG + Intronic
1102377419 12:112434004-112434026 TCCTAGATGTGGGCCAGGTGTGG + Intronic
1102450358 12:113037403-113037425 GAAGAGTTATGGGCCAGGTGCGG - Intergenic
1102465937 12:113130879-113130901 GACGAGGTGGTGGCCAGGTGAGG - Exonic
1102466231 12:113132368-113132390 CCAGATGTGGGGGCCAGGGGTGG - Intronic
1102639120 12:114350930-114350952 ACACATTTGTGGGCCAGGTGTGG - Intergenic
1102668959 12:114601031-114601053 GCAGAGGTGTGCTGCAGGGGTGG + Intergenic
1102903032 12:116653471-116653493 GCCAAGGTTTGGGCCAGGTACGG + Intergenic
1102979789 12:117232210-117232232 GCAGAGGATGGGGCCAGGAGAGG + Intronic
1103291134 12:119847272-119847294 GAAGAAGTTCGGGCCAGGTGTGG - Intronic
1103480821 12:121248750-121248772 GGAGGGGTGAGGGGCAGGTGTGG + Intronic
1103486366 12:121285516-121285538 GTAGATGTGTGGGCCAGGCATGG + Intronic
1103789095 12:123456795-123456817 GCATAGGGGTCAGCCAGGTGTGG + Intergenic
1104450526 12:128864850-128864872 CCAGAGGGGTGGGCATGGTGGGG + Intronic
1104748557 12:131224439-131224461 CGAGAGGTGTGGTCAAGGTGTGG + Intergenic
1105027930 12:132861980-132862002 ACAGAGCTTTGGGCCGGGTGCGG + Intronic
1105374135 13:19828181-19828203 GCAGAGGTGTGGGCCAGGTGCGG + Intronic
1106506476 13:30375054-30375076 GAGTAGGTGTGGGCCAGGAGTGG - Intergenic
1106550554 13:30767311-30767333 GCAGAAGTGTGGGTCACGGGGGG + Intergenic
1106680921 13:32006571-32006593 TCACAGGTATGGGCCAGGTGTGG + Intergenic
1106718794 13:32418433-32418455 GCAGAGGTGTGCTGCAGGGGTGG + Intronic
1107014345 13:35696477-35696499 ACATGGGAGTGGGCCAGGTGTGG - Intergenic
1107307483 13:39038095-39038117 CCAGAGGTGGGGTCCTGGTGTGG + Intergenic
1107899943 13:45001969-45001991 AAAATGGTGTGGGCCAGGTGTGG - Intronic
1108152890 13:47554666-47554688 GCAGAGGTCTGGCCCAAGTCTGG + Intergenic
1109305681 13:60638217-60638239 GTAGAGTTTTCGGCCAGGTGCGG + Intergenic
1112351533 13:98639051-98639073 ACAGTGGAATGGGCCAGGTGTGG + Intergenic
1112752599 13:102597341-102597363 GCAGAGGTCAGAGCCAGGCGCGG + Intronic
1112861554 13:103833859-103833881 GCAGAGGTGTGTTGCAGGGGTGG + Intergenic
1113096602 13:106671753-106671775 CCTGAGGTGTGGGGCAGGCGAGG + Intergenic
1113836915 13:113334123-113334145 GCACAGGCATGGGCCAGGCGCGG - Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114005602 14:18310013-18310035 AAAGAGTTTTGGGCCAGGTGTGG + Intergenic
1114492311 14:23110956-23110978 GGAGAGCTGTCGTCCAGGTGGGG + Intergenic
1114517938 14:23312168-23312190 AAATAGGTCTGGGCCAGGTGCGG + Intronic
1114659408 14:24335000-24335022 GCAGCGGAGTGGGCTAGGTCCGG + Exonic
1114936782 14:27548787-27548809 GCAGAGGTGTGCTGCAGGTGTGG + Intergenic
1115010608 14:28540433-28540455 GCAGAGGTGTGCTGCAGGGGTGG + Intergenic
1115750255 14:36482443-36482465 GCAGTGGTGGTGGCCAGCTGAGG - Intronic
1116160019 14:41256424-41256446 GAAGAAGTGTGAGCCAAGTGTGG + Intergenic
1116364091 14:44039024-44039046 GCAGAAGTCTGGTCCAGGGGTGG + Intergenic
1116810836 14:49538571-49538593 GCAGAATGCTGGGCCAGGTGTGG + Intergenic
1116869531 14:50058056-50058078 GCACAGCTGTGGGTCAGGGGAGG + Intergenic
1117418736 14:55522953-55522975 ACAGATGAATGGGCCAGGTGCGG + Intergenic
1118750288 14:68802579-68802601 GAAAAGGTGTTGGCCCGGTGTGG + Intergenic
1119403750 14:74382437-74382459 GTTTAGCTGTGGGCCAGGTGTGG - Intergenic
1119721008 14:76890481-76890503 GCAGATGAGTGGGCCATGTTTGG - Intergenic
1119759149 14:77139448-77139470 GCAGAAGTGGGTGCTAGGTGAGG + Exonic
1120188324 14:81417277-81417299 GCAGAGCTGGGGGCCGGGGGCGG - Intronic
1120360810 14:83499526-83499548 ACATAAGTGTGGGCCAGGTGTGG - Intergenic
1121016443 14:90552166-90552188 GCAGAGGTGTGCAGGAGGTGTGG - Intronic
1121403679 14:93704805-93704827 GGAGACCTGTGGGCCAGGTAAGG + Intronic
1121499064 14:94419215-94419237 GCAGAGGTGTGCTGCAGGGGTGG + Intergenic
1121904362 14:97726271-97726293 GCAGGGTTGCAGGCCAGGTGGGG - Intergenic
1122123986 14:99569404-99569426 GCGGAGCTGGGGCCCAGGTGTGG - Intronic
1122227775 14:100289924-100289946 GCAGATGTGTTGGTCATGTGAGG + Intergenic
1122561652 14:102619408-102619430 ATAGAGGCATGGGCCAGGTGGGG - Intronic
1122791391 14:104185537-104185559 GTAGAGGTGTGGGGTGGGTGTGG + Intergenic
1123120684 14:105915013-105915035 GGTGAGGTCTAGGCCAGGTGAGG + Intergenic
1123914288 15:25006344-25006366 ATAGAGGTGTGGGCCAGGTGTGG - Intergenic
1124033792 15:26034793-26034815 GCAGGGGCGTAGGCCAGGCGTGG - Intergenic
1124072849 15:26411856-26411878 GCAGAGGTGCTGTCCAGATGAGG + Intergenic
1124942864 15:34234660-34234682 GAAGAGGTTTAGGCCAGGTGTGG - Intronic
1125884703 15:43220144-43220166 GCAGAGGTGTGGGGACAGTGGGG - Intronic
1125968619 15:43894207-43894229 GCAGAGGTATGGGTCAGGGAAGG + Intronic
1126514437 15:49519438-49519460 GCAGAGGTGTGCTGCAGGGGTGG - Intronic
1126688380 15:51267572-51267594 GCAGCGGTGTTCGCCGGGTGGGG + Intronic
1126765271 15:52005232-52005254 AGAGAGATCTGGGCCAGGTGCGG + Intronic
1127969501 15:63947254-63947276 CCAGAGGTGTGTGCAAGCTGGGG - Intronic
1128048540 15:64641502-64641524 GCACAAGTGTAGGCCAGGCGCGG - Intronic
1128147242 15:65338564-65338586 GCACAGGTGTGGTCCAGGAAGGG + Intronic
1128149630 15:65355137-65355159 GCAGCGGAGTGGGGCGGGTGGGG + Intronic
1128368661 15:67023380-67023402 GGAGAGGAGTTGGCCAGGCGTGG - Intergenic
1128475752 15:67995666-67995688 GCTGAGGTTTGGGCCAGCTCAGG + Intergenic
1128609598 15:69063233-69063255 GAGGAGGTGGGGGCCGGGTGTGG + Intergenic
1128914060 15:71543735-71543757 TCACAGATGTGGGCCGGGTGTGG + Intronic
1129119685 15:73388471-73388493 GCATGGGGGTGGGCCAGGGGAGG - Intergenic
1129254682 15:74327342-74327364 ACAGAGCTCTGGGCCAGGTGCGG + Intronic
1129716539 15:77855053-77855075 GCAGAGCTGGGGTGCAGGTGAGG - Intergenic
1129787850 15:78321147-78321169 GAAGAGGTGTGGGTCCCGTGAGG + Intergenic
1129811749 15:78516727-78516749 AAAGAGGTTTAGGCCAGGTGTGG + Intronic
1131157382 15:90083578-90083600 GGAGAAGTGTGAGGCAGGTGTGG + Exonic
1132047031 15:98572729-98572751 GCAGTGGTGGGAGCCTGGTGGGG - Intergenic
1132075612 15:98817453-98817475 GCTGGGTTGGGGGCCAGGTGTGG + Intronic
1132233685 15:100203280-100203302 GAAGGGGTGTGGGCCAGGTGCGG + Intronic
1132353078 15:101152482-101152504 GTAGTAGTGTAGGCCAGGTGCGG - Intergenic
1132528578 16:431663-431685 AAAAAGGTCTGGGCCAGGTGCGG - Intronic
1132531289 16:451313-451335 GCAGGGGGGTGGGGAAGGTGAGG - Intronic
1133335526 16:5004469-5004491 GCAGAGGTGTGGGCAGGGGAAGG + Intronic
1133360742 16:5171742-5171764 GCTTAGGTCTGGGCCAGCTGGGG - Intergenic
1133934263 16:10256070-10256092 GGAGAGGTGAGGGCTAGATGTGG - Intergenic
1134358411 16:13506348-13506370 ACAGAGGTGTGTGGGAGGTGAGG + Intergenic
1134800083 16:17076183-17076205 GCAGAGGGGTGGGGCAGATCTGG + Intergenic
1134874744 16:17687968-17687990 ACAGATTTGTGGGCCAGCTGGGG + Intergenic
1135046946 16:19163677-19163699 GGAGAGGTGGGTGCCAGGTGTGG - Intronic
1135463987 16:22669744-22669766 TCAGTGCTGTGGGCAAGGTGCGG + Intergenic
1135512638 16:23100480-23100502 GCAGAATAGTGGGCCGGGTGTGG + Intronic
1135591073 16:23705620-23705642 TCAAGGGGGTGGGCCAGGTGTGG + Intronic
1135901636 16:26465159-26465181 GCAGGGGTGTGGGGGAGGTGGGG - Intergenic
1135935519 16:26776703-26776725 GGGGGGGTGTGGGCCAGGTGCGG + Intergenic
1137492970 16:48948506-48948528 CTAGAGGAGTTGGCCAGGTGCGG + Intergenic
1137607628 16:49797039-49797061 GCAGAGGTGGTGGCCAGGCAAGG + Intronic
1137629250 16:49930633-49930655 GCAGGTGTGTGGGCTGGGTGGGG + Intergenic
1138511117 16:57508877-57508899 TCAGGAGCGTGGGCCAGGTGCGG + Intergenic
1138530811 16:57633465-57633487 GCAAAGGTCTGGGACAGCTGGGG - Intronic
1139372874 16:66479487-66479509 GGAGAGGGGTGGGGAAGGTGGGG + Intronic
1139603368 16:68000420-68000442 GCAGAGGTGGGGTGCAGCTGGGG + Intronic
1139644736 16:68320112-68320134 GCAGAGATGTAGGCCAGGTTAGG + Intronic
1139782332 16:69362134-69362156 GCACAGGTGTGGGCATCGTGGGG - Intronic
1139830254 16:69791808-69791830 GCCGAGGTGGGGGCCAGGCACGG - Intronic
1140225353 16:73072158-73072180 TCAGAAATGTAGGCCAGGTGGGG + Intergenic
1140340640 16:74156452-74156474 GAAAAGATCTGGGCCAGGTGCGG + Intergenic
1140346468 16:74218209-74218231 TCTGAGATGTTGGCCAGGTGCGG - Intergenic
1140536671 16:75715986-75716008 ACAGAAATGTGGGCCAGATGTGG - Intronic
1141266250 16:82500162-82500184 CTAGAGGTGTGGCCCAGGTAAGG + Intergenic
1141880012 16:86851609-86851631 GCAGGTGTGTGTGCCATGTGTGG + Intergenic
1141902117 16:86997741-86997763 GCACAGGTATGGGCCAGATGCGG + Intergenic
1141910725 16:87056843-87056865 TGAGAGGTGTGGGCCGGGTAGGG + Intergenic
1142185299 16:88692064-88692086 GCAGGGGTGGGGGCCGGGGGCGG - Intergenic
1142364783 16:89644530-89644552 GCAGAGCCATGGGCCAGGTGGGG - Exonic
1142431744 16:90032293-90032315 GAGGAGGTGTGGTACAGGTGTGG + Intronic
1142431764 16:90032398-90032420 GAGGAGGTGTGGTACAGGTGTGG + Intronic
1142431786 16:90032503-90032525 GAGGAGGTGTGGTGCAGGTGTGG + Intronic
1142519341 17:494002-494024 GCTGAGGAGGGGGCCGGGTGTGG + Intergenic
1143130259 17:4673043-4673065 GAGCAGGTGTGGGGCAGGTGGGG + Exonic
1143202099 17:5120281-5120303 GCAGTGGTGGGGGCAAGGTCAGG + Intronic
1143237169 17:5412804-5412826 GTAGGGGAGTGGGACAGGTGAGG - Intronic
1143244126 17:5468681-5468703 GCCGAGGGCTGGGCCAGGGGCGG + Exonic
1143449272 17:7026208-7026230 GCAGTGGTGGGGGCCAGGTACGG - Intronic
1143909512 17:10236175-10236197 GCATTGCTTTGGGCCAGGTGTGG + Intergenic
1144125074 17:12195787-12195809 GGATAGGTGAGGGCCAGGAGAGG + Intergenic
1144205481 17:12976845-12976867 TGAGAGTGGTGGGCCAGGTGAGG + Intronic
1144792862 17:17871078-17871100 TCAGAGGCCGGGGCCAGGTGTGG + Intronic
1144873272 17:18383194-18383216 GCAGAGGTTGGGGCCAGGCGGGG + Intronic
1144999728 17:19295771-19295793 TGAGAGGTGTGGGAGAGGTGTGG - Intronic
1145229706 17:21164534-21164556 GCAGTGGCCTCGGCCAGGTGCGG + Intronic
1145311844 17:21705173-21705195 GCGGAGGTATGGGCGAGGTGGGG - Intergenic
1145930010 17:28678656-28678678 CAAGAGGTGTGGGCCAGGGAAGG + Intronic
1146376268 17:32296622-32296644 GAAGAGATCTAGGCCAGGTGCGG - Intronic
1146890369 17:36502689-36502711 GCAGAGAACTGGGGCAGGTGAGG - Intronic
1147047262 17:37762503-37762525 GAAGAGTTATTGGCCAGGTGAGG + Intergenic
1147343062 17:39766714-39766736 GCAGAGATGTGGTTCAGTTGAGG + Intronic
1147509644 17:41056516-41056538 ACTGAGGTATGGGCCAGATGAGG - Intergenic
1147581461 17:41629553-41629575 GCAGTGGTGGGGGCAAGGTCAGG - Intergenic
1147672374 17:42184117-42184139 GCAGAGGCCTGGGCCAGGACAGG + Exonic
1148029162 17:44608174-44608196 GCAGGGGTGTGGGCACAGTGAGG - Intergenic
1148123929 17:45227328-45227350 GCACTGGTGTGGGGGAGGTGGGG + Intronic
1148343506 17:46888228-46888250 AGGGAGGTGTGGGTCAGGTGGGG + Intergenic
1148459538 17:47831231-47831253 GCAAAGGTCTGGGCGAGGAGTGG + Intronic
1148466269 17:47866921-47866943 GCAGAGGGCAGGGCCAGGAGAGG + Intergenic
1148618959 17:49020330-49020352 GGAGAAGTTAGGGCCAGGTGTGG - Intronic
1148845744 17:50528850-50528872 GGCGTGGTCTGGGCCAGGTGGGG + Intronic
1149598929 17:57880883-57880905 GCGAAGGTGTAGGCCAGGTTGGG - Intronic
1150133566 17:62681932-62681954 GCCGAGGTGAGGGCAAGGTGGGG + Exonic
1151171855 17:72253258-72253280 TAAGAGATGTGGGCTAGGTGTGG - Intergenic
1151222415 17:72622913-72622935 GCAGAGGAGGGGGTGAGGTGTGG + Intergenic
1151392890 17:73799652-73799674 GCAAGGCTGGGGGCCAGGTGCGG + Intergenic
1151747969 17:76021836-76021858 GCAGAGGTCGGGGCCAGGTGGGG - Intronic
1151787455 17:76282021-76282043 GCCAAGGTGTGGGCCTTGTGCGG + Exonic
1151832453 17:76562288-76562310 GGGGAGGTGTGGGCCGGGCGCGG + Intergenic
1152158074 17:78647987-78648009 GCAGAGGGATGGGCCAGAGGAGG + Intergenic
1152298730 17:79483375-79483397 GCAAAGGTGTGGTGCAGGGGTGG - Intronic
1152344147 17:79741553-79741575 GCACAGGTGCGGGGCAGGTGTGG - Intronic
1152449576 17:80368721-80368743 CCAGTGGCGTCGGCCAGGTGTGG - Intronic
1152570415 17:81119127-81119149 GGCCAGGTGAGGGCCAGGTGAGG + Intronic
1152758104 17:82095514-82095536 CCAGAGGTGGGGGCCCTGTGGGG + Intronic
1152872384 17:82763447-82763469 ACAGGGTTTTGGGCCAGGTGCGG + Intronic
1152910340 17:83001592-83001614 GCAGAGGGGCGGGCGGGGTGGGG + Intronic
1153205747 18:2698656-2698678 AAAAAGGTGGGGGCCAGGTGTGG - Intronic
1153291462 18:3505944-3505966 GCAAATTTTTGGGCCAGGTGCGG + Intronic
1153706943 18:7755464-7755486 GCAGAGGAGAGGGGCATGTGTGG + Intronic
1154038569 18:10832005-10832027 ACAGAGTTGGAGGCCAGGTGCGG + Intronic
1154531825 18:15353861-15353883 AAAGAGTTTTGGGCCAGGTGCGG - Intergenic
1155210699 18:23598260-23598282 TCAGAGGTAGTGGCCAGGTGAGG - Intergenic
1155509925 18:26566380-26566402 GTGCAGGTGTGGGCCTGGTGGGG - Intronic
1156559472 18:38106221-38106243 ACAGAAGTGTGGGCAAGGTCAGG - Intergenic
1157410045 18:47455868-47455890 GCAGAGTGGTGGGGCAGGGGAGG - Intergenic
1157716805 18:49893670-49893692 CCAGAGGTGGGATCCAGGTGTGG - Intronic
1157764510 18:50286522-50286544 GCAGAGGTGAGGGCCATGGATGG - Exonic
1157765590 18:50294551-50294573 TAAGAAATGTGGGCCAGGTGCGG - Intergenic
1158626621 18:59077297-59077319 CCAATGGTGGGGGCCAGGTGGGG + Intergenic
1158674358 18:59504962-59504984 GCAGGGGTATGGCCCAGGTTTGG - Intronic
1159157318 18:64601350-64601372 GCAGAGGTGTGCTGCAGGGGTGG - Intergenic
1159606274 18:70478357-70478379 GCAGAGGTGTGCTGCAGGGGCGG + Intergenic
1159915371 18:74183090-74183112 GAAGAGGTGAGGGACAGGTTGGG - Intergenic
1160343637 18:78111341-78111363 AAGGAGGTGTGGGCCAGGTAAGG - Intergenic
1160405770 18:78645384-78645406 GCTGAGGTCTGGGCCTGGTGTGG - Intergenic
1160405785 18:78645437-78645459 GCTGAGGTCTGGGCCTGGTGTGG - Intergenic
1160513628 18:79466500-79466522 GCAGAGGTCGGGGCTGGGTGGGG - Intronic
1160597619 18:79988179-79988201 GCAGAGGCGCGGGGCAGATGCGG + Intronic
1160803167 19:979811-979833 GGAGAGGTGGGGGCCTGGGGAGG - Intergenic
1160806825 19:995657-995679 GCAGATGTCAGTGCCAGGTGAGG - Intronic
1160844352 19:1159916-1159938 GCAGAGGAGGGGGCCAGGGAAGG + Intronic
1160948738 19:1655648-1655670 GCAGAGGTGGTGGCCAAGTGGGG - Intergenic
1160995576 19:1880684-1880706 GCAGGGTGGTGGGCCAGGAGGGG - Intronic
1161028389 19:2047072-2047094 TCACAGGTGTGGGCCACATGTGG + Intronic
1161119520 19:2517800-2517822 GCAGAGGTACTGGCCAGGCGAGG - Intronic
1161399597 19:4061446-4061468 GCCGAGGACTGGGCCAGGCGGGG - Intronic
1161585456 19:5103064-5103086 GCAGATGTGTGGGGCAGTTGGGG + Intronic
1161877399 19:6922323-6922345 TCAGAGGTGTTGGCCGGGTGTGG + Intronic
1162184023 19:8890773-8890795 GTGGAGTTGTAGGCCAGGTGCGG + Intronic
1162491937 19:10997755-10997777 ACACAGGTGAAGGCCAGGTGCGG - Intronic
1162593205 19:11606689-11606711 GCAGAGGTGTGCTACAGGGGCGG - Intronic
1162988962 19:14289970-14289992 GCAGAGGCGTGGGCGAGGAGGGG + Intergenic
1163236676 19:16034087-16034109 GCAGAGGTGGGGGAGGGGTGAGG + Intergenic
1163358370 19:16829629-16829651 GCAGAGGGGAGGCCGAGGTGGGG - Intronic
1163407437 19:17131709-17131731 GCCTAGGTGTGGGCCCAGTGGGG - Intronic
1163546667 19:17944755-17944777 GCAGTGGTCAGGGCCGGGTGCGG + Intergenic
1164524138 19:29001090-29001112 GGAGAGGGGTGGGGGAGGTGGGG + Intergenic
1164779954 19:30884257-30884279 AAAGAAGTGGGGGCCAGGTGTGG - Intergenic
1165111010 19:33502210-33502232 GATGAGGTGGGGCCCAGGTGTGG - Intronic
1165241759 19:34474409-34474431 CCAAAAATGTGGGCCAGGTGAGG + Intergenic
1165317380 19:35065187-35065209 ACAGAGGTTTGTACCAGGTGGGG + Intronic
1165318889 19:35074136-35074158 GCAGAGGTGGGGCCAGGGTGGGG - Intergenic
1165391646 19:35542481-35542503 GCAGAGATGTGGTCCTGGGGAGG - Exonic
1166111229 19:40624135-40624157 GCAAAGGTGTGGCCCGGGTGCGG - Intronic
1166171200 19:41028550-41028572 GCAGAGGGATTGGCCAGGTCTGG + Intergenic
1166443351 19:42835813-42835835 AAAAATGTGTGGGCCAGGTGCGG + Intronic
1166480325 19:43166554-43166576 AAAAATGTGTGGGCCAGGTGCGG + Exonic
1166671354 19:44711232-44711254 GCAGAGGTAGAGGCCAGGAGTGG + Intergenic
1166784184 19:45357891-45357913 GCACAGGTGTGGGCCCGAAGCGG - Intronic
1166816063 19:45546957-45546979 GCAGAGTTTTAGGCCAGGCGCGG - Intronic
1166851380 19:45763117-45763139 CCAGATGTGGGGGCCAGGAGCGG + Intronic
1166886156 19:45962142-45962164 GGAGAGGTGGGGGCCCAGTGAGG + Intronic
1167172433 19:47842289-47842311 GCCCAGGAGTGGGCCGGGTGCGG + Exonic
1167425184 19:49426530-49426552 TCAGAGGGGTGGGCCATGTCCGG - Exonic
1167457645 19:49605792-49605814 GCAGGGGAGGGGGCCAGGCGAGG + Intronic
1167660745 19:50794650-50794672 GCAGAGGGCATGGCCAGGTGGGG + Intronic
1167918901 19:52765024-52765046 TAAGAGGATTGGGCCAGGTGTGG - Exonic
1168193280 19:54755636-54755658 GTAGAGATATGGGCCTGGTGTGG + Intronic
1168250466 19:55138566-55138588 CCAGAGAAGGGGGCCAGGTGCGG - Intronic
1168596922 19:57684786-57684808 GCAGCTGTGTGAGACAGGTGTGG + Intronic
925050015 2:806110-806132 GCACATTTGTGGGCCAGGAGTGG - Intergenic
926760409 2:16273662-16273684 GCAGAGGTGTGGGATGGGAGAGG + Intergenic
927417560 2:22894435-22894457 GCAGAGGTGTGTGCTTGGTGGGG - Intergenic
927781897 2:25946262-25946284 GGAAAGGTGGGGGCCAGGTGAGG + Intronic
928364814 2:30692354-30692376 GCCTCGGTGTGGGGCAGGTGTGG + Intergenic
929610675 2:43268700-43268722 GCAGGGGTGGGGCCCAGGAGAGG - Intronic
929926736 2:46218782-46218804 GCATAGCTCTGGGCCGGGTGTGG + Intergenic
930419682 2:51135097-51135119 GCAGAGGTGTGTTGCAGGGGTGG + Intergenic
931382195 2:61764350-61764372 GCAGAAGTGTGGGCGAGCTGGGG + Intergenic
931434415 2:62234799-62234821 CCAGGGATGTGGACCAGGTGGGG - Intergenic
931814448 2:65886928-65886950 TTAAATGTGTGGGCCAGGTGAGG - Intergenic
933784371 2:85827365-85827387 GCAGAGATGTGGGAGAGGGGAGG + Intergenic
933867107 2:86530281-86530303 GAAGAGTTCTGGGCCAGGTGCGG - Intronic
933898577 2:86833467-86833489 GGAGAGGAGAGGGCCGGGTGCGG - Intronic
933995953 2:87669986-87670008 GCAGAGGTGAGGGCAGAGTGAGG - Intergenic
935085581 2:99841441-99841463 GCAGAGGTGAGGCCAGGGTGAGG + Intronic
935190094 2:100770641-100770663 AAAATGGTGTGGGCCAGGTGCGG + Intergenic
935202495 2:100870187-100870209 TCAGGAGTCTGGGCCAGGTGCGG - Intronic
935649009 2:105366279-105366301 GAAAAGGTGTGGGCAAGGTGGGG + Intronic
935714864 2:105930920-105930942 GAAAAAGTGTGGGTCAGGTGTGG + Intergenic
935761590 2:106325588-106325610 GAAAATGTCTGGGCCAGGTGCGG - Intergenic
936267416 2:111021174-111021196 GTAGAGGAGTGGGCCAGTGGAGG + Intronic
936297904 2:111280926-111280948 GCAGAGGTGAGGGCAGAGTGAGG + Intergenic
936827930 2:116604259-116604281 GCAGAAGTTTGTGCCAGGGGTGG + Intergenic
938317558 2:130340548-130340570 GGACAGGAGTGGGCCAGGGGAGG - Intronic
939646215 2:144702233-144702255 GCAGGGGTGTGGGCTTGGTAAGG - Intergenic
939824277 2:146996040-146996062 AAAGAGTTGTTGGCCAGGTGCGG + Intergenic
940076933 2:149751957-149751979 ACAGACATGTAGGCCAGGTGTGG - Intergenic
940122470 2:150282089-150282111 GCAGATGTGTGGGCGTGGAGTGG - Intergenic
940327667 2:152442537-152442559 GGACAGAAGTGGGCCAGGTGTGG - Intronic
940667890 2:156631204-156631226 GAAGAGGTGTGGGGGAGTTGTGG + Intergenic
940719231 2:157263115-157263137 AAAGAGGTGTGGGCCGGATGCGG - Intronic
941682619 2:168415076-168415098 GCAGAGGTGTGCTGCAGGAGTGG - Intergenic
942226772 2:173823429-173823451 GGAGACGTTTGGGCCAGGTGTGG - Intergenic
943648601 2:190432705-190432727 ACAGAGATTTTGGCCAGGTGCGG - Intronic
944657326 2:201889104-201889126 GCAGAAGTTTAGGCCAGGCGAGG + Intronic
945194873 2:207228500-207228522 GCAGAGGGGAGGGCGAGCTGAGG - Intergenic
945868645 2:215203454-215203476 GAAGTGGGGTGGGCCAGGGGTGG + Intergenic
946190213 2:218003880-218003902 GCAGAGGTGGGGGCGAGGGGAGG - Intergenic
946315886 2:218911935-218911957 TCAGAGTTGTAGGCCAGGTGTGG + Intergenic
946366961 2:219254302-219254324 GCAGGGGTGAAGGCCAGCTGTGG - Intronic
946389447 2:219406680-219406702 GCAGAGGTGTGGGCAAGGGGAGG - Intergenic
946539234 2:220665746-220665768 CCAGTGGTGTGGGTGAGGTGGGG - Intergenic
947070245 2:226280733-226280755 GCAGAGGTGTGTTGCAGGGGTGG + Intergenic
947454754 2:230243795-230243817 GCCAAGGTGTGAGCCAGGTAAGG + Exonic
948290282 2:236819348-236819370 CCTGAGGAGTGGGCCACGTGTGG + Intergenic
948317758 2:237042220-237042242 GCAGAGATGAGGGCCAGGTCTGG - Intergenic
948569685 2:238909914-238909936 GCAGAGGTGGGGGCCTCCTGAGG - Exonic
948702612 2:239769735-239769757 GCAGAGGTCTTGCCCAGGTAGGG + Intronic
948725639 2:239932122-239932144 GCAGAGGTGCAGGCCGGGCGCGG - Intronic
948800047 2:240429394-240429416 GCAGGGTTGTCAGCCAGGTGAGG - Intergenic
948976474 2:241466619-241466641 GGGGTGGTGAGGGCCAGGTGGGG - Intronic
1168783667 20:518119-518141 AAAGATGAGTGGGCCAGGTGTGG - Intronic
1169265957 20:4167579-4167601 TCAGAGGTGTTGGCCAAGTGGGG + Intronic
1169317016 20:4601159-4601181 TCTGGGGTATGGGCCAGGTGCGG - Intergenic
1170736417 20:19017315-19017337 GCAGGGCTGTGGGACAGGAGGGG - Intergenic
1170737764 20:19026201-19026223 GCTGAGGTGTGTGGGAGGTGGGG + Intergenic
1171220308 20:23391022-23391044 GAACTGGTGTCGGCCAGGTGCGG + Intronic
1171908283 20:30919625-30919647 GGAGGGGTGTGGGCGGGGTGGGG - Intergenic
1171963922 20:31515282-31515304 GCAGGGGCAAGGGCCAGGTGTGG - Intronic
1172033375 20:31996352-31996374 GCAGGGGTGTGGGGAAGGTCTGG - Intronic
1172293056 20:33789858-33789880 ATAGAGGTGTGGACGAGGTGTGG + Intronic
1172746219 20:37211345-37211367 TTAGAGATGGGGGCCAGGTGTGG + Intronic
1172847589 20:37938988-37939010 CCAGAGGGGTGGGTAAGGTGTGG + Intronic
1172871971 20:38141703-38141725 GCTGGGGCGTGGTCCAGGTGGGG - Intronic
1173342631 20:42166626-42166648 GAAGAAGTCGGGGCCAGGTGCGG + Intronic
1173555247 20:43961261-43961283 GCAGAGGTCTGGATGAGGTGTGG + Intronic
1173813521 20:45970880-45970902 GCAGATGTCTAGGCCAGGAGTGG - Intronic
1173864003 20:46302776-46302798 GAAGAGGTGAGGACCAGCTGTGG - Intronic
1173954249 20:47018503-47018525 GCAGTGGTATGGACCAGGAGTGG + Intronic
1174067807 20:47878403-47878425 GCTGAGGTGTGGGCCAGGGAAGG - Intergenic
1174115581 20:48224462-48224484 GCCGTGGTGTGGACCGGGTGGGG - Intergenic
1174452017 20:50626270-50626292 GCAGAGGCCAAGGCCAGGTGGGG + Intronic
1174798378 20:53541473-53541495 TCAGAAATATGGGCCAGGTGCGG - Intergenic
1175313302 20:58026622-58026644 GCAGAAATGTGGGCCCAGTGAGG + Intergenic
1175728178 20:61333646-61333668 GCAGCTCTGTGGGCCACGTGTGG - Intronic
1175874346 20:62222312-62222334 GAACAGCTGTGGGGCAGGTGTGG - Intergenic
1176045589 20:63091057-63091079 GCAAAGCTGTGAGCCAGGTGAGG + Intergenic
1176284398 21:5011841-5011863 TCACAGGTGTGGCCCAGGGGAGG - Intergenic
1176410478 21:6447119-6447141 ACAGAGGGGTGAGCAAGGTGCGG + Intergenic
1176411336 21:6451017-6451039 GCAGGGGCGGGGGCCCGGTGGGG - Intergenic
1176765536 21:13014312-13014334 AAAGAGTTTTGGGCCAGGTGCGG + Intergenic
1176934077 21:14846182-14846204 GCAGAGGTGTGCCACAGGGGTGG - Intergenic
1177577418 21:22976204-22976226 GCAGAGGTGTGTTCCAGGGGTGG - Intergenic
1178096110 21:29217455-29217477 GAGGACGTGTGGGCCGGGTGCGG + Intronic
1178330448 21:31685910-31685932 TCAAAGCTGTGGGCCGGGTGTGG + Intronic
1179179321 21:39031827-39031849 GCAGAGCAGTGGGCCAGGGGAGG - Intergenic
1179644228 21:42765893-42765915 GCTATGGTGTGGGCCTGGTGGGG - Intronic
1179685971 21:43055441-43055463 ACAGAGGGGTGAGCAAGGTGCGG + Intronic
1179686829 21:43059339-43059361 GCAGGGGCGGGGGCCCGGTGGGG - Intronic
1179806303 21:43839780-43839802 GAAAACGTGTGGGCCAGGCGCGG - Intergenic
1179872783 21:44251634-44251656 TCACAGGTGTGGCCCAGGGGAGG + Exonic
1180089406 21:45526092-45526114 GGAGAGATGGGGGCCTGGTGGGG - Intronic
1180204984 21:46254319-46254341 GCAGGGTTGTGGGCCAGGGCCGG - Intronic
1180341719 22:11625787-11625809 GGAGGGGTGTGGGCGGGGTGGGG - Intergenic
1180430111 22:15240799-15240821 AAAGAGTTTTGGGCCAGGTGTGG + Intergenic
1180512728 22:16109116-16109138 AAAGAGTTTTGGGCCAGGTGTGG + Intergenic
1180666202 22:17514741-17514763 ACAGACTTGTGGGCCAGGCGCGG + Intronic
1180682616 22:17638870-17638892 GCAGGGGCCAGGGCCAGGTGAGG + Exonic
1180720059 22:17901380-17901402 GCAGCAGCCTGGGCCAGGTGAGG + Intronic
1180800911 22:18631463-18631485 GCAGAGGTGTCGGTGAGGGGTGG - Intergenic
1180852144 22:19027020-19027042 GCAGAGGTGTCGGTGAGGGGTGG - Intergenic
1180943954 22:19679536-19679558 GCAGATAAGTGGCCCAGGTGTGG - Intergenic
1180996908 22:19970364-19970386 CCAGTGGTGCGGGCCAGGTCTGG - Exonic
1181220806 22:21363799-21363821 GCAGAGGTGTTGGTGAGGGGTGG + Intergenic
1181287991 22:21768248-21768270 AAAGAATTGTGGGCCAGGTGCGG - Intronic
1181936462 22:26442331-26442353 CCAGAGGTGTGAGGCAGGTCAGG + Intronic
1181948168 22:26534675-26534697 GCAGAGGCGAGGGCCGGCTGGGG - Intronic
1182106417 22:27693111-27693133 TCAGAGGTGTGTGCCCTGTGAGG - Intergenic
1182280281 22:29214415-29214437 GCAAAGGCCTGGGGCAGGTGTGG + Intronic
1182416705 22:30225929-30225951 GCAGGGGAGAAGGCCAGGTGAGG - Intergenic
1182449301 22:30409277-30409299 GGAGAGGTGAGGGGCAGGGGTGG + Exonic
1182652618 22:31864397-31864419 GCAGCCATCTGGGCCAGGTGTGG - Intronic
1182926912 22:34133807-34133829 AAAGATTTGTGGGCCAGGTGTGG + Intergenic
1183231178 22:36583107-36583129 GCAGAGGTGTGAGCTGGATGGGG - Intronic
1183243355 22:36674617-36674639 CAACAGGTGTGGGCCAAGTGCGG - Intronic
1183606169 22:38867770-38867792 GCTGAGGTGCTGGCCAGCTGAGG - Intronic
1183665216 22:39242791-39242813 GGCGAGGTGCGGGCGAGGTGCGG + Intronic
1183693479 22:39404863-39404885 GGAGAAGTGGGGGCCAGGAGTGG + Intronic
1183718271 22:39547024-39547046 GAAGAACTGTGGGCCAGGTTAGG + Intergenic
1183780271 22:39994930-39994952 GCAGAGCTCGCGGCCAGGTGAGG + Exonic
1183896826 22:40976067-40976089 GAAGAAGTGAGGGCCGGGTGCGG - Intergenic
1184128809 22:42505137-42505159 GCAGAGGTGGGTGCCCGGTGTGG + Intergenic
1184137604 22:42558452-42558474 GCAGAGGTGGGTGCCCGGTGTGG + Exonic
1184181228 22:42828130-42828152 ACAAAGATGAGGGCCAGGTGTGG + Intronic
1184181512 22:42831007-42831029 ACAGAAGGGTCGGCCAGGTGTGG + Intronic
1184485432 22:44775738-44775760 AAAGAGTTATGGGCCAGGTGCGG - Intronic
1184614049 22:45625916-45625938 GCAGAGGTTTTGGTGAGGTGAGG - Intergenic
1184766432 22:46574951-46574973 GGAGGGGTGTGGGGCAGGAGGGG + Intergenic
1184799259 22:46750143-46750165 GAAGAGGCGTGGGCCAGCTCTGG + Intergenic
1184837549 22:47032824-47032846 GCAGAGCTGTGGGCTGGGAGTGG + Intronic
1184863182 22:47188450-47188472 GCAGAGGTGTGTGGGAGGTGGGG + Intergenic
1185101386 22:48842760-48842782 GCAGAGAGGTGGGGCAGTTGGGG - Intronic
1185175512 22:49324292-49324314 ACTGAGCTGAGGGCCAGGTGGGG - Intergenic
1185280796 22:49969054-49969076 ACACAGGTGGGGGCCAGCTGAGG + Intergenic
1185299980 22:50074485-50074507 GAGGGGGTCTGGGCCAGGTGAGG - Intronic
949509724 3:4757573-4757595 GCTGAGGCGTCGGACAGGTGGGG + Intronic
949658258 3:6247132-6247154 GAATAAATGTGGGCCAGGTGCGG + Intergenic
950119771 3:10474096-10474118 GCAGTGGTGTTGGAGAGGTGTGG + Intronic
950403609 3:12790144-12790166 AGCCAGGTGTGGGCCAGGTGCGG - Intergenic
950467297 3:13162962-13162984 GCAGGGGTGAAGCCCAGGTGAGG - Intergenic
950489583 3:13295557-13295579 ACAGCAGGGTGGGCCAGGTGCGG - Intergenic
950491400 3:13307265-13307287 GCAGAGCTATGAGTCAGGTGGGG - Intergenic
950556811 3:13701034-13701056 GCAGGGGTGACGCCCAGGTGAGG + Intergenic
950658376 3:14451483-14451505 GCACGGGTGAGGGCCAGGTAGGG + Intronic
950764778 3:15265706-15265728 GCAGTGATGTGGGTCAGGTGTGG + Intronic
950829544 3:15859998-15860020 GCAGGGGTGCGGGCCGGGGGAGG + Intergenic
951788662 3:26453759-26453781 ACATATGTGTGGGCCAGGCGCGG - Intergenic
952152332 3:30606744-30606766 GCAGATGTGCGGGCCAGATGTGG - Exonic
952323088 3:32296261-32296283 GTAGAAGTCTGGGTCAGGTGTGG - Intronic
952569908 3:34701791-34701813 GCAGAGGTGTGCTGCAGGGGTGG - Intergenic
952747380 3:36794061-36794083 GAAGACATGTGGGCCGGGTGCGG - Intergenic
952964402 3:38612135-38612157 GCAGGGGTCTGGGCCACTTGTGG + Intronic
953063872 3:39451419-39451441 TAAGAGTTCTGGGCCAGGTGTGG + Intergenic
953888250 3:46732057-46732079 GCCCAGATGTGGGCCATGTGCGG - Intronic
953908305 3:46879450-46879472 ACAGAGGCATAGGCCAGGTGCGG + Intronic
954112533 3:48442738-48442760 GCATAGGATTGGGCCAGGCGCGG - Intronic
954127709 3:48541417-48541439 AGCCAGGTGTGGGCCAGGTGCGG - Intronic
954300745 3:49699587-49699609 GCTGGGGTCTGGGCCAGGCGGGG + Intronic
954415858 3:50392988-50393010 GCCATGGTGTGGGCAAGGTGAGG + Intronic
954453384 3:50583820-50583842 GCAGAGGTATGGGCTAGGGGAGG - Exonic
954681894 3:52350374-52350396 GGGGAGGTCTGGGCCAGGGGAGG - Intronic
954704986 3:52475064-52475086 ACTTAGGTTTGGGCCAGGTGTGG + Intronic
955342023 3:58132295-58132317 GCATAGGTGCAGGGCAGGTGAGG - Intronic
955925281 3:63998198-63998220 GAAGGGGGGGGGGCCAGGTGGGG + Intronic
955951814 3:64250384-64250406 CTAGGGGAGTGGGCCAGGTGGGG + Intronic
956593702 3:70944235-70944257 GCAGGGGTGTGGGTTAGGTAAGG - Intergenic
956652029 3:71513074-71513096 AAAGAGGTATGGGCCAGGTTGGG - Intronic
957214906 3:77307590-77307612 GCAGGGGTGGGGGCAAGGTGCGG + Intronic
957276376 3:78095345-78095367 TCAAAGCTGTGGGCCTGGTGGGG - Intergenic
957820986 3:85373637-85373659 GCAGAGGTGTGCTGCAGGGGTGG - Intronic
958050753 3:88342317-88342339 GCACAGGTGTGGGCCATGATAGG - Intergenic
958903221 3:99912666-99912688 GAAGCTCTGTGGGCCAGGTGCGG - Intronic
959846614 3:111040617-111040639 GCAGAGGTGTGCTGCAGGGGTGG + Intergenic
960026936 3:113020101-113020123 GAAGAGGTTTGTGCAAGGTGTGG + Intergenic
960255385 3:115505945-115505967 GCAGAGGTGTGCTGCAGGGGTGG + Intergenic
960568070 3:119156405-119156427 GCAGAGGTGTGGCCACTGTGTGG + Intronic
960808594 3:121607597-121607619 TTAGAGGTCTCGGCCAGGTGCGG - Intronic
962250749 3:133834672-133834694 GCAGAGGGGAGGGCCAGGGTTGG - Intronic
962365699 3:134778385-134778407 AGAGTGATGTGGGCCAGGTGTGG - Intronic
962898460 3:139736632-139736654 GCATAGCTGGGGGACAGGTGGGG + Intergenic
963153348 3:142070195-142070217 AAAGAAGTTTGGGCCAGGTGCGG - Intronic
963225972 3:142862031-142862053 GAAGAGGTCAGGCCCAGGTGTGG - Intronic
963243125 3:143030753-143030775 GAACATTTGTGGGCCAGGTGTGG + Intronic
963257576 3:143161016-143161038 GCAGAGCTGTGGCTTAGGTGAGG + Intergenic
963808750 3:149753470-149753492 GCATTGCTCTGGGCCAGGTGTGG - Intergenic
964102737 3:153006444-153006466 GAAGAGGTGGAGGCCGGGTGTGG - Intergenic
964358061 3:155868634-155868656 ACAGACTTGTTGGCCAGGTGCGG - Intergenic
964678023 3:159305177-159305199 GCAGGGCTCTGGGCCAGGTGTGG - Intronic
964754343 3:160080436-160080458 CCACAGGTTTCGGCCAGGTGTGG - Intergenic
964983884 3:162716473-162716495 GCAGTCATGGGGGCCAGGTGTGG - Intergenic
965101925 3:164309589-164309611 GCAGAGGTGTGCTGCAGGGGTGG - Intergenic
966466251 3:180233815-180233837 GCAGAAGTTTGCTCCAGGTGTGG - Intergenic
966876195 3:184323202-184323224 CCCAAGGGGTGGGCCAGGTGGGG + Exonic
966916794 3:184588802-184588824 GAAGAGGAGTGAGGCAGGTGTGG + Intronic
966973934 3:185069079-185069101 GCAGAAGCCTGGGCCAGTTGTGG - Intergenic
967759194 3:193204750-193204772 CCAGAGATGTGGGCCAGATTAGG + Intergenic
967903093 3:194477237-194477259 GCAGAGGTGGGAGAAAGGTGGGG - Intronic
968196555 3:196712146-196712168 GCGGAGGTGGGGGCCGGCTGGGG + Exonic
968453102 4:684266-684288 GCAGTGGGGTGGGGCAGCTGTGG - Intronic
968547649 4:1206945-1206967 GGGCAGGTGTGGGGCAGGTGTGG + Intronic
968610983 4:1556871-1556893 GAAGAGGAGGGGGCAAGGTGAGG - Intergenic
968646953 4:1745979-1746001 GCAGAGGCTTGGCCCAGCTGGGG + Intergenic
968781889 4:2588559-2588581 GCAGAGGTGTGGGTGACTTGGGG + Intronic
968813469 4:2810281-2810303 GGAGAGGAGCAGGCCAGGTGAGG - Intronic
968814565 4:2815230-2815252 GCACAGGGCAGGGCCAGGTGGGG + Intronic
968952822 4:3703428-3703450 GCAGAGATGGGGGCAGGGTGGGG + Intergenic
969194640 4:5551031-5551053 GCAGAGGTGTGCTGCAGGGGTGG + Intronic
969228578 4:5814690-5814712 GCAGGGGTGTGGCCCATGTGAGG - Intronic
969370507 4:6728353-6728375 GCAGCGGTGTGTGCCAGGCCTGG - Intergenic
969491047 4:7499472-7499494 CCAGAGGTGGGGGCCTGGTCAGG + Intronic
969721353 4:8894403-8894425 GCGGAGGAGGGGGCCAGGAGGGG - Intergenic
971257674 4:25029825-25029847 GCAGAGGTTTGGGGCATGTTGGG - Intronic
971257979 4:25031049-25031071 GGCGAGGTGGGGGCCGGGTGGGG - Intergenic
971365678 4:25975273-25975295 ACTGAGGTATGGGCCATGTGTGG - Intergenic
971910630 4:32792381-32792403 ACAGGGGAGTAGGCCAGGTGAGG - Intergenic
971935697 4:33144195-33144217 GGTGAGGTTTGGGCCAGGAGTGG - Intergenic
972280639 4:37598973-37598995 GCACAGGTTTGGGCCAGGCGCGG - Intronic
972686755 4:41360256-41360278 GCAGAGGTAGGGGCAAGGCGGGG - Intronic
972798340 4:42445787-42445809 GAAGAGATATAGGCCAGGTGTGG + Intronic
973137730 4:46728380-46728402 ACAGATGTGTAGGCCAGGTGTGG + Intergenic
973986366 4:56358238-56358260 GTAGAGGGGTGGGGCTGGTGAGG - Intronic
975423236 4:74194700-74194722 GCACAGGTGTGGGCCACGATTGG - Intronic
976591072 4:86850468-86850490 GCAGAGGTGTGGTCAGGCTGAGG + Intergenic
977014059 4:91670379-91670401 GCAGAGGTGTGCTGCAGGGGTGG - Intergenic
979605605 4:122635464-122635486 GCAGAGGTGTGGGCCACAGTGGG + Intergenic
979621230 4:122801028-122801050 ACTGAGATCTGGGCCAGGTGTGG - Intergenic
979864334 4:125734685-125734707 GCAGAGGGGTAGGGCAGGAGTGG + Intergenic
980721081 4:136696592-136696614 GCTGATCTGTGGGGCAGGTGGGG - Intergenic
980882344 4:138724733-138724755 GGAGAGGTGTGGGCCGGAGGGGG - Intergenic
980904184 4:138931740-138931762 GCAGTCATGAGGGCCAGGTGTGG - Intergenic
981791244 4:148539414-148539436 GCAAAGGTGTGGTAAAGGTGTGG + Intergenic
981994176 4:150958171-150958193 GCAGAGGTGTGCTGCAGGGGTGG - Intronic
983789899 4:171783393-171783415 GCAGAGGTGTGTTGCAGGGGTGG - Intergenic
983840562 4:172452910-172452932 TAAGATGTGAGGGCCAGGTGCGG + Intronic
984117498 4:175700151-175700173 ATAGAGTTGTGGGCCGGGTGTGG - Intronic
984138723 4:175974972-175974994 GCTGATGTATAGGCCAGGTGCGG - Intronic
984983818 4:185308047-185308069 AGAGAGGTGTGGGCCCGGCGTGG - Intronic
985175475 4:187195354-187195376 GCTGAGGCGTGGGCTGGGTGAGG - Intergenic
985588151 5:751404-751426 GGGCAGGTGTGGGACAGGTGTGG + Intronic
986778822 5:11045603-11045625 GCAGAGGAGAAGGCCATGTGAGG - Intronic
989273324 5:39557207-39557229 TCTGAGGTGGGGGGCAGGTGAGG + Intergenic
989360852 5:40599766-40599788 GCAGAGGTGTGGGGGTGATGAGG - Intergenic
989709980 5:44387294-44387316 GCAGGGGTGTGGGCTGGTTGGGG - Intronic
990327917 5:54696363-54696385 ACAGAGGAGAGGACCAGGTGCGG - Intergenic
990743008 5:58931662-58931684 GGAGATGTGTGGGACAGTTGGGG - Intergenic
990804921 5:59649356-59649378 GCAGAAGTGTGAGCCGGGGGAGG + Intronic
991495297 5:67220214-67220236 GGAGAGGAGAGGGTCAGGTGTGG + Intergenic
992639915 5:78760418-78760440 GCACAGGTGTTGCACAGGTGGGG - Intronic
992972617 5:82078415-82078437 GAAAATGTGTGTGCCAGGTGTGG + Intronic
994145390 5:96389084-96389106 GCAGTGGGGTGGGAGAGGTGGGG + Intergenic
995176849 5:109188000-109188022 GCAGAGGTGAAAGCCAGCTGTGG - Exonic
996314681 5:122148594-122148616 GCAGAGGTAGGGACCAGTTGGGG - Intronic
997811327 5:136973289-136973311 AAAGAGGTATTGGCCAGGTGTGG + Intergenic
998253133 5:140565955-140565977 ACAGTGGAGTGGGCCAGGTAAGG + Exonic
998379186 5:141711909-141711931 GCAGAGGTGGAGGCCAGGGCTGG - Intergenic
999742762 5:154569032-154569054 GCCTGGGTTTGGGCCAGGTGTGG + Intergenic
999745476 5:154588608-154588630 GCTGAGGAGAGGGCCATGTGAGG - Intergenic
1000042437 5:157494770-157494792 GCAGAGGTCAGGGGCAGGTCGGG + Exonic
1000355675 5:160392070-160392092 CTAGATGTGTAGGCCAGGTGCGG - Intergenic
1000502414 5:162068141-162068163 GAAGAGGTGGGGGGAAGGTGTGG + Intronic
1001038420 5:168314720-168314742 CCAGAGGTGGGCTCCAGGTGTGG + Intronic
1001094525 5:168766028-168766050 CCAGGGGTGTGGGACAGGTAGGG + Intronic
1001266575 5:170278462-170278484 GCAGGGGTGGGGGGCTGGTGAGG + Intronic
1001610096 5:172993562-172993584 TAAGAGTTCTGGGCCAGGTGTGG + Intronic
1001964086 5:175898084-175898106 GCAGAGATGCGGGCCCTGTGTGG + Intergenic
1002090749 5:176804355-176804377 GCACATGTGTGAGCTAGGTGTGG + Intergenic
1002312277 5:178322280-178322302 AAATAGGCGTGGGCCAGGTGCGG - Intronic
1002420906 5:179148687-179148709 GCACAGGTGGGCGCTAGGTGGGG - Intronic
1002433823 5:179219618-179219640 GCAGAGGTGTGAGGCTGCTGAGG + Intronic
1002505297 5:179675212-179675234 GGAGAGATGAGGGCCAGGTGTGG - Intergenic
1002811893 6:639177-639199 GCAGAGGTGTGGGAAACTTGGGG + Intronic
1002855654 6:1035744-1035766 GGTGAGGTGTGTGCCAGGAGTGG + Intergenic
1003108740 6:3235641-3235663 GCAGACTAGTGGGCCAGTTGGGG - Intronic
1003226886 6:4214126-4214148 GCAGAGGTGTGCTGCAGGGGTGG - Intergenic
1003315864 6:5011406-5011428 GCAGAGCTGTGGGCAAGGAAAGG + Intergenic
1003425253 6:5994696-5994718 GTGGAGGTGTGGGCGGGGTGGGG + Intergenic
1004063421 6:12220219-12220241 GAATATGTGTGGGCCAGGCGTGG + Intergenic
1004228627 6:13811631-13811653 GTAGAGTTCTGGGGCAGGTGAGG - Intronic
1004602726 6:17166069-17166091 GCAAATGTGTGGGCCGGGCGCGG + Intergenic
1004649280 6:17593005-17593027 TTAGAAATGTGGGCCAGGTGTGG - Intergenic
1005710530 6:28500007-28500029 GCATAGGTGAGGGGCAGGTTTGG - Intergenic
1005945689 6:30593831-30593853 GCAAAAGTATAGGCCAGGTGCGG - Intronic
1006574215 6:35032169-35032191 GCAGAGTGCTGGGCAAGGTGTGG + Intronic
1006634086 6:35449920-35449942 GCAGGGGTATGGGGCAGGGGAGG + Intergenic
1006648964 6:35535374-35535396 GCTGAGGTCAGGGCAAGGTGAGG - Intergenic
1006828451 6:36954354-36954376 ACAGAGGAGTGGGCAAGATGAGG - Intronic
1007145251 6:39622947-39622969 GCGGTGGTGTGGGAGAGGTGAGG + Intronic
1007468696 6:42073998-42074020 GAAAAGGAGTGTGCCAGGTGTGG + Intronic
1007511037 6:42374513-42374535 ACAGATGTGTGGGCATGGTGAGG - Intronic
1007587191 6:42998605-42998627 CCAGAAGTGAGGGCCAGGTATGG + Intronic
1008101262 6:47393682-47393704 GCAAAGGGCTGGGCCAGGTATGG + Intergenic
1010613472 6:77984854-77984876 CCTGAGGTGTGAGCTAGGTGTGG + Intergenic
1010971607 6:82268979-82269001 TCAGAGGTGTTGGCCGGGCGTGG + Intergenic
1010981708 6:82376555-82376577 GCAGAGGTGTGCTGCAGGGGTGG - Intergenic
1011343768 6:86346690-86346712 GCAGAGGTGTGCTGCAGGGGTGG - Intergenic
1011738245 6:90333884-90333906 GCAGAGGTGTGCTACAGGGGTGG - Intergenic
1012661335 6:101897968-101897990 CCAGAGTGGTGGGTCAGGTGAGG + Intronic
1013022844 6:106236002-106236024 GCCAAGGTCTGGGCCAGGTCAGG - Intronic
1013064289 6:106668936-106668958 GCAGGGGAGTAGGCCAGGCGCGG + Intergenic
1013238876 6:108224568-108224590 GCAGCTAAGTGGGCCAGGTGTGG - Intronic
1014254935 6:119151522-119151544 AATGAGCTGTGGGCCAGGTGCGG + Intergenic
1014474934 6:121860393-121860415 GCAGAGGAGAGAGGCAGGTGTGG + Intergenic
1015235233 6:130963122-130963144 GCACAGGACTGGGCCATGTGTGG - Intronic
1016131728 6:140481454-140481476 GCAGGGGTGGGGGGCAGGTAGGG + Intergenic
1016241257 6:141934381-141934403 GCAGAGGTGTAGTGCAGGGGTGG + Intergenic
1016393523 6:143598574-143598596 GCAGAAGTGTGGGCCAGGGAGGG + Intronic
1016439574 6:144069255-144069277 AAAGAGGTTTAGGCCAGGTGCGG + Intergenic
1016643522 6:146378135-146378157 GCAGAGGTGTGCTGCAGGGGTGG + Intronic
1017070331 6:150570371-150570393 AGAGACGTGAGGGCCAGGTGCGG - Intergenic
1017109551 6:150919518-150919540 GCAGAACTGTGAGCCAGGTCAGG - Intronic
1017125269 6:151058964-151058986 GAAGCTCTGTGGGCCAGGTGCGG - Intronic
1017133583 6:151129195-151129217 GCAGAGGTGTGCTGCAGGAGCGG + Intergenic
1017168115 6:151428822-151428844 TTATAAGTGTGGGCCAGGTGTGG - Intronic
1017247051 6:152238175-152238197 GCCCAGGTGTGTGCCTGGTGGGG + Intronic
1017836931 6:158187284-158187306 TAAGAGCTCTGGGCCAGGTGCGG - Intronic
1017894287 6:158665817-158665839 ACAGAAGTTTGGGCCAAGTGTGG + Intronic
1018086271 6:160303729-160303751 GCAGAGGTGTGTTGCAGGGGTGG - Intergenic
1018131389 6:160735230-160735252 GCAGTGGTGTGTACCAGATGGGG - Intronic
1018717020 6:166541254-166541276 CCAGAGGTGTGGGGCAGGCGAGG + Intronic
1018893880 6:168000338-168000360 GGAGTGGGGAGGGCCAGGTGTGG - Intronic
1018893972 6:168000643-168000665 GGAGTGGGGAGGGCCAGGTGTGG - Intronic
1018893983 6:168000674-168000696 GGAGTGGGGAGGGCCAGGTGTGG - Intronic
1019049330 6:169171058-169171080 ACAGAGATGTGATCCAGGTGGGG + Intergenic
1019350041 7:550324-550346 TGTGAGGTGTGGGCCGGGTGGGG - Exonic
1019433069 7:1008241-1008263 GCCCAGGTGTGGGCAAGGTGTGG - Intronic
1019446714 7:1075009-1075031 GCAGATGTGTGGGCCATGGGAGG + Intronic
1019496703 7:1343971-1343993 AAAGAGGTGTAGGCCGGGTGCGG + Intergenic
1019586517 7:1807326-1807348 AAAAATGTGTGGGCCAGGTGCGG + Intergenic
1019699596 7:2468271-2468293 GCAGAGGATGGGGCCAGGTGCGG - Intergenic
1019699847 7:2469254-2469276 GCAGAGGTTTCGGCCGGGCGCGG + Intergenic
1019885397 7:3899870-3899892 GCAGAGCTGTGTGCCAGGTCCGG - Intronic
1020008793 7:4797185-4797207 GCTGAGGTGCGGGACTGGTGAGG - Intronic
1020109145 7:5438406-5438428 GCAGAGGTGGGGGACAGCTCTGG - Intronic
1021001810 7:15340745-15340767 GCAGAGGTGTGCTGCAGGGGTGG + Intronic
1021553424 7:21896017-21896039 TCAAAAGTGTGGGCCAGGCGCGG - Intronic
1021929312 7:25563826-25563848 ACAAAGATTTGGGCCAGGTGCGG + Intergenic
1022103428 7:27182506-27182528 GCAGAGCTGCGGGCTGGGTGTGG - Exonic
1022112588 7:27240511-27240533 GCAGAGCTGGGGGCGGGGTGGGG + Intergenic
1022122423 7:27322201-27322223 GCAGAGGAGTGCTCCAGTTGTGG + Intergenic
1022314915 7:29236823-29236845 GCAGAGGTGAGGGTGATGTGGGG - Intronic
1022499107 7:30871487-30871509 GCAGAGGTGTGCCACACGTGAGG - Intronic
1022511503 7:30937670-30937692 GGAGGGGTGAGGGCGAGGTGTGG - Intergenic
1023013342 7:35942452-35942474 TCAGTGTTGTTGGCCAGGTGCGG - Intergenic
1023210828 7:37803145-37803167 GTAGATGGATGGGCCAGGTGTGG - Intronic
1023317868 7:38959010-38959032 TGAGTGGTGTGGGCCAGGTGCGG - Intergenic
1023881360 7:44323408-44323430 CCAGAGGTGGAGACCAGGTGGGG - Intronic
1023991222 7:45130015-45130037 GCAGAGGTGTGGATCAGGAGGGG - Intergenic
1024077789 7:45831380-45831402 TCAGTGTTGTTGGCCAGGTGCGG + Intergenic
1024329896 7:48145174-48145196 GCAGAGTTTATGGCCAGGTGTGG - Intergenic
1024487185 7:49932084-49932106 GCAGAGGTGTGCTGCAGGGGTGG + Intronic
1024567621 7:50695029-50695051 GCAGAGGTGTGTCCCAGGCACGG - Intronic
1024903528 7:54350199-54350221 GCAGAGGGGTGGGCCACCTGAGG + Intergenic
1024911865 7:54455793-54455815 CCAGAAGCCTGGGCCAGGTGTGG - Intergenic
1025021154 7:55481219-55481241 GCAGGGGAGTGAGCCAGGAGGGG + Intronic
1025216434 7:57060545-57060567 GGAGGGCTGGGGGCCAGGTGGGG - Intergenic
1025730410 7:64102483-64102505 GCAGCAGTCTGGTCCAGGTGGGG + Intronic
1025932943 7:66010897-66010919 GCAGTGGGGTGGGTGAGGTGGGG + Intergenic
1026385837 7:69846861-69846883 GCTGATGTGGGGGCCGGGTGTGG - Intronic
1026466897 7:70662064-70662086 CCAGAGATGTGGGCCAGGTGGGG + Intronic
1026896095 7:74010833-74010855 GCAGAGCTGGGGGCTGGGTGCGG - Intergenic
1026928618 7:74210535-74210557 ACAGAGTTGAGGGCCAGGTAGGG - Intronic
1027228239 7:76258220-76258242 GCAGAGGGGAGGGCGAGGAGAGG + Intronic
1027291861 7:76722683-76722705 TAATAGGTGTGGGCCGGGTGCGG + Intergenic
1027344033 7:77238776-77238798 ACTGAGTTGTGGGCCAGGGGAGG - Intronic
1029584175 7:101459596-101459618 GGCCAGGTGTAGGCCAGGTGTGG - Intronic
1030009833 7:105154961-105154983 GAATAAGGGTGGGCCAGGTGCGG - Intronic
1030504648 7:110405478-110405500 TGAGAGGTATTGGCCAGGTGGGG - Intergenic
1030605465 7:111634449-111634471 CGAGAAGTTTGGGCCAGGTGTGG - Intergenic
1030809894 7:113959253-113959275 GCAGAAGTGTGGTGCAGGGGTGG - Intronic
1031186041 7:118481427-118481449 GCAGAGGTGTGCTGCAGGGGTGG - Intergenic
1032164869 7:129537731-129537753 GCAGATCTGTGGACCAGCTGAGG + Intergenic
1032645016 7:133814134-133814156 GCAGGGGTGGGGGTCAGGTCTGG - Intronic
1033028985 7:137806721-137806743 GCAGAGGTTCAGGCCGGGTGCGG - Intronic
1033209243 7:139448284-139448306 GGAGAAATGTTGGCCAGGTGTGG - Intergenic
1033281550 7:140009784-140009806 ATGGAGGTGTGGGGCAGGTGTGG - Intronic
1033281583 7:140009888-140009910 GTGAAGGTGTGGGGCAGGTGTGG - Intronic
1033281592 7:140009918-140009940 GGGCAGGTGTGGGGCAGGTGTGG - Intronic
1033281600 7:140009940-140009962 GGGCAGGTGTGGGGCAGGTGCGG - Intronic
1033281608 7:140009962-140009984 GGGCAGGTGTGGGGCAGGTGCGG - Intronic
1033281624 7:140010017-140010039 GTGGAGGTGTGGGGCGGGTGTGG - Intronic
1034281631 7:149858933-149858955 GCACACGCGTGGGCCAGCTGTGG + Intronic
1034281641 7:149858966-149858988 GCACACGCGTGGGCCAGCTGTGG + Intronic
1034281651 7:149858999-149859021 GCACACGCGTGGGCCAGCTGTGG + Intronic
1034281661 7:149859032-149859054 GCACACGCGTGGGCCAGCTGTGG + Intronic
1034281671 7:149859065-149859087 GCACACGCGTGGGCCAGCTGTGG + Intronic
1034399833 7:150854910-150854932 GCAGAGGTCTGAGACAGGAGTGG + Intronic
1034529946 7:151689467-151689489 GATGGGGTGTGGGCCACGTGGGG + Intronic
1034558821 7:151866853-151866875 GCAGAGGTGTGTGCGAGGGGTGG - Intronic
1035046461 7:155970849-155970871 GCAGAGGAGTGGGCTATGAGAGG - Intergenic
1035202180 7:157274751-157274773 AAAGAAGTGTGGGCCAGGCGCGG + Intergenic
1035354927 7:158270945-158270967 GTGGAGGGGTGGTCCAGGTGGGG - Intronic
1035886499 8:3296708-3296730 GAAGAGGTGTGCGTGAGGTGAGG + Intronic
1035896144 8:3404476-3404498 GCAGAGCTGGGGTCTAGGTGTGG - Intronic
1036209819 8:6833134-6833156 GCGGGGGTATGGGCCAGGTAGGG - Intronic
1037367254 8:18136211-18136233 GGAGCAGTGAGGGCCAGGTGTGG + Intergenic
1037703300 8:21295164-21295186 GAAGAAGTGTGTTCCAGGTGGGG + Intergenic
1038854807 8:31319820-31319842 GCAGTGTGGTGGGCAAGGTGAGG - Intergenic
1039437944 8:37573544-37573566 GCAGGGGTGAGGGACAGGGGTGG - Intergenic
1039630766 8:39108778-39108800 GCAGAGGTGTGGTCAAGGCCAGG + Intronic
1040530007 8:48259038-48259060 GCAGATGTGTGAGCCAGCTCAGG + Intergenic
1040616519 8:49043120-49043142 TCACAGGTGTGGGCCACGTGTGG + Intergenic
1041237310 8:55817151-55817173 GGAGAGATGAGGGCCAGGCGTGG - Intronic
1041288181 8:56282228-56282250 GCAGAGAAGTGGGCCTGCTGGGG - Intergenic
1041448880 8:57985868-57985890 GCACAAGTGTGGGGCTGGTGGGG - Intergenic
1041662758 8:60415081-60415103 GAATAGGTTTGGGCCAGGTGCGG + Intergenic
1041748934 8:61238067-61238089 GAAGAGGTGTGGGGCAGGGTAGG - Intronic
1041901570 8:62988395-62988417 GCAGAAGTGTGCTGCAGGTGCGG - Intronic
1044680048 8:94768701-94768723 TAAGATGTGTTGGCCAGGTGCGG + Intronic
1044693415 8:94900254-94900276 GCAGAGGTGTGCTCTCGGTGGGG + Intronic
1044700624 8:94962581-94962603 ACAGAAGTCTGGGCTAGGTGTGG - Intronic
1044893570 8:96863499-96863521 GAAGAGGTGTGGTGAAGGTGAGG + Intronic
1046148404 8:110191584-110191606 AAAGAGGAGGGGGCCAGGTGTGG - Intergenic
1046226324 8:111285445-111285467 GCAGAGGTGTGCTGCAGGGGTGG - Intergenic
1046932172 8:119852643-119852665 GAAGAAATTTGGGCCAGGTGTGG - Intronic
1048111589 8:131473706-131473728 GCAGAGGTGTGCTGCAGGGGTGG + Intergenic
1048183271 8:132215703-132215725 GCAGATGTGCCTGCCAGGTGAGG + Intronic
1049038058 8:140091983-140092005 GCAGAGGTCTGGGCTGGGGGTGG - Intronic
1049536617 8:143185596-143185618 GCAGAGATGTGGGGCATGGGAGG - Intergenic
1049651676 8:143772492-143772514 CCAGAGGTGTGGGCCCCGGGAGG + Intergenic
1049690816 8:143958092-143958114 GCAGAAGCCTGGGGCAGGTGAGG - Intronic
1049701091 8:144012999-144013021 ACAGAGGAGAGGGCCAGGTAAGG - Intronic
1050696765 9:8287999-8288021 TCATAGGTGTGGGCAAGTTGGGG + Intergenic
1051636863 9:19188643-19188665 AGTGAGCTGTGGGCCAGGTGTGG - Intergenic
1051655285 9:19375291-19375313 GCAAAGGGGATGGCCAGGTGGGG - Intergenic
1051921652 9:22274288-22274310 GCAGGGGTGTGGGGGAGGGGTGG - Intergenic
1052707595 9:32011297-32011319 GCAGAGGTGAAGCCCTGGTGTGG - Intergenic
1053709530 9:40791622-40791644 AAAGAGTTTTGGGCCAGGTGCGG - Intergenic
1054419434 9:64912410-64912432 AAAGAGTTTTGGGCCAGGTGCGG - Intergenic
1054773583 9:69105678-69105700 GTACAGGTGTGGGCTGGGTGTGG + Intergenic
1055264688 9:74481415-74481437 GCACATATGTGGGCCAGGCGCGG + Intergenic
1055294928 9:74824440-74824462 CAAGAGAAGTGGGCCAGGTGTGG - Intronic
1056214597 9:84395291-84395313 GAAAAAGTTTGGGCCAGGTGTGG - Intergenic
1056803606 9:89711351-89711373 GGAGAGGTGTGGGGCAGGGAAGG - Intergenic
1056846654 9:90044053-90044075 GAAGAGGAATGGGCCAGCTGGGG - Intergenic
1057210710 9:93199606-93199628 ACAAAGCTGTGGGCCGGGTGCGG + Intronic
1057716734 9:97501775-97501797 GCAGAGCTGTGGGGCCGGCGCGG - Exonic
1058794303 9:108483327-108483349 GGAGAAGTGTGGCCCAGGTTTGG + Intergenic
1059351811 9:113670800-113670822 GCCAGGGTCTGGGCCAGGTGTGG - Intergenic
1059425482 9:114218316-114218338 GCAGAGGAGTGTGGCAGGGGAGG - Intronic
1059456824 9:114404991-114405013 GCAGAGGTTCAGACCAGGTGTGG + Intronic
1059654933 9:116349030-116349052 ATAGAGGAGAGGGCCAGGTGGGG - Intronic
1059716310 9:116916554-116916576 AGAAAGATGTGGGCCAGGTGTGG + Intronic
1060234591 9:121853462-121853484 GCAGAGGTGGGGGCCTGAGGGGG + Intronic
1060551500 9:124487625-124487647 GCAGGGCGGTGGGGCAGGTGGGG + Intronic
1060791319 9:126487467-126487489 AAACAGGTCTGGGCCAGGTGTGG + Intronic
1061413040 9:130431335-130431357 GCATGGGGGTGGGGCAGGTGGGG - Intronic
1061665872 9:132161045-132161067 GCAGAGTAGTGGGGCAGGAGGGG - Intergenic
1061943175 9:133893829-133893851 GCTGCTGTGTGGGTCAGGTGCGG - Intronic
1061985743 9:134129311-134129333 GCAGAGGTATAGGGCAGGGGTGG + Intergenic
1062154084 9:135036561-135036583 GCAGAGGTTTTGGCCACCTGGGG - Intergenic
1062231851 9:135486297-135486319 GTAGAGGTGGTGGCCATGTGAGG + Exonic
1062243747 9:135552952-135552974 GCAGAGGCGTGGGGTGGGTGTGG - Intergenic
1062254667 9:135615272-135615294 GCAGGGGTGTGGGCCGGGTCGGG - Intergenic
1062357391 9:136171269-136171291 GCAGAGACGTGGGCCAGGGAGGG - Intergenic
1062390381 9:136331415-136331437 GCTGGGGAGGGGGCCAGGTGGGG + Intronic
1062412213 9:136431266-136431288 GGAGAGGTGAGGGCCTGGGGGGG - Intronic
1062412259 9:136431390-136431412 GGAGAGGTGAGGGCCTGGGGGGG - Intronic
1062412275 9:136431432-136431454 GGAGAGGTGAGGGCCTGGGGGGG - Intronic
1062412338 9:136431599-136431621 GGAGAGGTGAGGGCCTGGGGGGG - Intronic
1062412354 9:136431641-136431663 GGAGAGGTGAGGGCCTGGGGGGG - Intronic
1062412400 9:136431765-136431787 GGAGAGGTGAGGGCCTGGGGGGG - Intronic
1062453112 9:136623758-136623780 GCAGAGCTGAGGGGCAGGCGTGG + Intergenic
1186247768 X:7632101-7632123 GCCCAGGAGTGGGCCTGGTGAGG + Intergenic
1186799649 X:13079878-13079900 ATATAGATGTGGGCCAGGTGCGG - Intergenic
1187214675 X:17264859-17264881 GCAGAGGTGTGCTGCAGGGGTGG + Intergenic
1187539189 X:20174635-20174657 GTAGAGTTTTAGGCCAGGTGCGG - Intronic
1187680572 X:21763560-21763582 GCGAAGCTGTGGGCCAGGTGGGG - Intergenic
1187931147 X:24294657-24294679 GCACAGGTGTGGGCCACGGTGGG - Intergenic
1188204474 X:27337654-27337676 TAAGAGTTCTGGGCCAGGTGCGG + Intergenic
1188396095 X:29685694-29685716 ACAGAAGTATTGGCCAGGTGCGG + Intronic
1188660061 X:32748050-32748072 GAAAAAGTGTAGGCCAGGTGTGG + Intronic
1189193617 X:39133343-39133365 CCTGAGGTGGGGGCCAGGAGGGG + Intergenic
1189339650 X:40195021-40195043 GGCCAGGTGTGGGCCAGGTGCGG - Intergenic
1190679402 X:52811792-52811814 GCAGAGGTGCCCGCCCGGTGAGG + Intergenic
1190877685 X:54471271-54471293 GCAGAGAAGTGGCCCAGGGGAGG - Intronic
1193640806 X:84007932-84007954 GGAGAGCTTTGGGCCAGGAGAGG - Intergenic
1193828518 X:86257696-86257718 CAAGAGTTGTAGGCCAGGTGTGG - Intronic
1194199891 X:90941566-90941588 GCAGAGGTCTGATCCAGGGGTGG - Intergenic
1195091792 X:101467439-101467461 TCATAGGTTTTGGCCAGGTGTGG - Intronic
1195269343 X:103215186-103215208 GAGGACGTGTGGGCCAGGGGCGG + Exonic
1195281015 X:103332597-103332619 GCAGCAGTGTTGGGCAGGTGTGG - Intergenic
1195901968 X:109808462-109808484 GCCAATGTGTGGGCCAGGTACGG + Intergenic
1195929880 X:110063859-110063881 GCACAGGTGTGGGGCTGTTGGGG + Intronic
1196793630 X:119485622-119485644 GCGGAAGGGTGGGCCAGGTGTGG + Intergenic
1198729600 X:139714730-139714752 TCAGTGTTTTGGGCCAGGTGTGG - Intergenic
1198912831 X:141633688-141633710 GCAGAGGTGTGCTGCAGGGGTGG + Intronic
1199192067 X:144981940-144981962 GCAGAGGTGTGCTGCAGGGGTGG + Intergenic
1199206938 X:145160016-145160038 GCAGAGGTGTGCTGCAGGGGTGG - Intergenic
1199713300 X:150487658-150487680 GAATAGATGTTGGCCAGGTGAGG - Intronic
1199983958 X:152937128-152937150 ACAGAGGTGTAGGTCAGGTAAGG + Intronic
1200545882 Y:4517982-4518004 GCAGAGGTCTGATCCAGGGGTGG - Intergenic
1200988589 Y:9327745-9327767 GCTGAGGTGAGCGCCAGGTAGGG + Intergenic
1202119401 Y:21508447-21508469 GCTGAGGTGAGCGCCAGGTAGGG - Intergenic
1202121853 Y:21531987-21532009 GCTGAGGTGAGCGCCAGGTAGGG - Intronic
1202157153 Y:21897395-21897417 GCTGAGGTGAGCGCCAGGTAGGG + Intronic
1202159599 Y:21920936-21920958 GCTGAGGTGAGCGCCAGGTAGGG + Intergenic
1202186044 Y:22185851-22185873 GCTGAGGTGAGCGCCAGGTAGGG + Intergenic
1202205315 Y:22400545-22400567 GCTGAGGTGAGCGCCAGGTAGGG - Intronic