ID: 1105375686

View in Genome Browser
Species Human (GRCh38)
Location 13:19842246-19842268
Sequence GGCTCTTGACAGCCCCCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105375686 Original CRISPR GGCTCTTGACAGCCCCCTGC GGG (reversed) Intronic
900641308 1:3689252-3689274 GTCTCTGGGAAGCCCCCTGCAGG - Intronic
902551118 1:17220142-17220164 GGGTCTTGCCAGCAGCCTGCAGG + Intronic
902615159 1:17619561-17619583 GGCTCTTGGCAGAGCCCAGCTGG + Intronic
902724244 1:18324444-18324466 GGCTCATGACCGCCCCCTGCAGG - Intronic
903216010 1:21843610-21843632 GGCTCTTGACTTCCTCCTGCCGG - Intronic
903348711 1:22704624-22704646 GTCTCTTGACTGCCACCTGGTGG - Intergenic
915216293 1:154342864-154342886 CGATCTTGACAGCCTCCAGCAGG - Exonic
921054997 1:211536838-211536860 GGGTCTTTCCAGCCCCATGCTGG - Intergenic
922755260 1:228093072-228093094 GGCTCCTGGCATCCTCCTGCTGG + Intronic
923264679 1:232302825-232302847 GGCTCTTGTCTGGCCCCTGCTGG + Intergenic
924710524 1:246527187-246527209 CTCTCCTGCCAGCCCCCTGCAGG + Intergenic
1067839192 10:49662659-49662681 GGCCATTGACAACCACCTGCTGG + Exonic
1069552736 10:69375819-69375841 GGTTCTTGCCAGCTCCCGGCTGG + Intronic
1069878219 10:71576080-71576102 GCCTCTGGGCAGCCCCATGCAGG + Intronic
1070145426 10:73770408-73770430 GGCTCTGGACAACACCCTGTTGG - Exonic
1075228013 10:120646922-120646944 GGCTCTTGCCACTCTCCTGCTGG + Intergenic
1076602652 10:131668820-131668842 GGCTCCTGACAGCTCTTTGCTGG + Intergenic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1077392770 11:2307660-2307682 GGCTTTTGAGAGCCCCCTTGCGG - Intronic
1077453307 11:2663707-2663729 GGGTCTTGCAAGGCCCCTGCAGG + Intronic
1077799073 11:5520660-5520682 GGTTCTTTACAGCCCCACGCTGG - Intronic
1078507100 11:11960426-11960448 GTGTCTTGCCAGCCTCCTGCTGG + Intergenic
1078668378 11:13344306-13344328 GACACTTGACTGCCACCTGCTGG + Intronic
1079078356 11:17397241-17397263 TGCGCTTCACAGCCCCCAGCTGG + Exonic
1081825820 11:46050428-46050450 GGCTTTTGAGAGGCCCATGCAGG + Intronic
1082807218 11:57458847-57458869 GGCTCTCGGGTGCCCCCTGCTGG - Intergenic
1083201049 11:61121319-61121341 GGCTGTTGGCAGCCACCAGCAGG - Intronic
1083263774 11:61536852-61536874 GGCTCTTGAGAGGCCCCTAGGGG - Intronic
1083662335 11:64257302-64257324 GCCTCTTAAAAGCACCCTGCAGG - Intronic
1085447638 11:76611180-76611202 GGAACTGGACGGCCCCCTGCGGG - Intergenic
1087200328 11:95338456-95338478 GGCTCTTCACATCCCTCTGGGGG + Intergenic
1088745064 11:112798105-112798127 AGCACCTGACCGCCCCCTGCAGG - Intergenic
1089684392 11:120137683-120137705 GCTTCTTGGCAGCCCCCAGCTGG + Exonic
1091567649 12:1660988-1661010 GCCTCCTGGCAGCCCCATGCGGG + Intergenic
1096121573 12:49092320-49092342 GGATCTGGGGAGCCCCCTGCAGG + Intronic
1096571277 12:52524658-52524680 TGCTCCCCACAGCCCCCTGCAGG - Intergenic
1096869384 12:54583882-54583904 AGCTCTTCACAGCCCCCAGAGGG - Intronic
1097071266 12:56356526-56356548 GAATCTTGACAGCCCCTTTCAGG - Exonic
1097194296 12:57235298-57235320 GGCTCTTGGTGGACCCCTGCTGG + Exonic
1102258159 12:111428171-111428193 GGCGCTGGCCAGCCCCCTCCAGG - Intronic
1102953657 12:117046115-117046137 GGCTCTTGTCAGCCCCCAATAGG + Intronic
1104205239 12:126632316-126632338 GCCTCTTAACTGCCCCCTGGAGG - Intergenic
1105375686 13:19842246-19842268 GGCTCTTGACAGCCCCCTGCGGG - Intronic
1105624881 13:22103183-22103205 GCCTCATGAGGGCCCCCTGCTGG + Intergenic
1105896104 13:24718510-24718532 GGGTCTTCACATCCCCCAGCCGG - Intergenic
1108685034 13:52812033-52812055 GCCTCTCAACAGCACCCTGCAGG - Intergenic
1113913219 13:113854528-113854550 TGCTCCCGACAGCCCCCAGCAGG + Intronic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1114494145 14:23121033-23121055 GGCTCTCGGCAGGCTCCTGCGGG + Intergenic
1117628016 14:57660350-57660372 GGCTCTTGACAGGCTTCTGCTGG + Intronic
1118844512 14:69536842-69536864 TGCTCTAGACAGCCACGTGCAGG - Intergenic
1119428190 14:74549673-74549695 GGCTCCTGGCAGCCCTCTGCTGG - Intronic
1121544658 14:94754591-94754613 GGCTTTTGACAGTCCTCGGCTGG + Intergenic
1122407481 14:101508989-101509011 GGCCCTTGAGACCCCCCTGCTGG - Intergenic
1122637136 14:103135413-103135435 TGCTCTTAACAGCTCCCAGCGGG - Exonic
1122932860 14:104942730-104942752 GGCCCTTGACATCCACCTGGGGG + Exonic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1128535275 15:68485757-68485779 GGCTCTTGGCAGCCTGCAGCTGG + Intergenic
1128747681 15:70125908-70125930 GGGTGTTTACAGCCCCCTGAGGG + Intergenic
1129195687 15:73964901-73964923 TGCTCTTGCCCGCCCCCTGGTGG + Intergenic
1129265440 15:74390878-74390900 GCTTCTTGGCAGCCACCTGCAGG + Intergenic
1130415075 15:83685969-83685991 GGCTCTTTCCAGCCTCTTGCTGG + Intronic
1131218530 15:90560780-90560802 GGCTCCTGATTGCACCCTGCAGG + Intronic
1131412172 15:92218863-92218885 GGCAATTTACAGTCCCCTGCAGG + Intergenic
1132998788 16:2838802-2838824 TGCTCCTGACAGCCACCTCCAGG + Intronic
1133219567 16:4314066-4314088 GGCCCTTAATAGCCCCCTCCTGG + Intergenic
1133344850 16:5063009-5063031 GTCACTTGACAGCCATCTGCTGG - Intronic
1135555802 16:23435611-23435633 GGCTCCTGTCCGCCCCCTTCTGG + Intronic
1135787526 16:25363810-25363832 GGCTGGTCACAGCTCCCTGCTGG - Intergenic
1137566750 16:49538103-49538125 AGCTCCTGACAGCCCCCACCAGG + Intronic
1137773838 16:51039830-51039852 GGCTCCTCACTGCCCCCAGCAGG - Intergenic
1139153710 16:64415504-64415526 GGCCATTGAAAGCCACCTGCAGG + Intergenic
1139925584 16:70484055-70484077 GGCTCTTGACAGGCCATAGCTGG - Intronic
1140376681 16:74450429-74450451 GGCTCTTGAGAGCCCCAGGCAGG - Intergenic
1141443272 16:84042841-84042863 GCCTCTCCCCAGCCCCCTGCAGG + Intergenic
1142006786 16:87693017-87693039 GGCTGTTCTCTGCCCCCTGCAGG + Intronic
1142496547 17:309410-309432 GGCTCCTGCCAGCCCCCTGCTGG + Intronic
1142496615 17:309584-309606 GGCTCCTGCCAGCCTCCTGCTGG + Intronic
1142496633 17:309638-309660 GGCTCCTGCCAGCCCCCTGCTGG + Intronic
1142496655 17:309697-309719 GGCTCCTGCCAGCCTCCTGCTGG + Intronic
1143777732 17:9210296-9210318 GGCTGTAGACAGCTCCCTGAGGG - Intronic
1144495374 17:15742105-15742127 GCCTCTTGCCAGCCCCATGAGGG - Intronic
1144832875 17:18141412-18141434 GACACTTGACTGCCACCTGCTGG - Intronic
1145799937 17:27676504-27676526 CTCTCTTGCCAGCCCCCTGCAGG + Intergenic
1146320474 17:31842714-31842736 GGGTCTTTACTGCCACCTGCTGG + Intergenic
1146911391 17:36650653-36650675 GGCTCTGCACAGCCCCCAGAAGG - Intergenic
1147949351 17:44098333-44098355 GGCTCTTGGCCGCCTCCTGGTGG + Intronic
1148189079 17:45666390-45666412 GGGTCTTTACTGCACCCTGCTGG + Intergenic
1149007307 17:51819510-51819532 AGCTCTTGGCAGAGCCCTGCAGG + Intronic
1150623980 17:66829707-66829729 GCATCTGGACAGCTCCCTGCAGG - Intergenic
1152438014 17:80288057-80288079 GGTTGGCGACAGCCCCCTGCAGG + Exonic
1152596296 17:81239337-81239359 GGCTATTCCCAGCCCCCTGGAGG - Exonic
1156846615 18:41673131-41673153 GGTTCTGGATAGCTCCCTGCAGG - Intergenic
1160166877 18:76521518-76521540 GGCTCTTGAAAGCCTCCTTGAGG - Intergenic
1160340811 18:78087347-78087369 GGCTCATGACAGCCCAGTTCAGG - Intergenic
1160901340 19:1430224-1430246 GGCTATGGACCGCCCCCTGCAGG + Exonic
1161304250 19:3557908-3557930 GGAGCTGGACAGCCCACTGCGGG + Intronic
1162145941 19:8611983-8612005 GGCTCTGGCCAGCTCCCTGGGGG - Intergenic
1163521643 19:17795276-17795298 GGCTCTGGAGAAGCCCCTGCCGG + Intronic
1163529066 19:17839092-17839114 TGCTCATTAAAGCCCCCTGCAGG - Intronic
1163692530 19:18745383-18745405 GTCTCTTGGCAGGCCCCTCCAGG + Intronic
1164559425 19:29278922-29278944 AGCTCTTGTCAGCCCGCTGCTGG - Intergenic
1167581387 19:50345120-50345142 GGCCCTTCACAGACACCTGCTGG - Intronic
1167776997 19:51564932-51564954 GGCTGTTTAGAGCCCCCTTCAGG + Intergenic
926064074 2:9823224-9823246 GGCTCTTGACACCCAACTACTGG - Intergenic
926103713 2:10137307-10137329 GGCACCTGCCAGCCCCATGCTGG + Intergenic
929079248 2:38106151-38106173 AGCTCCTCACAGCCGCCTGCGGG - Intronic
929943577 2:46353359-46353381 GGCCCTGGACGGGCCCCTGCTGG - Intronic
930023360 2:47014698-47014720 GGCTCACGTCAGCCCCCAGCAGG + Intronic
930073970 2:47391726-47391748 GGCTCCTTTCAGCCCACTGCTGG + Intergenic
931937600 2:67215428-67215450 GGCGCTTGGCTACCCCCTGCTGG + Intergenic
932567880 2:72920886-72920908 GGGTCTCTACAGCCCCCTCCAGG - Intronic
937330618 2:121026028-121026050 GGCTCTAGGCAGCCAGCTGCCGG - Intergenic
937411981 2:121684623-121684645 GGCTCTTGTCAGCTCCTTGAAGG + Intergenic
937976278 2:127583833-127583855 AGCTTCTCACAGCCCCCTGCCGG - Intronic
938000679 2:127733285-127733307 GACTCCTGTCAGTCCCCTGCAGG - Intronic
940346929 2:152637889-152637911 AGCTCTTGGCAGCCCCCTTGGGG + Intronic
948902624 2:240964098-240964120 GGCTCTAGAAAGGCCCCTGTGGG + Intronic
948953416 2:241270085-241270107 GGCTCATCACAGCTCCGTGCTGG - Intronic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171906134 20:30900590-30900612 GGCTCATGAAAGCCCCATGTGGG + Intergenic
1172624789 20:36340775-36340797 GGCTCCCGACAGCCCCCCGAGGG - Intronic
1174343059 20:49909974-49909996 AGCGCTTGACAGCCCCCTGTTGG + Intronic
1175901024 20:62359982-62360004 GGCTGCTGGCAGCCCGCTGCAGG + Intronic
1176218789 20:63960333-63960355 GGCTGTGTCCAGCCCCCTGCAGG - Intronic
1176218880 20:63960714-63960736 GGCTGTGTCCAGCCCCCTGCAGG - Intronic
1176218936 20:63960968-63960990 GGCTGTGTCCAGCCCCCTGCAGG - Intronic
1179437131 21:41369684-41369706 GGCTGCTGAGAGCGCCCTGCAGG - Intronic
1179718207 21:43300972-43300994 CGCTCAGGACAGGCCCCTGCTGG + Intergenic
1179995382 21:44971652-44971674 GGCTCTGGGCAGCCACGTGCTGG - Intronic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG + Intergenic
1181365191 22:22371099-22371121 GGCTTCAGACAGCCCCCTGGAGG + Intergenic
1181368375 22:22397464-22397486 GGCTTCAGACAGCCCCCTGGAGG + Intergenic
1183582340 22:38733440-38733462 GGATCCAGTCAGCCCCCTGCTGG - Exonic
950124802 3:10504707-10504729 GGCTCCTCCCTGCCCCCTGCAGG - Intronic
950361808 3:12454723-12454745 CCCTGGTGACAGCCCCCTGCAGG + Intergenic
950452505 3:13073199-13073221 GGCCCTCCACAGCCCGCTGCTGG - Intergenic
950702489 3:14759923-14759945 TGACCTGGACAGCCCCCTGCAGG + Exonic
951991457 3:28679862-28679884 GGCTCTTGACAGCTGACTGTTGG + Intergenic
954395293 3:50290263-50290285 GGCTCTCAAGAGCACCCTGCCGG + Exonic
954677824 3:52325377-52325399 GGCTCTGGGCAGCCTCCTGATGG - Intronic
954715255 3:52523720-52523742 TGCTCTGGCCAGCCCCCTCCTGG + Exonic
956164658 3:66387269-66387291 GGATCTAGACAGCCACATGCAGG + Intronic
957084852 3:75669536-75669558 GGCTCCCGAAAGCCCCCTGTGGG - Intergenic
960974487 3:123161371-123161393 AGCCCTTGACCGCCTCCTGCTGG - Exonic
961418898 3:126784067-126784089 AACTCTTGACAGCTGCCTGCAGG + Intronic
962001823 3:131305800-131305822 GGTTCTTGACAGCCCCACGCAGG + Intronic
968001330 3:195208859-195208881 TCCTCTTGCAAGCCCCCTGCTGG - Intronic
968911890 4:3480677-3480699 AGCTCTGGAGAGCCCCCTGCCGG + Intronic
969787975 4:9473842-9473864 GGCTCTTGGGAGCCCCATGTCGG + Intergenic
970146994 4:13046424-13046446 GGCTGCTGACTGCCCACTGCTGG + Intergenic
976771905 4:88662256-88662278 GGCTCCTGACAGATCCCAGCTGG - Intronic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985573696 5:664007-664029 GGCTCTGCTCAGCCCCCTGCTGG + Exonic
985619511 5:946787-946809 GGGTCTTTACAGCGCCATGCTGG + Intergenic
996888652 5:128389810-128389832 GGCACTTGGCAGCCCCATGAAGG + Intronic
997479855 5:134176878-134176900 GGCTCTCGTCAGCCTCCCGCCGG - Exonic
998261494 5:140635161-140635183 GGCTCATCACTGCCCCCTGCGGG + Intergenic
1002461866 5:179377910-179377932 GGCTGTTGCCAGACCCCAGCTGG + Intergenic
1002523351 5:179803276-179803298 GCCTCTGGACAGCCCCTGGCGGG + Intronic
1009012623 6:57861037-57861059 GGCTGGTGACAGCTCCCTCCTGG - Intergenic
1018941082 6:168309075-168309097 TGATCTTGACAGAGCCCTGCCGG - Exonic
1019032658 6:169025601-169025623 GGCTCTGCACAGCTCCCCGCTGG - Intergenic
1019175947 6:170159638-170159660 GGATCTGGGCAGCCCCTTGCTGG - Intergenic
1019752028 7:2736836-2736858 GCCCCTTCACAGACCCCTGCTGG + Intronic
1021880773 7:25093497-25093519 AGCTCTTGGGGGCCCCCTGCTGG + Intergenic
1023093528 7:36638313-36638335 GGCTGTTGACAGCCTCCTGCTGG - Intronic
1023907709 7:44533913-44533935 GGCACTTGCCAACTCCCTGCTGG - Intronic
1024088612 7:45917757-45917779 GGCTCAGGTCTGCCCCCTGCCGG - Intronic
1024263219 7:47587274-47587296 AGCTCTTGGCAGCCTCCTGTGGG - Intergenic
1024992892 7:55250394-55250416 GACTCAGGACAGCCCCCTGGAGG - Intronic
1025983073 7:66423917-66423939 AGCTCTCGTCAGCCTCCTGCTGG - Intergenic
1026971868 7:74473353-74473375 AGCTCTTGGCAGCCCCAGGCTGG - Intronic
1027554715 7:79648626-79648648 GGTGCTTGGCAGCCCCATGCAGG + Intergenic
1029280118 7:99430044-99430066 GGCACTTGTCAGCCCACTCCAGG + Intronic
1032495806 7:132361259-132361281 GCCTCTTCAAAGGCCCCTGCAGG + Intronic
1033726825 7:144127897-144127919 GGCCCTTGGTCGCCCCCTGCTGG + Intergenic
1035757968 8:2048322-2048344 AGCTCTTCCCAGCACCCTGCTGG + Intronic
1036455718 8:8905385-8905407 GGCTCCTGACAGCCCACTACTGG - Intergenic
1039776130 8:40738605-40738627 GGCTATTGGCTGCCCCTTGCTGG - Intronic
1043819716 8:84847346-84847368 GGCACTTGGCATCCCCATGCAGG + Intronic
1045659530 8:104422819-104422841 GGCCCTGGGCAGGCCCCTGCTGG + Intronic
1049560257 8:143306800-143306822 GGGACGTGAGAGCCCCCTGCTGG + Intronic
1050312972 9:4371975-4371997 GGTTTTTGTCAGCCCCCTTCTGG + Intergenic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1057542739 9:95990580-95990602 GGCTCGTTTCAGCCCGCTGCTGG + Intronic
1057906777 9:98989482-98989504 TGCCCTTGACAGCCCTCTGATGG - Intronic
1059290706 9:113221484-113221506 GGAGCTTCACAGCCCCTTGCAGG + Intergenic
1059579145 9:115524646-115524668 GGCTCTTTACTGCTCCCTGGTGG + Intergenic
1060005733 9:119997892-119997914 GGCTCATGATAGCCCTCTTCTGG + Intergenic
1060539423 9:124419727-124419749 GGCTCTTGGTCGCCCTCTGCTGG - Intergenic
1061015892 9:127980690-127980712 AGCTCCTGGCAGCCCCCTGGGGG - Intergenic
1061701868 9:132422308-132422330 GGGCCTTGAAAGCCACCTGCTGG - Intronic
1061800183 9:133109396-133109418 GGCTCGGGGCAGCCCCCGGCGGG - Intronic
1062497846 9:136839981-136840003 TGCTCCTGGCAGCCCCCTGCAGG + Intronic
1062572423 9:137191812-137191834 GAATCTGCACAGCCCCCTGCCGG + Exonic
1062711023 9:137975287-137975309 GCCTCTTGGCAGCCTCGTGCTGG + Intronic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1188839382 X:34996898-34996920 GGCTCTTCACTGCTCCCTGATGG + Intergenic
1196031593 X:111099004-111099026 GGCCCTTTTCCGCCCCCTGCTGG - Intronic
1196921698 X:120591838-120591860 GGCTACTGCCAGACCCCTGCTGG - Intergenic
1198414045 X:136401861-136401883 GTCTCCTGACAGCCTCCTGGAGG + Intronic
1199782898 X:151079866-151079888 GGCTCTTGTCAGCTCCATTCAGG - Intergenic
1200292731 X:154887277-154887299 GGCTTTTGACAGCCACGGGCAGG + Exonic
1200339575 X:155383017-155383039 GGCTTTTGACAGCCACGGGCAGG + Exonic
1200346895 X:155457676-155457698 GGCTTTTGACAGCCACGGGCAGG - Exonic
1201175736 Y:11307522-11307544 GGCTCATGAAAGCCCCTTGTGGG - Intergenic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic