ID: 1105378149

View in Genome Browser
Species Human (GRCh38)
Location 13:19863488-19863510
Sequence CCAGCCACCCCCACTCTCAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 1, 2: 5, 3: 34, 4: 311}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105378141_1105378149 10 Left 1105378141 13:19863455-19863477 CCTCCGCCTCCTCCTCCGGAGGC 0: 2
1: 0
2: 11
3: 106
4: 1020
Right 1105378149 13:19863488-19863510 CCAGCCACCCCCACTCTCAGCGG 0: 1
1: 1
2: 5
3: 34
4: 311
1105378142_1105378149 7 Left 1105378142 13:19863458-19863480 CCGCCTCCTCCTCCGGAGGCTGC 0: 2
1: 1
2: 17
3: 122
4: 867
Right 1105378149 13:19863488-19863510 CCAGCCACCCCCACTCTCAGCGG 0: 1
1: 1
2: 5
3: 34
4: 311
1105378135_1105378149 25 Left 1105378135 13:19863440-19863462 CCCCACTCACCTCGGCCTCCGCC 0: 1
1: 0
2: 4
3: 59
4: 466
Right 1105378149 13:19863488-19863510 CCAGCCACCCCCACTCTCAGCGG 0: 1
1: 1
2: 5
3: 34
4: 311
1105378144_1105378149 1 Left 1105378144 13:19863464-19863486 CCTCCTCCGGAGGCTGCGCTGCT 0: 2
1: 0
2: 0
3: 23
4: 177
Right 1105378149 13:19863488-19863510 CCAGCCACCCCCACTCTCAGCGG 0: 1
1: 1
2: 5
3: 34
4: 311
1105378134_1105378149 28 Left 1105378134 13:19863437-19863459 CCTCCCCACTCACCTCGGCCTCC 0: 1
1: 2
2: 25
3: 203
4: 1080
Right 1105378149 13:19863488-19863510 CCAGCCACCCCCACTCTCAGCGG 0: 1
1: 1
2: 5
3: 34
4: 311
1105378146_1105378149 -5 Left 1105378146 13:19863470-19863492 CCGGAGGCTGCGCTGCTCCCAGC 0: 2
1: 0
2: 4
3: 52
4: 468
Right 1105378149 13:19863488-19863510 CCAGCCACCCCCACTCTCAGCGG 0: 1
1: 1
2: 5
3: 34
4: 311
1105378145_1105378149 -2 Left 1105378145 13:19863467-19863489 CCTCCGGAGGCTGCGCTGCTCCC 0: 2
1: 0
2: 3
3: 25
4: 213
Right 1105378149 13:19863488-19863510 CCAGCCACCCCCACTCTCAGCGG 0: 1
1: 1
2: 5
3: 34
4: 311
1105378143_1105378149 4 Left 1105378143 13:19863461-19863483 CCTCCTCCTCCGGAGGCTGCGCT 0: 2
1: 0
2: 2
3: 68
4: 2205
Right 1105378149 13:19863488-19863510 CCAGCCACCCCCACTCTCAGCGG 0: 1
1: 1
2: 5
3: 34
4: 311
1105378137_1105378149 23 Left 1105378137 13:19863442-19863464 CCACTCACCTCGGCCTCCGCCTC 0: 1
1: 0
2: 19
3: 429
4: 2961
Right 1105378149 13:19863488-19863510 CCAGCCACCCCCACTCTCAGCGG 0: 1
1: 1
2: 5
3: 34
4: 311
1105378136_1105378149 24 Left 1105378136 13:19863441-19863463 CCCACTCACCTCGGCCTCCGCCT 0: 1
1: 0
2: 4
3: 48
4: 538
Right 1105378149 13:19863488-19863510 CCAGCCACCCCCACTCTCAGCGG 0: 1
1: 1
2: 5
3: 34
4: 311
1105378138_1105378149 16 Left 1105378138 13:19863449-19863471 CCTCGGCCTCCGCCTCCTCCTCC 0: 1
1: 9
2: 245
3: 3409
4: 10867
Right 1105378149 13:19863488-19863510 CCAGCCACCCCCACTCTCAGCGG 0: 1
1: 1
2: 5
3: 34
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105378149 Original CRISPR CCAGCCACCCCCACTCTCAG CGG Exonic
900369352 1:2324509-2324531 CCAGCCTCGCCGTCTCTCAGGGG - Intronic
900572978 1:3368535-3368557 CCAGCCGCTCCCACCCTGAGGGG + Intronic
900907814 1:5573089-5573111 CCTGCCACCCCCACTTCCTGGGG + Intergenic
900922401 1:5681748-5681770 CCAGCCCCACCCACCCTCAAGGG + Intergenic
901026611 1:6281794-6281816 ACAGCCATTCCCACCCTCAGGGG + Intronic
901442381 1:9286256-9286278 CAAACCACCCCCAAACTCAGTGG - Intergenic
902206880 1:14874969-14874991 CCAGGGACCCCCACTTGCAGAGG - Intronic
902957367 1:19934694-19934716 CAAGCCACCCCCAAACACAGTGG + Intergenic
903779180 1:25810690-25810712 GAAGCCACCCCCACTCCTAGGGG - Intronic
904438157 1:30512716-30512738 CCAGCCACCCACACCCTCCCTGG + Intergenic
904715515 1:32465007-32465029 CCAGCCGCCCCGCCTCTCATCGG + Intergenic
905036621 1:34922922-34922944 CCATTCCCACCCACTCTCAGTGG + Intronic
905888391 1:41504131-41504153 CCAGCAACCCAGACACTCAGTGG - Intergenic
906931696 1:50176437-50176459 CCAGCCACACCCACATTCAGAGG - Intronic
907517005 1:54999135-54999157 ACAGCCACCCCCTCTCCCGGGGG + Exonic
911159740 1:94672340-94672362 CCAGGGACCCCCAGGCTCAGGGG + Intergenic
912439800 1:109689125-109689147 GCAGCCACCCACACTCACACAGG - Exonic
912443117 1:109713561-109713583 GCAGCCACCCACACTCACACAGG - Exonic
912997715 1:114547964-114547986 ACAGTCACCCCCACTCCCAGAGG + Intergenic
913216946 1:116628572-116628594 CCTGCCACCCACACTCTTGGTGG - Intronic
913717930 1:121557368-121557390 ACATCAACCCACACTCTCAGAGG - Intergenic
915153598 1:153855795-153855817 CCAGCTACTCCCAGTCCCAGAGG - Intronic
915283696 1:154839614-154839636 CCAGCAACCCTCACTCACTGTGG - Intronic
915446529 1:155977755-155977777 CCAGCCACCCGCCCACCCAGAGG + Intronic
915569093 1:156734261-156734283 CCAGCCACCCACTGACTCAGTGG - Exonic
915650424 1:157306609-157306631 CCAGCAGCCGCCCCTCTCAGGGG + Intergenic
916240360 1:162633140-162633162 CTAGCCACCCCAAATCTCAGGGG - Intronic
916868702 1:168888443-168888465 CCAGGTACTCCCACTCTTAGGGG + Intergenic
917826899 1:178831624-178831646 CCCGCCCCCCCCACCCCCAGCGG + Intronic
919972766 1:202591574-202591596 CCTGCCCACCCCACTCTCAGGGG + Exonic
919975158 1:202605662-202605684 CCCAGCACCCCCACTCTCAGTGG + Exonic
919977408 1:202621712-202621734 CCTGCCCCCCTCACCCTCAGAGG + Intronic
920633455 1:207676026-207676048 CCATCCACCTTCACACTCAGTGG - Intronic
922499080 1:226083620-226083642 CCAGCCACCCGCGCTCTCCCAGG + Intergenic
922617853 1:226973670-226973692 CCAGCTGCCCCCAGCCTCAGGGG - Intronic
922788256 1:228294394-228294416 TCAGCCACACTCACTGTCAGGGG + Exonic
1062954922 10:1533814-1533836 CCACCCTCCCCCTCTGTCAGCGG + Intronic
1063086502 10:2822985-2823007 ACAGCCCCCCCAAATCTCAGTGG + Intergenic
1064326211 10:14353902-14353924 CCAGCCATCTCCACTCTCCTGGG + Intronic
1064464355 10:15564376-15564398 CCAGCGTCCTCCACCCTCAGTGG - Intronic
1065856026 10:29830970-29830992 CCAGTCACCAGCACACTCAGGGG + Intergenic
1067480141 10:46589652-46589674 CCAGCCACCCCCACATTCCAAGG + Intronic
1067511104 10:46895725-46895747 CCATTCACTCCCACTCTCTGGGG - Intergenic
1067614597 10:47752147-47752169 CCAGCCACCCCCACATTCCAAGG - Intergenic
1067651149 10:48156137-48156159 CCATTCACTCCCACTCTCTGGGG + Intergenic
1067777239 10:49172508-49172530 CCAGCCAACCCTACTCACTGGGG + Intronic
1068936426 10:62639700-62639722 CCAGCCTCCCCCACTGTCATGGG + Intronic
1069770579 10:70896764-70896786 CAAGTAACCCCCAATCTCAGTGG + Intergenic
1069830752 10:71280872-71280894 CCAGCCTACCCCAGACTCAGGGG + Intronic
1070378600 10:75858545-75858567 CCAGCCTCTCCCACTCTCAATGG - Intronic
1072718286 10:97765784-97765806 GAAGCCACCCCCACTCTAATGGG - Intergenic
1073146751 10:101286143-101286165 CCCCCCACCCCCACCCCCAGCGG - Intergenic
1073309277 10:102528147-102528169 CCAACCACCCCCAAACTCAAAGG - Intronic
1074537155 10:114336686-114336708 ACTCCCACCCCCACCCTCAGAGG - Intronic
1074917124 10:117968456-117968478 CCAGCCACAGCCCCTGTCAGAGG - Intergenic
1075059011 10:119241644-119241666 CCAGCCACCCCGACTGTCTCAGG - Intronic
1075644777 10:124090379-124090401 CCAGCCCCCTCCACTAGCAGGGG + Intronic
1076638814 10:131900704-131900726 CCGGCCGCCCCTACTCTCCGGGG - Exonic
1077365058 11:2158297-2158319 CCAGCCGGCCCCACTCGCACGGG - Intronic
1077395464 11:2318548-2318570 CCTGCCACACCCACTCTTACTGG + Intergenic
1077418350 11:2436445-2436467 ACAGCCACCACCACTCTCCAGGG + Intergenic
1078067394 11:8087369-8087391 CAAGCCACTCACACTTTCAGAGG - Intronic
1078268800 11:9775567-9775589 TCAGCCACCCCCAACCTCGGGGG + Intergenic
1078986357 11:16603518-16603540 CCTCCCACCCCCACTCCCAAAGG - Intronic
1079111282 11:17606542-17606564 CCAGCAACCTCCTCTCTCAATGG + Intronic
1079158962 11:17974916-17974938 CCAGCCAGCCCCAGAGTCAGTGG - Intronic
1079510523 11:21205210-21205232 ACAGCCACCCCTTCTCCCAGGGG + Intronic
1080644019 11:34174970-34174992 CCAGCCACCCCAACTCCCTCGGG + Intronic
1081406391 11:42703530-42703552 CATGCCACCACCACTCTCTGAGG + Intergenic
1083173630 11:60936606-60936628 CCCTCCTCCCCCACTCTCACAGG - Exonic
1084272057 11:68034247-68034269 CCAGCCAGCCCCTCCCCCAGCGG + Intronic
1084460655 11:69294913-69294935 CCAGCCACCGTCACACACAGAGG + Intronic
1084612144 11:70210063-70210085 GCCGCCACCCCCACTCCCAGTGG + Intergenic
1085400042 11:76230460-76230482 CCAGCCTCCCCTGCTCTCTGGGG + Intergenic
1088317301 11:108520295-108520317 CCATCCACCACCACTTTCTGTGG + Intronic
1088882945 11:113986085-113986107 CCAGCAACTCCCACTCTCCCTGG - Exonic
1090571268 11:128049174-128049196 CCTGCCACCCCGTCTCTTAGAGG - Intergenic
1092503842 12:9074637-9074659 CCAGCCAGCCCCAACCTCGGAGG - Exonic
1092510854 12:9154693-9154715 CCAGCCAGCCCCCACCTCAGGGG - Exonic
1093110410 12:15145168-15145190 CCAAACAACCCCATTCTCAGAGG + Intronic
1095247821 12:39943352-39943374 ACAGCCACCCCTTCTCCCAGGGG + Intronic
1096148070 12:49293082-49293104 CCAGCAGCCTCTACTCTCAGAGG + Intergenic
1096408370 12:51359851-51359873 CCAGTCACCCCAACTCCCAGCGG - Intronic
1096869405 12:54583941-54583963 GCTGCCACCCCCACCCCCAGAGG - Intronic
1098426123 12:70366716-70366738 CCATCGCCCCCCACTCTCGGCGG - Exonic
1100277031 12:93080817-93080839 CCAGTCTCCACCACCCTCAGTGG - Intergenic
1100601799 12:96117953-96117975 CCAGCCACCCCCAAACTCATGGG + Intergenic
1102010102 12:109612928-109612950 ACAGGGACCCCCAGTCTCAGTGG - Intergenic
1102585265 12:113918557-113918579 CCAGCTAGCCCCACTCCCCGGGG - Intronic
1102596135 12:113993878-113993900 CCAGTCCCCTCCACTCTCAGGGG + Intergenic
1103798801 12:123523698-123523720 CCACCCACTCCGACCCTCAGGGG + Intronic
1104874728 12:132026118-132026140 CCACACACTCCCACTCCCAGGGG - Intronic
1105378149 13:19863488-19863510 CCAGCCACCCCCACTCTCAGCGG + Exonic
1105389105 13:19958877-19958899 CCAGCCACCCCCACTCTCGGCGG - Intronic
1105639578 13:22248289-22248311 ACAGACAGCCCCACTCTCAAAGG - Intergenic
1105874136 13:24538675-24538697 CAAGACATCCCCAGTCTCAGTGG + Intergenic
1105947020 13:25198791-25198813 CCAACAACCCCAAATCTCAGTGG + Intergenic
1107398779 13:40048149-40048171 TCAGCCATCCCCATTCTCAAGGG - Intergenic
1107400211 13:40062131-40062153 ACAGCCTCCCCCACCCTCACGGG + Intergenic
1107432871 13:40355565-40355587 CCAGTCACCCACACTCTCTCAGG + Intergenic
1107699928 13:43036975-43036997 CCGCCCAACCGCACTCTCAGGGG - Intronic
1107880274 13:44826596-44826618 AGAGCAATCCCCACTCTCAGAGG + Intergenic
1112320932 13:98406892-98406914 ACAGCCACCTCCACTCTCAAAGG - Intronic
1112494341 13:99893682-99893704 CCAGCCAGCCCCACACAGAGGGG + Exonic
1112842719 13:103600211-103600233 TGAGCCTCCCCCACTCTCCGTGG + Intergenic
1114183677 14:20384483-20384505 CCACACCCCCCCACTCACAGGGG + Exonic
1114639975 14:24213177-24213199 CCGTCCTCCCCCACTCTCAGAGG - Intronic
1115383697 14:32770579-32770601 CCAGGCACTCCCACTGCCAGAGG + Intronic
1117760365 14:59020942-59020964 CAAGCCACCCCCACTGGAAGTGG - Intergenic
1118371876 14:65144417-65144439 CCGGCCACCCCAACCCACAGTGG + Intergenic
1120912599 14:89681179-89681201 CCAGCCACGCTCCCTCTCAGGGG - Intergenic
1121010564 14:90517770-90517792 CCTGCCACCCGCTCTCTCAAAGG + Intergenic
1121104743 14:91272867-91272889 CAAGGCGCCCCCACGCTCAGGGG - Exonic
1122319160 14:100843378-100843400 CCAGCCACGCACAGTCTCGGAGG + Intergenic
1122610981 14:102983294-102983316 ACCCCCACCCCCACTCTCAGGGG - Intronic
1122736741 14:103847714-103847736 CCCGCTACCCTCGCTCTCAGCGG + Intergenic
1122971069 14:105152450-105152472 CCGGCCAGCCCCACTGTCACGGG + Intronic
1123133485 14:106007012-106007034 CCAGCCAGCCCCACTCCCAGAGG + Intergenic
1123135870 14:106026985-106027007 CCAGCCAGCCCCACTCCCAGAGG + Intergenic
1123165228 14:106319690-106319712 CCAGCCAGCCCCACTCCCAGAGG + Intergenic
1123583506 15:21737458-21737480 CCAGCCAGCCCCACTCCCAGAGG + Intergenic
1123620156 15:22180061-22180083 CCAGCCAGCCCCACTCCCAGAGG + Intergenic
1124493067 15:30170085-30170107 CCTGCCCCCCTCACCCTCAGAGG + Intergenic
1124750467 15:32368240-32368262 CCTGCCCCCCTCACCCTCAGAGG - Intergenic
1124845335 15:33284469-33284491 CAAACCACTCCCACACTCAGTGG + Intergenic
1127326204 15:57897371-57897393 CCAGCCACCCCCAAATTCTGTGG - Intergenic
1127675913 15:61238921-61238943 CAAACCACCCCCAAACTCAGTGG + Intergenic
1127866713 15:63039456-63039478 CAAACAACCCCCAATCTCAGTGG + Intergenic
1127974900 15:63990064-63990086 CCACCCACCCTCACCCTCTGTGG + Intronic
1128692408 15:69735081-69735103 CCCCCCACCCCATCTCTCAGTGG + Intergenic
1128729489 15:70011110-70011132 CAAGCCATCCAAACTCTCAGAGG + Intergenic
1129661229 15:77554205-77554227 CCAGCCACCTCCACTCAGGGGGG + Intergenic
1129892034 15:79077892-79077914 CCACCCACCCCTTCTCTCAGAGG - Intronic
1131153163 15:90059521-90059543 CCAGCCACTCTGACTCCCAGAGG + Intronic
1131341263 15:91603640-91603662 CAAACCACCCCCAAACTCAGAGG + Intergenic
1132834741 16:1947096-1947118 CCAGCCCCTCTCACTCACAGGGG - Exonic
1133137327 16:3720995-3721017 CCACCCACCCCCATTCCCTGAGG - Intergenic
1134193502 16:12140415-12140437 CCAGCCACCCCCAGCTCCAGGGG - Intronic
1135066399 16:19313910-19313932 CAAGCCACCCCAAAACTCAGTGG + Intronic
1135465272 16:22679591-22679613 CCCACCACCCCCAGCCTCAGTGG - Intergenic
1138443240 16:57047442-57047464 CCAGCATCCCTCACTCTAAGTGG - Intronic
1138443373 16:57047996-57048018 CAAGGCACCCCCACTCTCCTTGG + Intronic
1138898610 16:61241049-61241071 CCAGAGCCCCTCACTCTCAGAGG + Intergenic
1139640750 16:68289747-68289769 TGAGCCACCCCCACCCTCCGGGG - Intronic
1139922528 16:70469032-70469054 CCAGCCACTTCCCCTCTCTGGGG + Intronic
1141192208 16:81833050-81833072 CAAGACACCCCCTCTCTGAGAGG - Intronic
1141643022 16:85352472-85352494 TCAGCATCCCCCACTCCCAGGGG - Intergenic
1142006446 16:87691596-87691618 CCTGCCAGCCCCACCCCCAGAGG + Intronic
1142698428 17:1645825-1645847 CCAGCCACCCCCTCCCTCTCAGG - Intergenic
1143004385 17:3818937-3818959 CCAGGCACACACACTCCCAGTGG + Intronic
1143697446 17:8630775-8630797 CCACCCACCCCTACCCTCATTGG + Intergenic
1144444024 17:15309735-15309757 CCACCCACCCAGTCTCTCAGTGG + Intronic
1145122028 17:20268862-20268884 GCTCCCACTCCCACTCTCAGTGG + Intronic
1148147912 17:45377579-45377601 CCAGCCACTCCCCCTCACTGGGG + Intergenic
1148493348 17:48037425-48037447 CCCGCCACCCCCACTCCAAACGG + Intronic
1148691296 17:49528447-49528469 CCAGCCCCCTCCACGCACAGGGG + Intergenic
1148839523 17:50485823-50485845 CCACCCACCTTCACTCTCAAAGG - Exonic
1149991885 17:61388012-61388034 CCAGCCACCTCCCCCCTTAGAGG - Intronic
1151529153 17:74693318-74693340 CCATCCACCCTCCCTCTCAAAGG - Intronic
1151754549 17:76065965-76065987 CCAGCCACGCCCATTCACATAGG - Intronic
1151956664 17:77383541-77383563 TCAGCCATCCCCACTCTCCAAGG - Intronic
1152543362 17:80988252-80988274 TCAGCCACCACCACTCCCACTGG - Intergenic
1152697024 17:81802692-81802714 CCAGCCATTCCCCCTCCCAGGGG - Intergenic
1152838851 17:82553411-82553433 CCAGGCAGTCCCACTCTGAGAGG - Intronic
1154161595 18:11984306-11984328 CCAGCCACCCACACTGTGACGGG + Intronic
1154298870 18:13175338-13175360 TCAGCCACCCACACTCCCACAGG + Intergenic
1155105036 18:22655611-22655633 CAAACCTCCCCCACTCTTAGAGG - Intergenic
1156454942 18:37287577-37287599 CCAGCCAGCCCTGCTCTGAGTGG + Intronic
1157200503 18:45655191-45655213 CCAGACACATCCACTGTCAGTGG - Intronic
1157374460 18:47150426-47150448 CCAGCCACCCGCACTGGCCGCGG + Exonic
1157484380 18:48076574-48076596 CCACTCACCCACAATCTCAGTGG - Intronic
1160963291 19:1734296-1734318 CCATCCTCCCCCACTCTGCGGGG - Intergenic
1161027743 19:2044434-2044456 CCTGCCACCTTCACTCACAGAGG + Intronic
1161154154 19:2723495-2723517 CCACCCACCCCCACTCACAAAGG - Intronic
1161532593 19:4799045-4799067 CCACCCCACCCCAGTCTCAGAGG - Exonic
1161590397 19:5126805-5126827 CCAACCAGCCCCGGTCTCAGGGG - Intronic
1161701929 19:5800486-5800508 CCAGCCACCTCCACCCCCACAGG + Intergenic
1162317532 19:9948989-9949011 ACAGCCATTCCCACACTCAGAGG + Intergenic
1162948989 19:14059445-14059467 CTTGCCACCCCCGATCTCAGAGG + Intergenic
1163009157 19:14413846-14413868 CCAGCTTCTCCCACTCTCTGTGG + Intronic
1164042461 19:21505797-21505819 CCAGCCCCTCCCCCTCTCTGGGG - Intronic
1164442783 19:28292001-28292023 CCATCCATCCTAACTCTCAGAGG + Intergenic
1164719084 19:30418648-30418670 CCGGCCAACCCCACCTTCAGAGG - Intronic
1168288918 19:55347641-55347663 TGAGCCACCCCCACTCCCACAGG + Exonic
925160470 2:1680383-1680405 CCAGCCACCCCATGTCTCACCGG - Intronic
925280587 2:2681959-2681981 CCAGTGACTCCCACTCTCACTGG - Intergenic
926177963 2:10613916-10613938 CTAGCAACCCACACTCTAAGAGG + Intronic
926220918 2:10934939-10934961 CCAGCCAGCCCTGCCCTCAGGGG - Intergenic
926680089 2:15656351-15656373 CCAACCAACCCCACAGTCAGAGG - Intergenic
928076270 2:28267519-28267541 CAAGCAACCCCCAGTCTCTGTGG + Intronic
928107172 2:28478019-28478041 CCAGCCACTCCCTCTCACACAGG + Intronic
929293984 2:40225704-40225726 TCAGCCACCCCAACTCCCACTGG - Intronic
930222646 2:48760840-48760862 CCAGCCACCCACACCATCCGTGG - Intronic
930747263 2:54897600-54897622 CCAGCCACCCCATAGCTCAGGGG - Intronic
931165677 2:59745011-59745033 TCACCCACCCCCACCATCAGAGG + Intergenic
931436264 2:62249786-62249808 CCAACCAACCTCATTCTCAGAGG - Intergenic
932336841 2:70936371-70936393 ACAGCACACCCCACTCTCAGGGG - Intronic
932709022 2:74048285-74048307 CCACTCACACCCACCCTCAGTGG + Exonic
932960396 2:76406548-76406570 CCAGACACCAGCACCCTCAGTGG + Intergenic
935349970 2:102144228-102144250 CCAGCAAACCCCATTCTCAAAGG - Intronic
935561801 2:104567538-104567560 GCAGCAGCACCCACTCTCAGGGG - Intergenic
936261035 2:110959690-110959712 CCAGCATCCCTCATTCTCAGGGG - Intronic
937698702 2:124839111-124839133 CCAACCCAGCCCACTCTCAGAGG - Intronic
937980032 2:127609355-127609377 CCACCCATCCCCACATTCAGTGG - Intronic
938938300 2:136146858-136146880 CCCTACACCCCCACTCTAAGAGG - Intergenic
942136427 2:172930636-172930658 CCAGCCACCCCCACTCAATTGGG + Intronic
942468700 2:176236874-176236896 CCAGTCAGTCTCACTCTCAGTGG - Intergenic
944727871 2:202489891-202489913 CAAGCCACCCCTAAGCTCAGTGG + Intronic
946038357 2:216762767-216762789 CCAACCACCCCGACCCTCACAGG - Intergenic
948162118 2:235833485-235833507 CCACCCACCCCCACTCTCCAAGG + Intronic
948263596 2:236621966-236621988 CCAGCCACCCGCAGTCTCATAGG - Intergenic
948567135 2:238894393-238894415 CTTGCCACCCCCACACTCAGCGG + Intronic
1169029771 20:2398165-2398187 CCAACCACCCCAAAACTCAGTGG + Intronic
1169209623 20:3758882-3758904 CCCCCCACGCTCACTCTCAGGGG - Intronic
1169854120 20:10084850-10084872 CAAACCACCCCAAATCTCAGTGG - Intergenic
1170775615 20:19372408-19372430 TCAGCCACACCCACTTTCTGAGG + Intronic
1170832157 20:19851844-19851866 CAAGGCACCCCCAAACTCAGAGG + Intergenic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1171232787 20:23500738-23500760 CCAGCCACCCCACCACACAGAGG - Intergenic
1171314674 20:24178942-24178964 CCAGCAAGCACTACTCTCAGGGG + Intergenic
1172442710 20:34977440-34977462 CCAGCCTCCCTGTCTCTCAGTGG + Intronic
1173009202 20:39166149-39166171 CCAGCCACTCCATCTCTCAGTGG - Intergenic
1173839005 20:46144818-46144840 CCAGCCACACCCACCTTCTGAGG - Intergenic
1174340219 20:49890802-49890824 CCAGCCACCCCTCTTCACAGTGG + Exonic
1175408252 20:58749251-58749273 CCAGCCACCCACACCCTTTGAGG - Intergenic
1175510195 20:59518864-59518886 CTAGCCTCCCGCATTCTCAGTGG + Intergenic
1175613532 20:60372681-60372703 CCAGTCACACCCACTTTCAAGGG - Intergenic
1176284349 21:5011620-5011642 ACAGCCACCACCAGCCTCAGGGG - Intergenic
1177182358 21:17757676-17757698 TGAGCCTCCCCCTCTCTCAGTGG - Intergenic
1178492383 21:33060972-33060994 CCATCCACCCCCTCTCCCAGGGG + Intergenic
1179367047 21:40768322-40768344 CCCCCCACCCCCACCCTGAGGGG + Intronic
1179612704 21:42562907-42562929 TCAGCCTCCCCCATTCTCAAAGG - Intronic
1179872832 21:44251855-44251877 ACAGCCACCACCAGCCTCAGGGG + Intronic
1179890979 21:44334968-44334990 CCTGCAATACCCACTCTCAGAGG + Intronic
1179942649 21:44649785-44649807 CCAGCCACGCGGATTCTCAGTGG + Intronic
1180008176 21:45032931-45032953 AGAGCCACCCCCAGTCTCAGTGG - Intergenic
1180818297 22:18806955-18806977 CCTGCCACCCACACTCTTGGTGG - Intergenic
1181059955 22:20277515-20277537 CCAGCCCCCCACACACTCGGGGG - Intronic
1181204520 22:21241410-21241432 CCTGCCACCCACACTCTTGGTGG - Intergenic
1181395592 22:22618931-22618953 TCAGCCACCCTCAGTGTCAGTGG + Intergenic
1181402761 22:22661312-22661334 ACAGCCACCCTCAGTGTCAGTGG + Intergenic
1181494395 22:23279866-23279888 CCAGCCTCCACCACTGTGAGAGG - Intronic
1182297651 22:29319025-29319047 CCAGCCCTCCCCACTATCTGTGG - Intronic
1184454394 22:44600938-44600960 CCGGCCACCTCCTCTCTCTGGGG + Intergenic
1184660725 22:45964417-45964439 CCAGCCCCCCCCAGGCTGAGGGG + Intronic
1184943963 22:47787948-47787970 CCAGCCTCCCCGCCTCTCAAAGG - Intergenic
1185152142 22:49169994-49170016 GCAACCATCCCCAATCTCAGTGG + Intergenic
1203222405 22_KI270731v1_random:54005-54027 CCTGCCACCCACACTCTTGGTGG + Intergenic
1203268425 22_KI270734v1_random:32809-32831 CCTGCCACCCACACTCTTGGTGG - Intergenic
950683955 3:14603110-14603132 CCCGGCACCCCCACCCTCGGCGG - Intergenic
950918672 3:16670522-16670544 CCAGCCCCCTCCATTCCCAGAGG - Intergenic
952679393 3:36073919-36073941 GCAGCCACCCCTCCACTCAGGGG + Intergenic
953611410 3:44450513-44450535 CCAGCCACCCCCACTCGTCCTGG + Exonic
954302244 3:49706190-49706212 GCTGCCAGCCCCACTCTCACTGG - Intronic
954441709 3:50525720-50525742 GCCCCCACCACCACTCTCAGGGG - Intergenic
954512061 3:51133927-51133949 CCTCCCACCCTCACCCTCAGTGG + Intronic
954797180 3:53167443-53167465 CCAGCCATCACCTCTCTCAAGGG - Intronic
954874053 3:53789580-53789602 CAGGCCACGCCCACTCTCAGGGG - Intronic
956224077 3:66936322-66936344 TCAGCCAGCCCCATTCTCAGAGG - Intergenic
956713314 3:72057254-72057276 CCAGCTACCCCAACCCACAGTGG - Intergenic
961505785 3:127369856-127369878 CCACCCAGCCCCACCCTCACTGG + Intergenic
961569175 3:127785949-127785971 CCAGCCACTCAGACACTCAGGGG - Intronic
962279645 3:134040175-134040197 CCTGGCACCCCCACTGTGAGAGG + Intronic
964576650 3:158177636-158177658 CCAGCCCCCCACACTCTGACAGG - Intronic
967313264 3:188126625-188126647 ACAGCAAGCCCCATTCTCAGTGG + Intergenic
968502095 4:955577-955599 CCAGCCACCACCACGCACACGGG - Intronic
968603061 4:1519500-1519522 CCAGCCGCCCCCAGGCCCAGTGG - Intergenic
969409436 4:7018438-7018460 CCAGCTCCACCCACTCTCTGAGG + Intronic
970124798 4:12797336-12797358 CCAGTCACACACACTTTCAGTGG - Intergenic
972418724 4:38867660-38867682 CCGGCCACCCCCACGCTGCGAGG - Intronic
973213594 4:47643814-47643836 CCAGCCATCCCCACTTCCAAAGG + Intronic
974296126 4:60000601-60000623 CCTACCCCCACCACTCTCAGGGG - Intergenic
975240297 4:72049957-72049979 CCAGTGACCCCCACCCTTAGGGG - Intronic
978402736 4:108348261-108348283 CCAGCAATCCCCACTCACATGGG - Intergenic
982137463 4:152285286-152285308 CCAACCACCCCGTGTCTCAGTGG - Intergenic
982177241 4:152717574-152717596 ACAGCTTCCCCCACCCTCAGTGG + Intronic
984097675 4:175451826-175451848 TCATCCACCCCAACTGTCAGAGG - Intergenic
985004203 4:185516739-185516761 CCACCCACCCCAAATCTCAGGGG + Intronic
985524757 5:396230-396252 CCTGGCACCCCCATCCTCAGGGG + Intronic
985625526 5:983273-983295 CCAGCCAGCTCCCCTCCCAGAGG - Intergenic
985929245 5:3043291-3043313 CTCCCCACCCCCACTCTCTGGGG - Intergenic
989750207 5:44884016-44884038 CCCGCCCCCCCCACCCCCAGTGG - Intergenic
989960640 5:50410506-50410528 ACATCAACCCACACTCTCAGAGG + Intronic
990278436 5:54224671-54224693 CCCACCACTCCCACTCTCAAGGG - Intronic
991676474 5:69093968-69093990 CCAGCAACCCTCACTCCCGGGGG - Exonic
993766186 5:91861728-91861750 ACATCAACCCCAACTCTCAGTGG - Intergenic
993991132 5:94660273-94660295 GCAGCCACGCCCACCGTCAGGGG - Intronic
997234226 5:132263501-132263523 CCCCCCACCCCCACCCCCAGTGG - Intronic
997439109 5:133896740-133896762 CCACCACCACCCACTCTCAGAGG + Intergenic
997884428 5:137617223-137617245 CCACCAACCCTGACTCTCAGTGG + Intergenic
998136670 5:139677697-139677719 CCACCCACCCCCAGCCTCTGAGG - Intronic
998211494 5:140202472-140202494 CAAACCACCCCCAATCTTAGAGG + Intronic
998403689 5:141861982-141862004 CCCTGCACCCCCACTCTTAGGGG - Intronic
998583310 5:143403081-143403103 CCCCCCACCCCCACTCCCCGAGG + Intronic
1001932911 5:175685932-175685954 GCTGCCACCCCCATTCCCAGGGG + Exonic
1002845133 6:938868-938890 CCAGCCAAGCCCACACACAGGGG + Intergenic
1003442719 6:6158663-6158685 CCAGCCTCCTGCACTCTCTGTGG - Intronic
1004821658 6:19374199-19374221 TCAGCCAACACCACTATCAGAGG + Intergenic
1006066257 6:31464497-31464519 TCAGCCAGCACCACTCTCTGGGG - Intergenic
1006388931 6:33747423-33747445 CCAAGCACCCCCAGTGTCAGGGG + Intergenic
1012764653 6:103351260-103351282 CCAGCCATAACCACTCTGAGTGG - Intergenic
1013403731 6:109823847-109823869 CCAACCACCCGCATTCTCACAGG + Intronic
1017629591 6:156383461-156383483 CCAGCCCCACCCACTTTCTGTGG - Intergenic
1018312764 6:162527927-162527949 CCTTCCACCACCAATCTCAGAGG + Intronic
1019488893 7:1301919-1301941 CCATCCACCCCCACACACGGAGG + Intergenic
1022306052 7:29147393-29147415 CCAGCCAACCCGACAGTCAGGGG + Intronic
1022488799 7:30800833-30800855 CCAGGCATCCCCAGTGTCAGAGG - Intronic
1022501895 7:30887130-30887152 TCAGCTACCCCCACTCCCTGCGG + Intronic
1026500646 7:70940620-70940642 CCAGCCACCCCAAAACTTAGTGG + Intergenic
1029493373 7:100884275-100884297 CCAGACACCCCCACCCCCATGGG - Intronic
1032385695 7:131521792-131521814 CCAGCCAGCCCCACCCGCAAGGG - Intronic
1035230918 7:157464985-157465007 CCAGACACCCCCACTCACACAGG - Intergenic
1035405895 7:158596966-158596988 CCAGCCAGCTCTGCTCTCAGCGG + Intergenic
1035988893 8:4465770-4465792 ATAACCACCCCCATTCTCAGAGG - Intronic
1036222625 8:6933511-6933533 CCAGCAACCCCCACAATCAGAGG - Intergenic
1036223612 8:6940680-6940702 CCAGCAACCCCCACAATCAGAGG - Intergenic
1037786134 8:21904326-21904348 CTGGCCACCCCCACTGTCACAGG + Intergenic
1039581379 8:38669609-38669631 GCAGGGACCCCCACTCTTAGTGG - Intergenic
1039603899 8:38865335-38865357 CCCGCCACCCCCATTCTGAATGG - Intergenic
1040424703 8:47273919-47273941 CCAGCCTCCTCCTTTCTCAGAGG + Intronic
1042688699 8:71471722-71471744 CTAGCCAACCCCAATATCAGGGG - Intronic
1042759562 8:72256633-72256655 CCAGCCACCACCGCTCTAATTGG - Intergenic
1043157256 8:76799210-76799232 CCAGTCACACCAAGTCTCAGTGG + Intronic
1045337993 8:101225337-101225359 CCAGCCTCCCCCACTGTCACAGG - Intergenic
1046654178 8:116874619-116874641 CCAGCCCGCCCAACTCCCAGCGG - Exonic
1046682480 8:117185524-117185546 GCAGCCTCTCCCACTCTGAGTGG - Intergenic
1049245488 8:141560161-141560183 CCAGCCACCAACACTGTCACAGG - Intergenic
1049297184 8:141848366-141848388 ACAACCACCCCCAATCTCAGAGG + Intergenic
1049453435 8:142675105-142675127 CCAGCCACCCCTGCTATGAGAGG - Intronic
1049462900 8:142738396-142738418 CCAGCCGCCCCCACCCCCGGAGG + Intergenic
1049641331 8:143717350-143717372 CCATCCACCCCCAATCCCATTGG - Intronic
1049711353 8:144064760-144064782 AGAGCCACCCTCACCCTCAGTGG + Intergenic
1051227079 9:14910541-14910563 ACAGACACACCCACTCACAGAGG + Intronic
1052955955 9:34253497-34253519 CCAGCCACCCTGCCTCTCAGGGG - Exonic
1053131640 9:35618782-35618804 CCAGGAACCCCCAGTCTCATGGG - Intronic
1057943080 9:99301898-99301920 CCCTCTACCCCCACTGTCAGAGG + Intergenic
1059321570 9:113474526-113474548 CCAGGCACGCCCTCTCTCTGTGG - Intronic
1059378643 9:113906468-113906490 CCAGCCACCCCCACTTGCTAAGG - Intronic
1059774839 9:117464679-117464701 ACTTCCACCCCCATTCTCAGGGG + Intergenic
1060787969 9:126465386-126465408 CCTGCCACCCCCAACCCCAGGGG - Intronic
1060938335 9:127528691-127528713 CCTACCACCCCCACACACAGTGG + Intronic
1061015339 9:127978081-127978103 CCAGCCACCCCCACCACAAGGGG + Intronic
1061203690 9:129151116-129151138 GCAGCCAGCCCCACACTCAGAGG - Intergenic
1061220281 9:129246612-129246634 CCCCCCACCCCCACCCTTAGAGG + Intergenic
1061495857 9:130973833-130973855 CCAGCCACCACCGCCCACAGGGG - Intergenic
1186641015 X:11455656-11455678 CCATCTACCCCCACTATCCGTGG + Intronic
1187250833 X:17596710-17596732 CCAGCCACTCCAAGTCTCAGGGG + Intronic
1188818909 X:34749093-34749115 CCTCCCACCCCCACTATCTGTGG - Intergenic
1195018452 X:100801114-100801136 CCAGCCTGCCCAACTCCCAGTGG + Intergenic
1197972308 X:132127953-132127975 CCAGGCATTCCCACTGTCAGCGG + Exonic
1199895295 X:152120713-152120735 CCACCCACCCCCACAGTGAGGGG - Intergenic
1199972772 X:152872942-152872964 CCAGCCACACACACACACAGGGG - Intergenic