ID: 1105379053

View in Genome Browser
Species Human (GRCh38)
Location 13:19869990-19870012
Sequence CTCATGAGAGACCCTGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 6, 2: 18, 3: 38, 4: 203}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105379053_1105379060 19 Left 1105379053 13:19869990-19870012 CCTGACTCAGGGTCTCTCATGAG 0: 1
1: 6
2: 18
3: 38
4: 203
Right 1105379060 13:19870032-19870054 CCAGGGCTGCAGTCGTATGAAGG 0: 1
1: 0
2: 33
3: 128
4: 340
1105379053_1105379062 29 Left 1105379053 13:19869990-19870012 CCTGACTCAGGGTCTCTCATGAG 0: 1
1: 6
2: 18
3: 38
4: 203
Right 1105379062 13:19870042-19870064 AGTCGTATGAAGGCCTGACAGGG 0: 1
1: 0
2: 1
3: 17
4: 202
1105379053_1105379063 30 Left 1105379053 13:19869990-19870012 CCTGACTCAGGGTCTCTCATGAG 0: 1
1: 6
2: 18
3: 38
4: 203
Right 1105379063 13:19870043-19870065 GTCGTATGAAGGCCTGACAGGGG 0: 1
1: 0
2: 0
3: 24
4: 420
1105379053_1105379055 -4 Left 1105379053 13:19869990-19870012 CCTGACTCAGGGTCTCTCATGAG 0: 1
1: 6
2: 18
3: 38
4: 203
Right 1105379055 13:19870009-19870031 TGAGGTTGCAGTCCACACGTAGG 0: 1
1: 0
2: 1
3: 23
4: 170
1105379053_1105379056 1 Left 1105379053 13:19869990-19870012 CCTGACTCAGGGTCTCTCATGAG 0: 1
1: 6
2: 18
3: 38
4: 203
Right 1105379056 13:19870014-19870036 TTGCAGTCCACACGTAGGCCAGG 0: 1
1: 0
2: 1
3: 5
4: 94
1105379053_1105379057 2 Left 1105379053 13:19869990-19870012 CCTGACTCAGGGTCTCTCATGAG 0: 1
1: 6
2: 18
3: 38
4: 203
Right 1105379057 13:19870015-19870037 TGCAGTCCACACGTAGGCCAGGG 0: 1
1: 0
2: 0
3: 10
4: 81
1105379053_1105379061 28 Left 1105379053 13:19869990-19870012 CCTGACTCAGGGTCTCTCATGAG 0: 1
1: 6
2: 18
3: 38
4: 203
Right 1105379061 13:19870041-19870063 CAGTCGTATGAAGGCCTGACAGG 0: 1
1: 0
2: 5
3: 115
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105379053 Original CRISPR CTCATGAGAGACCCTGAGTC AGG (reversed) Intergenic
900130769 1:1086239-1086261 CTCCTGAGAGAAGCTGAGGCCGG - Intronic
900406291 1:2494567-2494589 CACATGAGAGACGCTGAGGCAGG + Intronic
901736711 1:11317212-11317234 CTCAGGAGAGAGGCTGAGGCGGG - Intergenic
902663871 1:17923943-17923965 CTCAGGAGAGACCTGGAGGCTGG - Intergenic
903042281 1:20540364-20540386 CTCCTGAAAGACACTGAGCCAGG - Intergenic
903959978 1:27050856-27050878 TTTAAGAGAGACCCTGAATCAGG - Intergenic
905349622 1:37336276-37336298 CCTGTGAGAGACCCTGAGCCAGG - Intergenic
905771023 1:40638067-40638089 CCAATGTGAGACCCTGAGTCGGG + Intronic
907498200 1:54859287-54859309 AGCATGAGAGTCCCTGAGCCAGG + Intronic
907516134 1:54994585-54994607 ATCATGAAAGAGGCTGAGTCAGG + Intergenic
910725972 1:90339357-90339379 CTCACGAGAGACTCTGAACCAGG + Intergenic
911618047 1:100036857-100036879 TTCATGAGAGACCCAGAGGTAGG - Intergenic
911701589 1:100959417-100959439 CTTGTGAGAGATCCTGAGCCAGG - Intronic
912982760 1:114391885-114391907 CTCATGAGAAACCCTTGGGCTGG - Intergenic
913476836 1:119245893-119245915 CTGAGAAGAGACCCAGAGTCAGG - Intergenic
915034749 1:152912211-152912233 CTCCTGAGAGGAGCTGAGTCTGG - Intergenic
916053185 1:161050086-161050108 CTCATGAGAAGTCCTGAGGCAGG - Intronic
917353014 1:174097579-174097601 CAGTTGAGAGACCCTGAGGCAGG + Intergenic
917648066 1:177048284-177048306 CTCAGGAGAGTCCCTGAATCAGG - Intronic
920341310 1:205276692-205276714 CTCCTGGGAGGCCCTGTGTCTGG - Intergenic
920815073 1:209323641-209323663 ATCATGAAAGGCCCTCAGTCTGG - Intergenic
921075642 1:211698510-211698532 CTCACCACAGACCCTGAATCAGG - Intergenic
921445806 1:215245882-215245904 CACATGAAAGACCCTAAGCCAGG - Intergenic
923154576 1:231267052-231267074 CTAAAGAGAGAGCCTGTGTCAGG - Intronic
923319251 1:232814089-232814111 CTAATGATAGACTCTGATTCTGG - Intergenic
923607769 1:235460222-235460244 CTCATGAGGGAGGCTGAGACAGG - Intronic
924132648 1:240927964-240927986 CTCCTGATTAACCCTGAGTCTGG + Intronic
1063046394 10:2396978-2397000 CTTATCTGAGACCCTGAGTCAGG + Intergenic
1063569624 10:7203351-7203373 CACCTGAGAGATCCTAAGTCTGG - Intronic
1067685697 10:48465050-48465072 CTCCTGAGAGACCCTGATGAGGG - Intronic
1072325055 10:94289315-94289337 ATCAGGAGAGAAGCTGAGTCTGG - Intronic
1072328002 10:94317141-94317163 CTCATGAGGGAGGCTGAGTCAGG + Intronic
1073958778 10:108902320-108902342 ATCATGAGAGAGCCTGAGCCAGG - Intergenic
1075478539 10:122757906-122757928 CTCATGAAAGACCCTGAGCCAGG - Intergenic
1075932718 10:126313072-126313094 CTCATGAGAGACCCTCAGGCTGG - Intronic
1076732909 10:132447188-132447210 CCCATGGGAGCCCCTGAGCCCGG + Intronic
1077726791 11:4682840-4682862 CTTATGAAAGACCCTAAGTGGGG - Intronic
1082832667 11:57630627-57630649 CTCATGAGAGACCATGATCAGGG + Intergenic
1083335652 11:61920203-61920225 CTCCAGAGGGACCCTCAGTCTGG - Intronic
1084435771 11:69138467-69138489 CTCATGAGAGACCCAGAGCCAGG - Intergenic
1084514420 11:69628568-69628590 CCTGTGAGAGACCCTGAGCCAGG - Intergenic
1084659087 11:70536587-70536609 CTCATGGGAGACACTGAGTGTGG - Intronic
1085316570 11:75548660-75548682 CTCAAGAGAGACCCTGACCTGGG + Intergenic
1091037068 11:132243981-132244003 ATCATGAGAGCCCATGAGACGGG - Intronic
1091624877 12:2114168-2114190 CCCAGGAGAGACCCCAAGTCAGG - Intronic
1091940029 12:4471008-4471030 CTTATGAGAAACCATGAGCCAGG + Intergenic
1092625231 12:10319774-10319796 CTCATGAGAGACCCTGAGCTAGG + Intergenic
1092700769 12:11228402-11228424 TTCATGAGAGACCATAAGTCAGG - Intergenic
1093310997 12:17584622-17584644 TTCATGAGAGACTCCAAGTCCGG + Intergenic
1095898441 12:47303896-47303918 CTCATCAGAGACACCGTGTCTGG + Intergenic
1098984603 12:76998082-76998104 CTCATGAGGGAGGCTGAGGCAGG + Intergenic
1099014928 12:77332892-77332914 CTCTTGGGAGCCCCTGAGCCAGG + Intergenic
1101487934 12:105184726-105184748 CTCAAGTGAGTCCCTGACTCTGG - Intronic
1102470565 12:113157711-113157733 CCCCTGAGAGACCCTGAGATAGG + Exonic
1104904965 12:132208255-132208277 CTCTTGAGAGCCCCTGAGAGGGG - Intronic
1105379053 13:19869990-19870012 CTCATGAGAGACCCTGAGTCAGG - Intergenic
1108146445 13:47482505-47482527 CTCCTGAGAGTCCATGAGTCAGG + Intergenic
1108711334 13:53035360-53035382 TACATGAGATACCCTGAGACAGG + Intronic
1109038159 13:57293518-57293540 CTGATGAGAGAGCCTGAAGCAGG - Intergenic
1109810728 13:67509492-67509514 CTCATGAGAGACCCTCTGCTAGG + Intergenic
1109985129 13:69970842-69970864 CTCATGTGAGAGCCTGAGCCTGG - Intronic
1110647639 13:77906727-77906749 TTCTTGAGAGACCCTAAGCCAGG + Intronic
1110955536 13:81548318-81548340 CTTATGAGAGACACTGAATTAGG + Intergenic
1113007675 13:105725736-105725758 GTCAGGAGAGACCCAGAGACTGG + Intergenic
1113558340 13:111256395-111256417 CTCAGGACAGAACCTGAGTGTGG - Intronic
1113581886 13:111435779-111435801 CTCAGGAAAGAGCCTGAGTTTGG - Intergenic
1114456414 14:22857257-22857279 CTAATGAGAGATCCTAAGCCAGG + Intergenic
1114533773 14:23410667-23410689 CTCATGTTAGACCCTGAGCCGGG - Intergenic
1114783004 14:25560545-25560567 CTGATGAGATACCCTGAGCTGGG + Intergenic
1116905368 14:50398013-50398035 CTTGTGAGAGACCTTGAGCCAGG + Intronic
1122414125 14:101540724-101540746 CTCATGGGAGCCCCAGAGTGGGG - Intergenic
1122778761 14:104134873-104134895 CTCATCCAAGACCCTGAGCCTGG - Intergenic
1129415957 15:75380120-75380142 CTCATTAGAGACTCTGTGCCAGG - Intronic
1129782208 15:78279960-78279982 CTCATGGGAGAGCCTGCGGCAGG - Intronic
1133452353 16:5914346-5914368 CTCATGAGAGATCCTGCACCAGG - Intergenic
1133755211 16:8757562-8757584 CCCTTGAGAGATTCTGAGTCAGG + Intronic
1134210331 16:12271217-12271239 CTTAGGGGAGACCCTGAGCCAGG - Intronic
1135356966 16:21776976-21776998 CCCATGGGAGACCCTGAAGCAGG + Intergenic
1135455469 16:22593090-22593112 CCCATGGGAGACCCTGAAGCAGG + Intergenic
1137382497 16:48012301-48012323 CTGATGAAAGAGCCTGAGTGAGG + Intergenic
1138536444 16:57662858-57662880 CCCATGAGAGCCCCTGGGCCTGG - Intronic
1139307259 16:65997635-65997657 CACATGAGTGACACTGAGTGTGG - Intergenic
1141631623 16:85291172-85291194 CTGCTGAGAGACCCTGGGTGAGG - Intergenic
1142873161 17:2834400-2834422 CCCTTGAGAGACCTAGAGTCTGG + Intronic
1142888622 17:2928887-2928909 CTCCTGAGAGACCCAGGGGCTGG + Intronic
1142971749 17:3616492-3616514 CTCACGAGAGACCTTGAGCCAGG + Intronic
1143654459 17:8285758-8285780 CTCATGGGAGAACATGAGACAGG + Intergenic
1143975606 17:10827292-10827314 CTCATCACTGACCCTGACTCAGG + Intronic
1146915315 17:36674557-36674579 CTCAGGAGAGATCCTGAGTCAGG + Intergenic
1148159759 17:45443284-45443306 TGCATGAGGGACCCAGAGTCTGG - Intronic
1149575576 17:57709795-57709817 CTCATTAGTGACCCTCAATCTGG + Intergenic
1149687601 17:58545694-58545716 TTCAAGAGAGAACCGGAGTCCGG - Intergenic
1150200066 17:63345872-63345894 CTCATGAGCCAGCTTGAGTCAGG + Intronic
1150391045 17:64790156-64790178 TGCATGAGGGACCCAGAGTCTGG - Intergenic
1150409826 17:64934208-64934230 TGCATGAGGGACCCAGAGTCTGG - Intergenic
1151228587 17:72665280-72665302 CTCATGAGAGACCCTGAGCCAGG + Intronic
1151246008 17:72795212-72795234 CTCATGACAGACCCCGAGCCAGG - Intronic
1152315606 17:79578615-79578637 CTCAACAGAGACCCTTGGTCTGG + Intergenic
1152642336 17:81454465-81454487 CTCCTGAGAGGGCCTGAGCCCGG + Intronic
1152878922 17:82804375-82804397 CTCAGGAGAGACCCTGACCAGGG - Intronic
1152989080 18:346124-346146 CTCATGAAAAACAGTGAGTCAGG + Intronic
1153839869 18:8997043-8997065 CTCATGAGAAACCCTCAGCTAGG + Intergenic
1157403787 18:47407122-47407144 CTCATGAGAGACCCTGAGCCAGG + Intergenic
1157479791 18:48046059-48046081 CTCATGAAAGACACTGAACCAGG + Intronic
1157526788 18:48389415-48389437 CTAATGTGTGACCCAGAGTCAGG + Intronic
1157784005 18:50465792-50465814 TGCACGAGAGACCCTGAGTAAGG + Intergenic
1158579662 18:58671033-58671055 CACATGAAAGTCCCTGAGTCAGG + Intergenic
1158582308 18:58694746-58694768 CTCACGAGAGACCCTCAGCCAGG - Intronic
1159899660 18:74034110-74034132 CATATGAGAGACCCTGGGCCAGG + Intergenic
1160789446 19:916921-916943 CTCAGCGGAGACCCTGAGTGAGG - Intergenic
1160848896 19:1180358-1180380 CCCAGGAGAGACACTGAGGCCGG - Intronic
1161120221 19:2521547-2521569 CCCAGGGGAGACCCTGGGTCAGG + Intronic
1161330085 19:3682802-3682824 CTCATGAGAGACCCCGAGCCAGG + Intronic
1161431245 19:4233548-4233570 CGCCTGAGAGCACCTGAGTCAGG + Intronic
1161484057 19:4525277-4525299 CACCTGTGAGCCCCTGAGTCAGG - Intronic
1161657144 19:5523298-5523320 CGCCTGTGAGCCCCTGAGTCAGG + Intergenic
1161663856 19:5563242-5563264 CGCCTGTGAGCCCCTGAGTCGGG - Intergenic
1162648410 19:12066446-12066468 CTAATGAAAAACCATGAGTCGGG - Intronic
1162967861 19:14164485-14164507 CCCCTGAGGGACCCTCAGTCGGG - Intronic
1164063062 19:21692072-21692094 CCCATCAGAGAGCCTGAGTGAGG + Intergenic
1164991612 19:32688577-32688599 CTCATGGGAGATACTGAGTTAGG + Intergenic
1165792374 19:38500012-38500034 TGCATGTGAGACCCTGAGCCAGG + Exonic
1166463801 19:43014908-43014930 CTCATGACTGACCTTGTGTCTGG - Intronic
1166713911 19:44954589-44954611 CTGCTGAGAGACCCTTAGTTTGG - Intronic
1167484962 19:49757323-49757345 CTCGTGAGACGCCCTGAGCCAGG + Intronic
1168243476 19:55098609-55098631 CTCAGGAGAGACCCCCAGCCGGG - Intronic
925187247 2:1857076-1857098 CTCCTGTGAAACACTGAGTCAGG - Intronic
926287445 2:11501020-11501042 CTCATGTAAGACCCTGAGAAGGG - Intergenic
926605984 2:14898954-14898976 CACATGAGAGACCCCAAGTGAGG - Intergenic
928181922 2:29074011-29074033 CTCATGGGAGATCCTGCTTCAGG - Exonic
929504977 2:42521374-42521396 CTTGTGAGAGACCCTGAGCCAGG + Intronic
931234410 2:60401141-60401163 CTCTTCACAGACCCTGAGTGGGG + Intergenic
931318132 2:61151479-61151501 CTCTAGAAAGACCCTGAGCCAGG - Intronic
934765976 2:96880273-96880295 CTGATGACAGACCCTGAGGGCGG + Intronic
935726637 2:106029301-106029323 ATCACCAGAGACCCTGAATCAGG - Intergenic
936151199 2:110023294-110023316 CTCCTCAGAGACCCTGAGGCTGG + Intergenic
936193476 2:110348075-110348097 CTCCTCAGAGACCCTGAGGCTGG - Intergenic
937238445 2:120444763-120444785 CCCATGAGAGACCCCGAGCCAGG - Intergenic
937980326 2:127611017-127611039 CTCATGAGGGACCCTGAACTGGG - Intronic
939587913 2:144027473-144027495 CACATGAGAGGCCCTGGCTCTGG + Intronic
939789593 2:146555330-146555352 CTCATGAGATACCCTGAGCCAGG + Intergenic
940197221 2:151108329-151108351 CTCACTAGAGACCCTGAGTCTGG - Intergenic
941093547 2:161208606-161208628 AACATAAGAGACCCTGAGTCAGG - Intronic
941650211 2:168084393-168084415 AGCACGAGAGACCCCGAGTCAGG + Intronic
943333070 2:186584034-186584056 CTCAAGTGAGACCCTGAGCCAGG - Intergenic
945560667 2:211336041-211336063 TTCATGAGAGACCCTGAGCTAGG - Intergenic
946213941 2:218169013-218169035 CTCAAGAAAGACCCTGAGGCCGG + Intergenic
947274408 2:228373906-228373928 TGCATGAGAGTCCCTGAGTGAGG - Intergenic
948527476 2:238580559-238580581 CACTTGGGAGACCCTGAGACAGG + Intergenic
1169893875 20:10481764-10481786 CTTGTGAGAGACCCTGAGCAAGG - Intronic
1170874473 20:20237294-20237316 CTCGTAAGGTACCCTGAGTCTGG - Intronic
1172095050 20:32456481-32456503 CTCATGAGTGTCCCTGGGTTGGG + Intronic
1172230516 20:33332945-33332967 CGCTTGGGAGACCCTGAGTGCGG + Intergenic
1173270110 20:41526261-41526283 CTCAGTAGAGACCCTGAGCTTGG - Intronic
1173289168 20:41699350-41699372 CTCATGAGAGACCATGAGCCAGG + Intergenic
1174422912 20:50411996-50412018 CTCAGGGGAGTTCCTGAGTCAGG + Intergenic
1174967055 20:55228284-55228306 CTCTTTAGAGACACAGAGTCAGG - Intergenic
1175235499 20:57507728-57507750 CTCAGGAGTGGCCCTGAGCCAGG + Intronic
1175386918 20:58603101-58603123 CTCATGAGAGACCCCAAGCCGGG - Intergenic
1176045674 20:63091382-63091404 CCCACGAGAGACGCTGGGTCGGG + Intergenic
1176270351 20:64233030-64233052 CCCATCAGAAACCCTGTGTCTGG + Intronic
1177911143 21:27033828-27033850 CTTCTGAAAGACCCTGAGCCAGG + Intergenic
1178736810 21:35160022-35160044 ATCTAGAGAGATCCTGAGTCTGG + Intronic
1179270255 21:39845237-39845259 CCCAGGAGACACCCTCAGTCTGG + Intergenic
1179806986 21:43845620-43845642 CTCACAAGAGACCCTGAGCCAGG + Intergenic
1181503420 22:23333568-23333590 CTCATGAGAGTTCATGTGTCAGG - Intergenic
1181770771 22:25123742-25123764 CTCATGAGATACCCTGAGCCAGG + Intronic
1182711939 22:32328652-32328674 CTCCTGAGAGACCCCAAGCCAGG + Intergenic
1182765191 22:32753357-32753379 CTCTAGAGACAGCCTGAGTCAGG - Intronic
1184867097 22:47207652-47207674 CTCTGGAGAGACCCTGAGCCAGG + Intergenic
956105570 3:65814178-65814200 GTGATGAGACACCCTGTGTCTGG - Intronic
956769482 3:72512525-72512547 CTCATGAGAGACCCTGAGCCGGG + Intergenic
959002207 3:100977383-100977405 CTCATGAGAGATTCTGAGCCAGG - Intronic
963525175 3:146407717-146407739 CTCATCGGAGAGCCTGAGTGAGG + Intronic
965069420 3:163899212-163899234 ATCATGAGAGACTCTGAGTATGG + Intergenic
965104090 3:164337390-164337412 CCCATCGGAGACCCTGAGTGAGG + Intergenic
965289399 3:166859526-166859548 CTCAGAACAGAGCCTGAGTCAGG + Intergenic
966569097 3:181420836-181420858 CCCATGAGAGACCATGTGGCTGG - Intergenic
966863463 3:184243275-184243297 CTCACAAGAGACCCCGAGACAGG - Intronic
967222082 3:187255916-187255938 CTCAGAAGAGACCCTGAGCTGGG - Intronic
968633317 4:1664071-1664093 GACATGAGACACCCTGAATCTGG + Intronic
969619880 4:8273599-8273621 CTCAGGAGAGACCCGGGGGCTGG - Intronic
970000798 4:11364269-11364291 ATCATGAGAGATCCTGACCCTGG + Intergenic
972731584 4:41800211-41800233 CTCATAAGAGACCTTGAGCCAGG - Intergenic
973730117 4:53815119-53815141 CTGGTGAGAAACCCTGAGCCAGG - Intronic
975238261 4:72026449-72026471 GTCCTGAGAGAGTCTGAGTCAGG - Intergenic
979216392 4:118169829-118169851 CTCATGAGAAACCTGGAGCCAGG - Intronic
981275085 4:142890006-142890028 CTCATGAGAGACAATGAAACTGG + Intergenic
984080520 4:175243629-175243651 CTCCTGAGAGAGACTGATTCTGG + Intergenic
986689963 5:10306338-10306360 CTCCTGGGAGAGCCTGAGCCCGG + Intronic
986791277 5:11163395-11163417 CTCATGACAGACCCTGAGCCAGG + Intronic
988627200 5:32890055-32890077 CTCAAGAGAGACCCTGAGCCTGG + Intergenic
993201751 5:84825646-84825668 CTCATGAGAAACCTTAAGCCAGG - Intergenic
993601647 5:89933160-89933182 CTCATGAGAGCCTCTGAATTAGG - Intergenic
995572082 5:113491179-113491201 CTCATCACAGACCCAGAGGCAGG + Intergenic
996372940 5:122772535-122772557 CTTCTGAGAGACCCTGAGTCAGG + Intergenic
996591002 5:125147647-125147669 CTTATGAGAGATTCTGACTCAGG + Intergenic
999523716 5:152380114-152380136 CTCGTGAAAGACCCAGAGCCAGG - Intergenic
999763239 5:154718981-154719003 GTCAAGAGAGACCCTGCTTCTGG - Intronic
1003048725 6:2761601-2761623 CTCATGACAGACCGTGAGGTAGG + Intergenic
1003816528 6:9847597-9847619 TTCATGAGAGACCCTGAGCCAGG - Intronic
1003874617 6:10424672-10424694 CTAATGGGATATCCTGAGTCAGG + Intergenic
1007645464 6:43376967-43376989 TTCTTGAGAGACCCTGAGCCAGG + Intergenic
1007756724 6:44104287-44104309 CTGATGAGACACCCTGAGCAGGG + Intergenic
1012037029 6:94155348-94155370 GTCATGACAGACCCTTAGTTTGG - Intergenic
1012303177 6:97615654-97615676 CTCAAGATAGACCATGTGTCAGG - Intergenic
1014634582 6:123829453-123829475 CTCATGTGACATCCTGATTCAGG + Intronic
1014978997 6:127924130-127924152 CACATGAAAGACCCTGAGCCAGG + Intergenic
1016892823 6:149023456-149023478 CTCATGAGAGATCCCAAGCCAGG + Intronic
1017145063 6:151227358-151227380 CTCATGAGAGTCCCTGAGTCAGG - Intergenic
1019441831 7:1051338-1051360 CTGCTGGGAGACCCTGAGCCAGG + Intronic
1019485962 7:1289275-1289297 CTCGGGCCAGACCCTGAGTCGGG + Intergenic
1019729406 7:2622175-2622197 CTCAGGAGAGACACAGAGGCCGG + Intergenic
1020270477 7:6591874-6591896 CTCAAGAGAGACCCTCGGCCGGG + Intronic
1021871321 7:25009121-25009143 CCCATGAGAGACTTTGAGCCAGG - Intergenic
1022243191 7:28532304-28532326 CTCATAAGAGTGCCTGAGCCAGG + Intronic
1026444741 7:70474358-70474380 CTTCTGGGAGACCCTCAGTCAGG + Intronic
1026688991 7:72536231-72536253 CAGATGTGAGTCCCTGAGTCAGG - Intergenic
1026724220 7:72858117-72858139 CAGATGTGAGTCCCTGAGTCAGG - Intergenic
1027184984 7:75965677-75965699 CTCAGCAGTGACCCTGAGCCAGG - Intronic
1031823751 7:126535942-126535964 CTCATGAGAGACCCTGAGCCAGG + Intronic
1032084517 7:128877037-128877059 CCCAGGAGACACCCTGAGCCAGG - Exonic
1032409309 7:131682827-131682849 CTCCTGAGAGAACCCGAGTCAGG - Intergenic
1034931053 7:155164465-155164487 CTCATGAGAGACCCTGAGCCAGG - Intergenic
1035022850 7:155809278-155809300 CACATTAGAGACCCAGAGACAGG + Intronic
1036673705 8:10811584-10811606 CGCGTGAGAGACCCTGAGCCAGG - Intronic
1037556102 8:20024075-20024097 CTCATAAGATACCCTGAGCCAGG + Intergenic
1038490962 8:27970766-27970788 CTCTTGAGAAAGCCTGAGCCAGG + Intronic
1038695238 8:29800579-29800601 GTCATGAGAGGTCCTGAGTCTGG - Intergenic
1038906198 8:31906110-31906132 CACATGGGAGACCTTGAGTTGGG - Intronic
1039129104 8:34241537-34241559 CTGATGAGAGGCCTTGAGTGAGG - Intergenic
1040108619 8:43555210-43555232 CCCATGGGAGAGCCTGAGTGAGG + Intergenic
1041653289 8:60322493-60322515 TTGGTGAGAGACCCTGAGCCAGG - Intergenic
1041841925 8:62282131-62282153 CACATGAGAAACCCAGGGTCTGG - Intronic
1042991847 8:74649207-74649229 CTCATGAGAGACACAGATGCAGG + Intronic
1044780231 8:95735930-95735952 CACATGAGAAACCCAGGGTCTGG - Intergenic
1044962848 8:97547954-97547976 CTCATGAGAAATCCTGAGCCAGG - Intergenic
1047175912 8:122540147-122540169 CTCAGGAGAGACCCTGAGCCAGG + Intergenic
1048315042 8:133355588-133355610 CCCATGAGAGATCCTGCCTCTGG + Intergenic
1048422598 8:134292069-134292091 CTTGTGAGAGACCCTGACACAGG + Intergenic
1048898320 8:139015011-139015033 CTCACGAGAGACTCTGAACCAGG - Intergenic
1048950181 8:139490093-139490115 CTCATGTGAAACCCTCAGACTGG - Intergenic
1056683085 9:88737102-88737124 CTTGTGAGAGATCCTGAGTCAGG - Intergenic
1057073217 9:92118398-92118420 CCACTGAGAGACCCTGAGTGAGG + Intergenic
1057098852 9:92338754-92338776 CTCATGAGAGGCCCTGAGCAAGG - Intronic
1058113983 9:101064312-101064334 CCCATGAGAAACTCTGAGCCAGG - Intronic
1060864190 9:126981873-126981895 CTCCTGAGAGACCCTGAGCCAGG - Intronic
1061399910 9:130362727-130362749 ATCATGAGGGGCTCTGAGTCTGG + Intronic
1185871356 X:3667543-3667565 CTCAGAAGAGAGCCTGAGGCAGG - Intronic
1186962173 X:14748383-14748405 CTTGTGAGAGACTCTGAGACAGG + Intergenic
1187398098 X:18935455-18935477 CTCTTTAGAGAGCCTGTGTCAGG + Intronic
1187449616 X:19385167-19385189 TTCCTGGGAGACCCTGAGCCAGG - Intronic
1187809688 X:23161778-23161800 CTCATGAGAGACCTTGAATCAGG - Intergenic
1187921180 X:24203430-24203452 CTCATCAGAGTCCCAGAGGCAGG + Intronic
1189127952 X:38467935-38467957 CACATGAGAGACTCTGTGCCAGG + Intronic
1189249197 X:39586975-39586997 CCCATGGCAGACCCTGAGACTGG + Intergenic
1189350951 X:40275334-40275356 CTCATGAGACACCCCAAGCCAGG - Intergenic
1190237292 X:48626256-48626278 TTCATGAGAGACCCTGAGCCAGG - Intergenic
1192724806 X:73737977-73737999 CTCATAATAGTCCCTGATTCTGG + Intergenic
1194539849 X:95156734-95156756 CTGATGAGAGGTCCTGAGCCAGG - Intergenic
1195433032 X:104810774-104810796 CTCATCAGAAACCCGAAGTCTGG - Intronic
1197761631 X:130032208-130032230 CTCACGAGAGACCCCAAGCCAGG - Intronic
1198097877 X:133398422-133398444 CTAATGAGGAACCCTGAGGCTGG - Intronic
1198874037 X:141203920-141203942 CTCATTGGAGACTCTGTGTCGGG + Intergenic
1199184479 X:144898999-144899021 CTCCTCAGAGACTCTGATTCAGG + Intergenic
1200792745 Y:7314119-7314141 CTCAGAAGAGAGCCTGAGGCAGG + Intergenic