ID: 1105383682

View in Genome Browser
Species Human (GRCh38)
Location 13:19910811-19910833
Sequence GGTGGATGTGGTTACTGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 2, 1: 3, 2: 16, 3: 49, 4: 233}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105383679_1105383682 -5 Left 1105383679 13:19910793-19910815 CCAGGGTGGCAGGTGCAAGGTGG 0: 1
1: 0
2: 4
3: 47
4: 434
Right 1105383682 13:19910811-19910833 GGTGGATGTGGTTACTGTAATGG 0: 2
1: 3
2: 16
3: 49
4: 233
1105383677_1105383682 -3 Left 1105383677 13:19910791-19910813 CCCCAGGGTGGCAGGTGCAAGGT 0: 1
1: 0
2: 2
3: 29
4: 314
Right 1105383682 13:19910811-19910833 GGTGGATGTGGTTACTGTAATGG 0: 2
1: 3
2: 16
3: 49
4: 233
1105383671_1105383682 22 Left 1105383671 13:19910766-19910788 CCTAAATACAATGAGAATAGTTG 0: 1
1: 0
2: 3
3: 36
4: 326
Right 1105383682 13:19910811-19910833 GGTGGATGTGGTTACTGTAATGG 0: 2
1: 3
2: 16
3: 49
4: 233
1105383678_1105383682 -4 Left 1105383678 13:19910792-19910814 CCCAGGGTGGCAGGTGCAAGGTG 0: 1
1: 0
2: 4
3: 39
4: 327
Right 1105383682 13:19910811-19910833 GGTGGATGTGGTTACTGTAATGG 0: 2
1: 3
2: 16
3: 49
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105383682 Original CRISPR GGTGGATGTGGTTACTGTAA TGG Intergenic
900450317 1:2746293-2746315 TGTGGGTGTGGGTACTGTACAGG - Intronic
900876597 1:5347314-5347336 GGTGGTTGTGGTTGTGGTAATGG + Intergenic
901511726 1:9721062-9721084 GGTGGAGGTGGTCAGGGTAAGGG - Intronic
904705883 1:32390386-32390408 GGTGGATTTGGTGACTGAACAGG + Intronic
905094049 1:35453816-35453838 GGGAGATGTGGTTACCGTCAGGG + Intronic
908737328 1:67290343-67290365 GGTGGATGTAGCTCCTGTAATGG + Intergenic
909149286 1:71980594-71980616 GGTGGATCTGGTTACATTAAAGG - Intronic
910587980 1:88899996-88900018 GGTGGGTGTAGCTACTCTAATGG + Intergenic
910639201 1:89441703-89441725 GGTGGGTGTAGCTACCGTAATGG - Intergenic
912416350 1:109510329-109510351 GGTGCATGAGGTGTCTGTAAAGG - Intergenic
912944046 1:114069927-114069949 GGTGGGTGTAGCTACTGTAATGG - Intergenic
916274150 1:162975925-162975947 AATGGATGTGGTTAGTGTGAAGG + Intergenic
916366127 1:164029787-164029809 GGTGGGTGTTGTTACTGTGATGG - Intergenic
916763047 1:167834178-167834200 AGTGGAGGTGGTAACTGAAATGG - Intronic
917656846 1:177135092-177135114 GGTGGATGTGCTTACTGCCATGG + Intronic
917964598 1:180170339-180170361 GTTGGAAGTGGTTAAGGTAATGG + Intronic
918221877 1:182442828-182442850 TGAGGAGGTGGTTATTGTAATGG - Intergenic
918918447 1:190673574-190673596 GGTGGGTGTAGCTACTGTAATGG - Intergenic
919719862 1:200821720-200821742 GGTTGTTGTGTTTCCTGTAAGGG - Intronic
919838769 1:201594348-201594370 GGAGGAGGTGGTTGCTGGAATGG + Intergenic
920563684 1:206957486-206957508 AGTGGATGTGATTCCTGGAAAGG + Intergenic
923144579 1:231188986-231189008 GGTGGATGTTGGTTCTGTGATGG + Intronic
923146607 1:231202906-231202928 GCTGGATGTGGTCACTGGACTGG + Intronic
923253803 1:232201122-232201144 GGTGGGTGTAGCTACAGTAATGG - Intergenic
923448869 1:234097945-234097967 GGTGGAGGTGGTGACTGTGTTGG + Intronic
1064322195 10:14316031-14316053 GGTGGATGTGGTTGCTGCATAGG - Intronic
1064545882 10:16449541-16449563 GGTGGGCATTGTTACTGTAATGG - Intronic
1067577266 10:47416631-47416653 GATGGATGGGGGCACTGTAATGG - Intergenic
1067577347 10:47417009-47417031 GATGGATGGGGGCACTGTAATGG - Intergenic
1067577382 10:47417171-47417193 GATGGATGGGGGCACTGTAATGG - Intergenic
1068225578 10:54103340-54103362 GGTGGGTGTAGTTACCATAATGG - Intronic
1068446979 10:57136854-57136876 AGTGGGTGTAGCTACTGTAATGG + Intergenic
1069140031 10:64811067-64811089 GCTGGGCTTGGTTACTGTAATGG - Intergenic
1071243874 10:83741204-83741226 GATGGAAGGGGTTACTGTGAAGG + Intergenic
1071943012 10:90609518-90609540 GGTGGGTGTAGCTACTGTAATGG - Intergenic
1072159192 10:92750403-92750425 GAAGGATGTGGTGACTGGAAGGG - Intergenic
1072360240 10:94652412-94652434 GGTGGGTGTAGTTACTGTAATGG + Intergenic
1073077081 10:100830836-100830858 GGGGGATGTGGTGACTGTCCAGG + Intergenic
1075417459 10:122275501-122275523 GGTGGTGGTGGTGACGGTAATGG - Intronic
1076249054 10:128970678-128970700 GGTGGATGTGGAGGCTGTATAGG - Intergenic
1077888479 11:6402864-6402886 GGGGGATGTGGTTAGGGTGAGGG + Intronic
1079531089 11:21454696-21454718 GGCAGATTTGATTACTGTAAAGG + Intronic
1080735349 11:35008772-35008794 GGTTGATGTGGATACAGCAAAGG - Intronic
1080976630 11:37350113-37350135 GGTGGGTGTAGCTACTGTAATGG + Intergenic
1081482787 11:43504915-43504937 GGCAGATATGGTTACTGTACTGG - Intergenic
1081881595 11:46457514-46457536 GGCTGACTTGGTTACTGTAATGG + Intronic
1084803958 11:71565951-71565973 GGTGGCTGTGGTTCCTGTGGGGG + Exonic
1086000581 11:81979572-81979594 GGTGAATGTTGATACTGTAATGG - Intergenic
1086472742 11:87133009-87133031 AGTCGATGTGGTAACTGAAAGGG + Intronic
1088082318 11:105933452-105933474 GGTGAGTGTGGTAACTGTTATGG + Intronic
1088449121 11:109963595-109963617 GGTGGGCATAGTTACTGTAATGG + Intergenic
1089115650 11:116093135-116093157 GGTGGATGTAATTACTGTAAGGG - Intergenic
1090325340 11:125881443-125881465 GGTGGATGTAGTTTAAGTAAAGG - Intergenic
1091958765 12:4672589-4672611 GGTGGCTTTGTTTACTGTGAGGG - Intronic
1092012598 12:5127332-5127354 ATTGGGTGTGGTTACTTTAATGG - Intergenic
1092093044 12:5819877-5819899 GGTGGGTGTACCTACTGTAATGG + Intronic
1093392313 12:18637542-18637564 GGTGGGTGTGGTTACCATAGCGG - Intronic
1094114624 12:26897104-26897126 GGTGGAATTGCTGACTGTAATGG - Intergenic
1095132163 12:38556387-38556409 GGTGGGTGTGGTTACTATAAAGG - Intergenic
1095329075 12:40935673-40935695 GGTGGATATGTTCATTGTAAGGG - Intronic
1095844701 12:46732242-46732264 GGTGGGTGTAGCTACTGTAATGG - Intergenic
1096296741 12:50390595-50390617 GGTGGATATGATTACTGTAATGG - Intronic
1098672813 12:73252494-73252516 GGAGGGTGTAGCTACTGTAATGG + Intergenic
1098730827 12:74035597-74035619 GGTGGGTGTAGCTACCGTAATGG + Intergenic
1099792573 12:87355251-87355273 GGTTGATGTTGTTAATGTAGAGG + Intergenic
1100916581 12:99430572-99430594 GGTGGAGGATGTTACTCTAATGG - Intronic
1101222418 12:102655233-102655255 GGTGGACGTGGTTACTGTAATGG + Intergenic
1101263889 12:103064352-103064374 GGTGGTTGTAGCTACTGTAATGG + Intergenic
1101534911 12:105607861-105607883 GGTGGGTGTAGCTACCGTAATGG - Intergenic
1101711053 12:107267213-107267235 GGAGGGAGTGGTTATTGTAAGGG + Intergenic
1102716521 12:114978173-114978195 GGAGGATGTGGTTAAGGCAAGGG - Intergenic
1105383682 13:19910811-19910833 GGTGGATGTGGTTACTGTAATGG + Intergenic
1105611185 13:21970997-21971019 GGTGTGTGTGGTATCTGTAAGGG + Intergenic
1109516046 13:63443547-63443569 GGTGGGCATGGCTACTGTAATGG + Intergenic
1110460352 13:75738104-75738126 GGTTGACGTGGGTACTGTGAAGG + Intronic
1111370549 13:87311281-87311303 GATGGGTGTGGTTACTGCAGTGG + Intergenic
1113108687 13:106798812-106798834 GGTGGGGGTGTTTACTGGAAGGG + Intergenic
1113736064 13:112679879-112679901 GGTGGGTGTGGTTAGTATCAGGG - Intronic
1113906042 13:113819667-113819689 GGTGGATGCGGTCACTGCAGGGG - Intergenic
1115518907 14:34213281-34213303 TGTGGATGAAGTTACTGTGATGG - Intronic
1116067855 14:40007411-40007433 GATGGGTATAGTTACTGTAATGG + Intergenic
1116158614 14:41238431-41238453 GGTGGGTTTAGTGACTGTAATGG - Intergenic
1116417151 14:44692478-44692500 GGTTGCTGTGGTTAGTGTAAGGG - Intergenic
1120082262 14:80229299-80229321 AGTGGATGTAGCTATTGTAATGG - Intronic
1121035065 14:90696373-90696395 GGTGGCCGTGCTTAATGTAAAGG - Intronic
1121072510 14:91037363-91037385 GGTGGATGTAATTACCATAATGG - Intronic
1202935526 14_KI270725v1_random:84102-84124 GGTGGGTGTAGCTACCGTAATGG - Intergenic
1128223933 15:65988817-65988839 GGTGGATGTGGGGAAAGTAAAGG - Intronic
1129826013 15:78635507-78635529 GGCGGATCAGGTTATTGTAACGG + Exonic
1131088516 15:89599535-89599557 GGTGGATTTGGTTAGTGTCTTGG + Intronic
1131978821 15:97975206-97975228 GGAGGATGGGGTGACTATAAAGG - Intergenic
1132225495 15:100137808-100137830 GGTGGATGTTGGTAGTGAAAGGG - Intronic
1133369589 16:5238056-5238078 GGTGGATGCAGTTACCATAAAGG - Intergenic
1133402984 16:5502332-5502354 AGTGGATGGGGACACTGTAAGGG + Intergenic
1133924959 16:10184570-10184592 TGTGGATGTGGCTGCTGAAATGG + Intergenic
1134221831 16:12361011-12361033 GGTGGAAATGGGTACCGTAAGGG - Intronic
1134257996 16:12627092-12627114 GGTGGAGGTGGTCTCTGTCAGGG - Intergenic
1134784045 16:16924811-16924833 CGTGGGTGTGGTTACAGTCACGG - Intergenic
1135026896 16:19005768-19005790 GGTGGGTGTGGTCCCTGAAAAGG - Intronic
1135869186 16:26133582-26133604 GCTGGATGTTGTTAGTATAATGG - Intronic
1140490842 16:75334517-75334539 GGTGGAGGAGGTTTCTATAAAGG + Intronic
1144590093 17:16516366-16516388 GATGGATGTGGTGAGTGTTATGG - Intergenic
1145819733 17:27823005-27823027 TGTGGATTTGATTACTGTAGAGG + Intronic
1147308786 17:39581628-39581650 GGTTCATGTGGTTATTGTAAAGG - Intergenic
1147374088 17:40013933-40013955 AGTGGATGTGGTGACTGGATGGG - Intergenic
1151144961 17:72031992-72032014 GGTGGATGTGGCTGATGTCAGGG - Intergenic
1151692128 17:75693184-75693206 GGTGGGTTTGGTCACTGAAAAGG + Intronic
1153048876 18:882519-882541 GGTGGGTTTTGTTGCTGTAAGGG + Intergenic
1155234528 18:23806136-23806158 GGCGGGTGTGGTTACCATAATGG - Intronic
1155488322 18:26371546-26371568 GGTGAATGTGATTACCGTAATGG + Intronic
1156998367 18:43495961-43495983 GGTGGGTGTATCTACTGTAATGG + Intergenic
1157054404 18:44209540-44209562 GGTGGATGTGGCTACTGTAATGG + Intergenic
1157911159 18:51618354-51618376 GATGGGTGTGGCTATTGTAAAGG + Intergenic
1159571178 18:70113504-70113526 GGTTCATATGGTAACTGTAATGG - Intronic
1162192061 19:8954729-8954751 GGTTGATGTGTCTAATGTAAAGG + Exonic
1162633172 19:11944941-11944963 GATGGATGTGGTTACTGGATGGG - Intronic
1165915071 19:39253464-39253486 AGTGGACGTGGCTACTGAAAGGG + Intergenic
926342116 2:11912183-11912205 GGTGGGTGTGGTTACTGTAATGG - Intergenic
927845667 2:26471108-26471130 GGTGGATGTGGTGAGTGTGGGGG - Exonic
928078478 2:28287086-28287108 GGTGTCTGTGGTTAAAGTAAAGG - Intronic
928794549 2:35000990-35001012 GGTGACTGTGACTACTGTAATGG - Intergenic
929659727 2:43771993-43772015 GGTAGATGGGGCTACTGTGAAGG - Intergenic
930478826 2:51921202-51921224 GGTAGATGTAGTTACTGTAATGG - Intergenic
931017886 2:58006680-58006702 GGTGGGTATGGTTACTGTGAAGG + Intronic
931452426 2:62379376-62379398 GGTGGATGAGATTCCTGCAAAGG + Intergenic
931742390 2:65258927-65258949 GGTGGAGGTGGTTTTTTTAAGGG + Intronic
931864947 2:66399474-66399496 GGTGAATGTTGTTACAGGAAGGG + Intergenic
933057128 2:77684517-77684539 GGTGGATGTGGTTAAAGAACTGG - Intergenic
933474424 2:82771189-82771211 GGTAGATGTGTTTAGTGTGATGG - Intergenic
933927259 2:87105656-87105678 GGTGGATGTGGTTAAAGAACTGG - Intergenic
934465957 2:94263143-94263165 GGTGGGTGTAGCTACCGTAATGG - Intergenic
935087566 2:99863015-99863037 AGTGGATGTGTTTCCTGCAAAGG + Intronic
938215454 2:129509071-129509093 GGTGGGTGTGGTTGCCATAATGG + Intergenic
940606144 2:155926116-155926138 GGTGGGTGTAGCTACTGTAATGG - Intergenic
942583409 2:177446533-177446555 GGTGGGTGTGGGTACAGTAGTGG + Intronic
943344142 2:186717517-186717539 GGTAGATGAGTCTACTGTAATGG + Intronic
943384254 2:187182634-187182656 GGTGGGTGTAGCTACAGTAATGG - Intergenic
943623758 2:190177969-190177991 GGTGAATGTGGTTAGGGTGAGGG - Intronic
946790700 2:223297995-223298017 GGTGGGTGTAGTTACTGTAATGG + Intergenic
947925774 2:233921302-233921324 GGAGGATGGGGTGATTGTAAAGG - Intronic
948038527 2:234879794-234879816 TGTGGCTCTGGTTACTGAAAAGG - Intergenic
1169626939 20:7581746-7581768 GGTAGAAGTAGTTACTGTGAAGG - Intergenic
1170683858 20:18551022-18551044 GGTGGAAGTGGTTGCTGTGTGGG + Intronic
1171720631 20:28559634-28559656 GGACGAGGTGGCTACTGTAATGG - Intergenic
1171863438 20:30422575-30422597 GGACGAGGTGGCTACTGTAATGG + Intergenic
1172329801 20:34067466-34067488 AGTGGCTGTTGTTACTGTGACGG + Intronic
1172538782 20:35695174-35695196 GGTGGAGATGGTTTCTGAAATGG - Intronic
1173551944 20:43938520-43938542 GCTGGATGTGGGCACTGAAATGG + Intronic
1173730624 20:45325854-45325876 GCCGCATGTGGTTACTGTATTGG + Exonic
1176596951 21:8706338-8706360 GGTGGGTGTAGCTACCGTAATGG - Intergenic
1177193011 21:17872635-17872657 GATGGATGTAGTTACCCTAACGG - Intergenic
1177912962 21:27054470-27054492 GGTGCATGTGGCTACTGTAATGG + Intergenic
1177933918 21:27318680-27318702 GGTGGGTGTAGCTACTGTAATGG - Intergenic
1178764050 21:35432693-35432715 GGTGGGTGTAGCTACCGTAACGG - Intronic
1179383308 21:40919317-40919339 GGAGGGTGCAGTTACTGTAATGG + Intergenic
1179458437 21:41515874-41515896 GGTGGGCATGGTTACTCTAATGG - Intronic
1180279874 22:10683780-10683802 GGTGGGTGTAGCTACCGTAATGG - Intergenic
1180667101 22:17522482-17522504 GGTGGATGTTGATTCTGAAAAGG - Intronic
1181754086 22:25010638-25010660 AGTGGCTGTGGTTCCTTTAACGG - Intronic
1182532144 22:30968967-30968989 GGTGGCTGTGGTGTCTGTGACGG - Intergenic
1182828302 22:33284340-33284362 GGTGGCTGTGGCTGCTTTAAAGG - Intronic
1183467171 22:37985568-37985590 GGTGTATGTGGGTTATGTAATGG + Intronic
1184021115 22:41822111-41822133 GGAGGATGTGGTTGTTGTCAGGG + Intronic
1184414314 22:44343376-44343398 AGCGGTTGTGGTTACTGTCACGG - Intergenic
1184603802 22:45560152-45560174 GGTGGGTGTAGCTTCTGTAATGG - Intronic
950712664 3:14824120-14824142 AGAGGATGTGGTTCCTGTATGGG - Intronic
953201870 3:40785028-40785050 GGTGGATTTGTTGACTGTTACGG + Intergenic
953826560 3:46257390-46257412 AGTGTATGAGGTTACTTTAATGG - Intronic
955390815 3:58521073-58521095 GGTGGCTGTGGTTTCTGTTTTGG + Intronic
957950691 3:87122186-87122208 GGTGGAGGTTGTTAGGGTAAGGG + Intergenic
958180020 3:90048186-90048208 GGTAAATGTGGTTATTATAATGG - Intergenic
958576762 3:95959680-95959702 GGTGAACGTGGTTACCATAATGG + Intergenic
959746244 3:109779013-109779035 GGTGGGTGTAGCTACTGTAATGG - Intergenic
959997398 3:112694240-112694262 GGTGGGCATAGTTACTGTAATGG + Intergenic
960033245 3:113076929-113076951 GGTGGATGTGGTTACTGTAATGG + Intergenic
962127392 3:132635162-132635184 AATGGCTGTGGTTACTTTAAGGG + Intronic
963661162 3:148130378-148130400 GGAGGGTGTAGTGACTGTAATGG + Intergenic
966445453 3:179996802-179996824 GGTGGGCGTAGCTACTGTAATGG + Intronic
966763283 3:183435910-183435932 GGTGAATGTGATTACCGCAAGGG + Intergenic
969263671 4:6050167-6050189 GGTGGCTGTGGTTGCTAGAAGGG - Intronic
969445045 4:7239903-7239925 GGTGGACGTTGTTCCTGGAAGGG + Intronic
969595113 4:8144334-8144356 GGTGGATGCGGATTCTGGAAGGG - Intronic
970816344 4:20160714-20160736 GGTGGATGTGGTTACCATAATGG + Intergenic
972048106 4:34694430-34694452 GGTGGGTGTAGTTACCATAATGG - Intergenic
973102717 4:46293013-46293035 GGTGGGTGGAGCTACTGTAATGG + Intronic
973193611 4:47414812-47414834 GGTGGAGGTGGGCATTGTAAAGG + Intronic
973973923 4:56243250-56243272 TGTGGATGTGGTGCCTGTGAGGG + Intronic
974479244 4:62422617-62422639 GGTGGGTATAGTTACTGTAATGG - Intergenic
974564573 4:63566559-63566581 GGTGGGTGTAGTTACTGTAAAGG + Intergenic
974588309 4:63910544-63910566 AGTGGATGAGGTTACTGTAATGG - Intergenic
975129547 4:70818945-70818967 GGTGGATGTAGTTATGGGAAAGG - Exonic
977487511 4:97666918-97666940 GGTGGTAGTGGTAACTATAAAGG - Intronic
977779928 4:100969053-100969075 GATGTATGTGGTTCCTGTTAAGG - Intergenic
977833491 4:101619935-101619957 GGTGGGTGTATCTACTGTAATGG - Intronic
978300540 4:107264988-107265010 GGTGGGTGTTATTACTCTAATGG + Intronic
980388142 4:132112871-132112893 GGTGGATGTAGCTACCTTAATGG - Intergenic
982423373 4:155224950-155224972 GGTGGTTGGGGTTACAGTGATGG + Intergenic
982868520 4:160547624-160547646 GGTATATGTGCTTACAGTAAAGG - Intergenic
983047965 4:163009751-163009773 GGTGGAAGTGGGTATTCTAAAGG + Intergenic
983731881 4:171004916-171004938 TGTGTGTGTGGCTACTGTAATGG + Intergenic
984693236 4:182752769-182752791 GAAGGATATGGTTACTGTAAGGG + Intronic
985041663 4:185897139-185897161 AGGGGTTGTGGTTACTGTGACGG - Intronic
985305938 4:188540161-188540183 GTTGGATGAGGTTCCTGAAAGGG - Intergenic
986250147 5:6048138-6048160 GGAGGTGGTGGTTACTCTAATGG + Intergenic
987037936 5:14036749-14036771 GGTGGAGGTGGTTAGGGGAAGGG - Intergenic
987788055 5:22527530-22527552 TGTGGATGTGGTTACCATAATGG - Intronic
987995004 5:25264912-25264934 TGTGAGTGTGGTTACTGTGATGG + Intergenic
988169414 5:27634577-27634599 GGTGGGCGTAGATACTGTAATGG - Intergenic
991014049 5:61912671-61912693 GGTGGTCGTAGCTACTGTAATGG - Intergenic
993319604 5:86456832-86456854 GGTGAGTGTAGCTACTGTAATGG + Intergenic
993892489 5:93490809-93490831 GGTGGTTGTGGTTATGGTAGTGG + Intergenic
993892560 5:93491155-93491177 GGTGGTTGTGGTTATGGTAGTGG + Intergenic
995156003 5:108913994-108914016 GGTGGGTGTAGTGACTGAAAGGG + Intronic
1000223472 5:159236041-159236063 GGTGGATGTAGTTACTATAATGG - Intergenic
1001126215 5:169021919-169021941 TGTGACTGTGGCTACTGTAATGG + Intronic
1001494944 5:172181160-172181182 GGTGGATGTGGGTGCTGGGAAGG - Intronic
1001820983 5:174710107-174710129 GGTGTATGCGGCTACTGAAATGG + Intergenic
1003798634 6:9635340-9635362 GCTGGATCTGATTACTGTAAGGG + Intronic
1004800644 6:19143413-19143435 TGTGGCTGTGGCTACTGTACCGG + Intergenic
1007168594 6:39846676-39846698 CGTGGATGTGGTTATGATAAGGG - Intronic
1008079587 6:47180122-47180144 GGTGGGCATGGTTACTGTAATGG - Intergenic
1009546380 6:65025246-65025268 GGTTGAAGTGTTTAATGTAATGG - Intronic
1009637877 6:66289833-66289855 GGTGTGTGTGGTTACTATAATGG - Intergenic
1009997436 6:70911945-70911967 CTTGGATGTTGTTAGTGTAAAGG + Intronic
1011040522 6:83025135-83025157 GGTAGGTGTGGTTAGTGTAATGG - Intronic
1011177067 6:84575455-84575477 AGTGTGTGTGGTTACTCTAATGG + Intergenic
1012033205 6:94099282-94099304 GGTGGGCGTGGTTAGTGTAATGG + Intergenic
1012363183 6:98408389-98408411 TGGGTGTGTGGTTACTGTAATGG - Intergenic
1014534432 6:122598386-122598408 GGTGGGTGTAGCTACTGTAATGG - Intronic
1015072850 6:129117758-129117780 ATTGCATGAGGTTACTGTAAAGG - Intronic
1016419838 6:143872440-143872462 GGTGGATGTAGCTACTGTAATGG - Intronic
1017032811 6:150238987-150239009 GGTGGATGTGGTTTCTGTATGGG - Intronic
1017149686 6:151267841-151267863 GGTGGATGTGGTTTCTTCACCGG + Intronic
1018851064 6:167590463-167590485 GGTGGAGGTGGTGATGGTAATGG - Intergenic
1019040566 6:169100692-169100714 GGTGGGTGTAGCTACTATAATGG + Intergenic
1023103081 7:36738763-36738785 GGTGTGTGTTGTTACTGTGATGG + Intergenic
1025156115 7:56607038-56607060 GGTGGGTGTAGTTACCATAATGG - Intergenic
1025761944 7:64403744-64403766 GGTGGGTGTAGTTACCATAATGG + Intergenic
1026480917 7:70778833-70778855 GGTTGATGTGGTTAGTGGAACGG + Intronic
1027406987 7:77872517-77872539 GGTGGGTGTGGCTACCATAATGG - Intronic
1028289241 7:89044960-89044982 GATGGATGGGGCTACTGTGAAGG - Intronic
1030277228 7:107734342-107734364 GGTGGGTATAGCTACTGTAATGG + Intergenic
1030457679 7:109794803-109794825 GGTGGGAGTAGCTACTGTAATGG - Intergenic
1031236618 7:119186247-119186269 GGTGGGTGTAGTTACTGTAATGG + Intergenic
1031779351 7:125942005-125942027 GGTGGACGTAGCTACCGTAATGG - Intergenic
1033600830 7:142887397-142887419 TGTGGATGTGGTGTCTGTGATGG + Intergenic
1034693045 7:153029229-153029251 GGGTGCTGTGGTTACTGGAAGGG - Intergenic
1035035697 7:155892541-155892563 GGTGGAGGTGGTGACTGTTATGG + Intergenic
1035035728 7:155892675-155892697 GGTGGAGGTGGTGACTGTTATGG + Intergenic
1035872855 8:3154436-3154458 GGTAAATGTGGTTTTTGTAAAGG + Intronic
1036466886 8:9006042-9006064 GGTGGATGTAGTTACTGGTACGG + Intronic
1037128818 8:15383534-15383556 GAAGGATGTGGTTACTGGAACGG - Intergenic
1037383819 8:18316361-18316383 GGTGGATACGGTTAGTCTAAGGG + Intergenic
1041186382 8:55305230-55305252 GGTGGATGTGGCTACTATATTGG + Intronic
1041803221 8:61822481-61822503 GGTGGGTGTGGCTACTGTAAAGG - Intergenic
1041984885 8:63909656-63909678 GGTGGAAGGGGTTGCTGCAAAGG + Intergenic
1043456728 8:80419269-80419291 TGCAGATGTGGTTACTGCAAAGG + Intergenic
1044133533 8:88556915-88556937 GGTGGCTGTGGTTACCGTAATGG + Intergenic
1044392036 8:91662827-91662849 GGTGGAAGTGGTTAGGGAAAGGG - Intergenic
1044487387 8:92768892-92768914 GGTGGACGTAGCTACTATAATGG - Intergenic
1046128899 8:109943367-109943389 GGTTGGTGTGGCTACTGTAATGG - Intergenic
1046571278 8:115969298-115969320 GGTGTCTGTGGTTTCTTTAATGG + Intergenic
1046586007 8:116149401-116149423 GATGGGTGTAGCTACTGTAATGG - Intergenic
1047564971 8:126034227-126034249 GGTGGGTGTCGTTTCTCTAATGG - Intergenic
1048192690 8:132304523-132304545 GGTGGTTAGGGTTACTGTATTGG - Intronic
1048445560 8:134490269-134490291 GGTGAGCGTGGTCACTGTAAAGG + Intronic
1050447278 9:5738893-5738915 GGTGGGCGTAGCTACTGTAATGG - Intronic
1050613013 9:7372705-7372727 GGTGGAAAGGGTTACTGTAAGGG - Intergenic
1051966184 9:22832474-22832496 GGTGGGTGTAGCTACTGTAATGG + Intergenic
1052357766 9:27523378-27523400 GGTGGTTCTGGATTCTGTAAAGG - Intronic
1053610583 9:39709339-39709361 AGTGGGTGTGGTTCCTGTAAGGG + Intergenic
1053868620 9:42467363-42467385 AGTGGGTGTGGTTCCTGTAAGGG + Intergenic
1054087670 9:60761818-60761840 AGTGGGTGTGGTTCCTGTAAGGG - Intergenic
1054242940 9:62633056-62633078 AGTGGGTGTGGTTCCTGTAAGGG - Intergenic
1054557064 9:66667574-66667596 AGTGGGTGTGGTTCCTGTAAGGG - Intergenic
1054857923 9:69921184-69921206 GCTGCCTGTGGTTACTGAAAAGG - Intergenic
1057648035 9:96895229-96895251 GGTGAACATGGTTACTGTAATGG + Intergenic
1058239636 9:102540765-102540787 GGTGGGTATAGTTACAGTAATGG + Intergenic
1058259476 9:102811436-102811458 GGTGGATATAGTTACTATAATGG - Intergenic
1058402901 9:104637501-104637523 GGTGACTGTGGATCCTGTAATGG - Intergenic
1058727366 9:107817111-107817133 GAGGGAAGTGGATACTGTAATGG - Intergenic
1059571221 9:115438274-115438296 GGTGGAAGGGGTTGCTGCAATGG + Intergenic
1060805365 9:126572444-126572466 GGTGGGCGTGGTTACTGTGATGG - Intergenic
1060889589 9:127179532-127179554 GGGGGATGTGCCTACTGGAAAGG - Intronic
1062670571 9:137706321-137706343 GGTGGATGTTGTGAGTGGAAAGG + Intronic
1186481734 X:9901389-9901411 GGTAGAAGTGGTTACTATAAAGG - Intronic
1188636726 X:32442545-32442567 GGTGGGTGTGTGTACTGAAATGG + Intronic
1188697510 X:33213910-33213932 GGTGACTGTTGTGACTGTAAAGG - Intronic
1189795608 X:44643238-44643260 GGTGGTTGTGGTGGTTGTAATGG + Intergenic
1190538156 X:51449442-51449464 GGTGGACATGGTTATCGTAATGG + Intergenic
1191831208 X:65418549-65418571 AGTGGGTGTGGTTACCTTAATGG + Intronic
1192077430 X:68014447-68014469 AGGGGGTGTGGTTACTGGAAGGG + Intergenic
1192789568 X:74368149-74368171 GGTGAGTGTGGTTGCTGTGATGG - Intergenic
1193915038 X:87353700-87353722 GGTGGGCATAGTTACTGTAATGG - Intergenic
1194087871 X:89551389-89551411 AGTGGACATGGTTACTATAATGG + Intergenic
1196044804 X:111246063-111246085 GGTGGCAGTGGTGTCTGTAAGGG + Exonic
1197245337 X:124161076-124161098 GGTGGGTGTAGCTACTGTAATGG - Intronic
1197554487 X:127937309-127937331 GGTGGGCATAGTTACTGTAATGG - Intergenic
1199446931 X:147935510-147935532 GGTGGATGTGGCCAATGTAAGGG + Intronic
1201193771 Y:11471832-11471854 GGTGGGCGTAGCTACTGTAATGG - Intergenic
1202100210 Y:21299661-21299683 GGTGGACATAGCTACTGTAATGG + Intergenic
1202330223 Y:23742875-23742897 GAAGGATGTGATTACCGTAAAGG - Intergenic
1202540547 Y:25927187-25927209 GAAGGATGTGATTACCGTAAAGG + Intergenic