ID: 1105389150

View in Genome Browser
Species Human (GRCh38)
Location 13:19959026-19959048
Sequence CGCTGCCGCGTCGGGGCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 118}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105389133_1105389150 21 Left 1105389133 13:19958982-19959004 CCCACCGACCCGGGATTAATACC 0: 2
1: 0
2: 0
3: 1
4: 83
Right 1105389150 13:19959026-19959048 CGCTGCCGCGTCGGGGCCTCGGG 0: 1
1: 0
2: 0
3: 6
4: 118
1105389141_1105389150 -1 Left 1105389141 13:19959004-19959026 CCCGCGGCGCGGCCGCCGTCGCC 0: 2
1: 0
2: 5
3: 158
4: 1777
Right 1105389150 13:19959026-19959048 CGCTGCCGCGTCGGGGCCTCGGG 0: 1
1: 0
2: 0
3: 6
4: 118
1105389142_1105389150 -2 Left 1105389142 13:19959005-19959027 CCGCGGCGCGGCCGCCGTCGCCG 0: 2
1: 1
2: 14
3: 221
4: 735
Right 1105389150 13:19959026-19959048 CGCTGCCGCGTCGGGGCCTCGGG 0: 1
1: 0
2: 0
3: 6
4: 118
1105389130_1105389150 30 Left 1105389130 13:19958973-19958995 CCGGAGCCTCCCACCGACCCGGG 0: 1
1: 1
2: 1
3: 24
4: 544
Right 1105389150 13:19959026-19959048 CGCTGCCGCGTCGGGGCCTCGGG 0: 1
1: 0
2: 0
3: 6
4: 118
1105389137_1105389150 13 Left 1105389137 13:19958990-19959012 CCCGGGATTAATACCCCGCGGCG 0: 2
1: 0
2: 0
3: 0
4: 14
Right 1105389150 13:19959026-19959048 CGCTGCCGCGTCGGGGCCTCGGG 0: 1
1: 0
2: 0
3: 6
4: 118
1105389132_1105389150 24 Left 1105389132 13:19958979-19959001 CCTCCCACCGACCCGGGATTAAT 0: 1
1: 0
2: 0
3: 12
4: 62
Right 1105389150 13:19959026-19959048 CGCTGCCGCGTCGGGGCCTCGGG 0: 1
1: 0
2: 0
3: 6
4: 118
1105389134_1105389150 20 Left 1105389134 13:19958983-19959005 CCACCGACCCGGGATTAATACCC 0: 2
1: 0
2: 0
3: 6
4: 82
Right 1105389150 13:19959026-19959048 CGCTGCCGCGTCGGGGCCTCGGG 0: 1
1: 0
2: 0
3: 6
4: 118
1105389135_1105389150 17 Left 1105389135 13:19958986-19959008 CCGACCCGGGATTAATACCCCGC 0: 2
1: 0
2: 0
3: 2
4: 22
Right 1105389150 13:19959026-19959048 CGCTGCCGCGTCGGGGCCTCGGG 0: 1
1: 0
2: 0
3: 6
4: 118
1105389138_1105389150 12 Left 1105389138 13:19958991-19959013 CCGGGATTAATACCCCGCGGCGC 0: 2
1: 0
2: 0
3: 1
4: 8
Right 1105389150 13:19959026-19959048 CGCTGCCGCGTCGGGGCCTCGGG 0: 1
1: 0
2: 0
3: 6
4: 118
1105389140_1105389150 0 Left 1105389140 13:19959003-19959025 CCCCGCGGCGCGGCCGCCGTCGC 0: 2
1: 0
2: 4
3: 59
4: 442
Right 1105389150 13:19959026-19959048 CGCTGCCGCGTCGGGGCCTCGGG 0: 1
1: 0
2: 0
3: 6
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105389150 Original CRISPR CGCTGCCGCGTCGGGGCCTC GGG Intronic
905345465 1:37308301-37308323 CGCTGCCGCGTGGGGGGCCACGG - Intergenic
908356841 1:63330342-63330364 CGCTGCCGGTTCGCGGCCTGGGG - Intergenic
908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG + Intergenic
910787974 1:91021607-91021629 CGCTGCGGCGTCGGAGGATCCGG - Intronic
911299698 1:96157252-96157274 GGCTGCCGCGTGGGGCCCTTGGG + Intergenic
917876863 1:179293915-179293937 CGCTGCCGGGCGCGGGCCTCAGG + Exonic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
1066180551 10:32957827-32957849 CGCTGTCACGTCGGGGCTGCCGG - Exonic
1067205680 10:44210027-44210049 CGCTGCAGTGTCTGGGCCTTAGG + Intergenic
1068669501 10:59709485-59709507 CCCGGCCTCGGCGGGGCCTCCGG + Exonic
1070895844 10:79982370-79982392 CGCTCCCGCGGCGGGGCCGTGGG + Intronic
1073577804 10:104640464-104640486 CGCTGCCGCGTGGGGGCACCTGG - Intergenic
1075334435 10:121598263-121598285 AGCTGCGGCCTCGGGGCCCCCGG + Exonic
1075492139 10:122880197-122880219 CGCTCATGCCTCGGGGCCTCGGG - Intergenic
1076368213 10:129935777-129935799 CCCTGCCACACCGGGGCCTCAGG + Intronic
1076374234 10:129972834-129972856 CGCGGCCGCCTGGGGGCCGCGGG + Intergenic
1077489818 11:2855621-2855643 CCCTGCGGCGTGGGGGCCTGCGG + Intergenic
1077514210 11:2992064-2992086 GGCGGCCGCGGCGGGGCCTGGGG - Intronic
1083432597 11:62622026-62622048 CGCTGCAGGGGCGGGGCCTGCGG - Exonic
1084295985 11:68213616-68213638 CGCCGCCGCGTCGCCGCCCCCGG + Intronic
1085037536 11:73309100-73309122 CGGTGCCGCGTGGGAGCCTCCGG + Exonic
1091259801 11:134225023-134225045 CGCTCGCGCATCGGGCCCTCTGG + Exonic
1092256150 12:6927849-6927871 CCGCGCCGGGTCGGGGCCTCGGG + Intronic
1103474811 12:121210435-121210457 AGCCGCCGCGCCGGGGCCCCGGG + Intronic
1104031900 12:125070867-125070889 AGCTGCCTCATCGGGCCCTCAGG - Intronic
1105389150 13:19959026-19959048 CGCTGCCGCGTCGGGGCCTCGGG + Intronic
1105432613 13:20350961-20350983 CGCTGCTGGGGCTGGGCCTCGGG + Intergenic
1110630101 13:77697853-77697875 CGCCGCCGCGCCGGCTCCTCGGG - Intronic
1112561725 13:100521311-100521333 CGCTGCCGGCTCGGGACTTCAGG - Intronic
1113379008 13:109786321-109786343 CGCTGCCTCCTCGGGCTCTCGGG + Exonic
1113439932 13:110320295-110320317 CCCTGCCGCGTGGGTGCCACTGG + Intronic
1113694142 13:112331987-112332009 CGCAGCCGCGCCTTGGCCTCCGG + Intergenic
1113737428 13:112689041-112689063 CGCTGCCCCGTCTGGGTCTTAGG - Intergenic
1114674116 14:24429846-24429868 AGCGGGCCCGTCGGGGCCTCTGG + Intronic
1115490147 14:33950885-33950907 CGCTGCAGCGTCGGGGACAAGGG + Exonic
1116862450 14:50005500-50005522 GTCTGCTGCTTCGGGGCCTCAGG - Intronic
1119520192 14:75279253-75279275 CGGTGCCGGCTCGGGGGCTCGGG + Intronic
1122094838 14:99363194-99363216 ACCTGCCGCCTCGGGACCTCAGG - Intergenic
1131180035 15:90233470-90233492 CGGTGCCACGCTGGGGCCTCAGG + Intronic
1132685659 16:1161000-1161022 CGAGGCAGCGTGGGGGCCTCCGG - Intronic
1132731112 16:1362466-1362488 CACTGCCGCTGCAGGGCCTCTGG - Exonic
1132751346 16:1459280-1459302 AGCAGACACGTCGGGGCCTCAGG + Intronic
1132751394 16:1459457-1459479 AGCACACGCGTCGGGGCCTCAGG + Intronic
1133298355 16:4766785-4766807 CGGGGCCGCGTAGGGGCTTCAGG - Intronic
1138608324 16:58103199-58103221 CTCTCCCACGTTGGGGCCTCAGG - Intergenic
1139570254 16:67807045-67807067 CCCCGCCGCGGGGGGGCCTCTGG + Intronic
1141086127 16:81096566-81096588 TGCTGCCTCTTCCGGGCCTCAGG - Intergenic
1142067159 16:88069141-88069163 CGCTGTCGCTGCGGGACCTCGGG + Intronic
1142371829 16:89686877-89686899 CGCTGCCGCGCCGAGGCTTCCGG + Intronic
1147599155 17:41734959-41734981 AGCTGCCGCGCCGGGGTTTCGGG + Intergenic
1147944154 17:44070837-44070859 CGCTGGCGGGGCGGGGCCTGGGG + Exonic
1148110962 17:45144466-45144488 CGCCGCCCCGTCGGGGACGCGGG + Intergenic
1150060677 17:62065686-62065708 CGCTGCCGCGCCGGGGGCCTGGG - Intergenic
1151779966 17:76239663-76239685 CGCTGCCGTCTCCTGGCCTCTGG - Intronic
1156474281 18:37395785-37395807 GGCTGCCATGTGGGGGCCTCAGG - Intronic
1158434949 18:57428799-57428821 GGCTGCGGCGTCGAGGCCGCGGG - Intergenic
1158954165 18:62523606-62523628 CGCCGCCGCCCCGGGGACTCGGG + Exonic
1159955520 18:74515969-74515991 CGCTGCAGCGTGGGTGGCTCAGG - Intronic
1160452378 18:78974249-78974271 CTCGGCCTCGACGGGGCCTCGGG + Intergenic
1160784465 19:892988-893010 CGCAGCCGTGGCGGGGCCTGCGG - Intronic
1160792561 19:929406-929428 CACTGCAGCGTGGGGGCCGCGGG - Exonic
1161175899 19:2841919-2841941 CGCTGCGGCTTCGGGACCCCCGG + Intronic
1161315078 19:3613991-3614013 CGCTGCTGCCTCCCGGCCTCTGG - Intronic
1162821620 19:13226713-13226735 CGCTGCCTTGGCGGGGCCTGGGG - Intronic
1163517945 19:17776088-17776110 CGCTGCTGCCTCGGGGCTGCAGG - Exonic
1164958428 19:32406043-32406065 GGCCGCGGCGTCGGGGCGTCGGG + Intronic
1165065720 19:33226809-33226831 GGGGGCCGCGTCGGGGCCACCGG + Intergenic
1167643642 19:50694919-50694941 CGCTGCGCCGCCGGGGCCCCAGG + Intronic
1168280810 19:55304633-55304655 CGCTGCCTTCTCGGGGCCCCAGG + Exonic
1168452545 19:56477483-56477505 CGCTGAGGGGTCGGGGCCTCAGG - Intronic
927935081 2:27071776-27071798 CGCGGCTGGGGCGGGGCCTCGGG + Intergenic
927957394 2:27217395-27217417 CGCGGCAGCGTAGGAGCCTCGGG - Exonic
931348716 2:61470479-61470501 CGCGGCCGCCGCGGCGCCTCGGG - Intronic
932812279 2:74835056-74835078 CGCTGCCGCGTGGGGCCGCCGGG + Intronic
943639541 2:190343642-190343664 CGCTGCCGCCTCGGGGCTCCCGG - Exonic
948345301 2:237291502-237291524 TGCTGCCGCTCCTGGGCCTCTGG + Intergenic
948844022 2:240674661-240674683 GGCAGCCCCATCGGGGCCTCTGG + Intergenic
948849788 2:240699974-240699996 GGCAGCCCCATCGGGGCCTCTGG - Intergenic
949040075 2:241844025-241844047 CGCTGCAGGGTCGGGGGCGCGGG + Intergenic
1170150534 20:13221865-13221887 CGCGGCCGCGTCGGGCCCGTCGG - Exonic
1176234552 20:64048398-64048420 CTCTCCAGCGGCGGGGCCTCGGG + Exonic
1178914050 21:36697310-36697332 AGCTGCCGGCTCCGGGCCTCTGG - Intergenic
1179167334 21:38945079-38945101 CGCTGCTGGGCAGGGGCCTCCGG + Intergenic
1184472116 22:44702104-44702126 CGCGGGCGGGGCGGGGCCTCAGG - Intronic
949461947 3:4303431-4303453 AGCTGCTCAGTCGGGGCCTCAGG - Exonic
953407054 3:42664736-42664758 CCCCTCCTCGTCGGGGCCTCAGG - Exonic
954152038 3:48662599-48662621 GGCCGCCGTGGCGGGGCCTCGGG - Exonic
954933622 3:54306660-54306682 CGCTGCCCTCTCAGGGCCTCAGG + Intronic
956454522 3:69407768-69407790 TGCAGCCGCGTCTGGGCCTATGG - Intronic
967982364 3:195073291-195073313 CCCTGCCTCGTAGAGGCCTCAGG - Intronic
968213398 3:196868021-196868043 TGCTGCCGCGACGGGGCCGGCGG + Exonic
969240383 4:5893128-5893150 CGGGGCCGGGGCGGGGCCTCTGG + Intergenic
969405222 4:6987144-6987166 CGCTGCCGGCTCGGCGCGTCAGG - Intronic
974716016 4:65669688-65669710 CGCCGCCGCTTGGGGGCCGCCGG + Exonic
981270995 4:142846874-142846896 CGCAGCAGCGTGGCGGCCTCGGG - Intronic
983904439 4:173169215-173169237 CGCTGCCGCGGCAGCGGCTCGGG + Intronic
984167531 4:176320297-176320319 GGCTGCCGTGCCGGGGCCGCGGG + Intronic
986748173 5:10761662-10761684 CGCTGCCGCGGCAGGGGCTGAGG - Intergenic
991702925 5:69332798-69332820 CGCTGCCGCCGCGCGTCCTCCGG + Intronic
993901204 5:93585082-93585104 CGCTGCGGGGTTGGGGCCGCCGG - Exonic
995106243 5:108381030-108381052 CGCTGCGGCGGCGGGGGCTGCGG - Exonic
1003872298 6:10412726-10412748 CGCAGCCGAGTCTGGGACTCGGG + Intronic
1006193307 6:32222546-32222568 CGCTGCCACATCCAGGCCTCGGG - Exonic
1018191737 6:161315020-161315042 CGCCGCCTTGTGGGGGCCTCAGG - Intergenic
1019379208 7:712428-712450 CGCAGCCGCCTCCTGGCCTCGGG - Intronic
1021716665 7:23468656-23468678 TGGAGCCGCGTCCGGGCCTCGGG - Intronic
1025263944 7:57440364-57440386 CTCTGCCATGTGGGGGCCTCAGG + Intergenic
1025635290 7:63315744-63315766 CTCTGCCATGTGGGGGCCTCAGG - Intergenic
1025647405 7:63432426-63432448 CTCTGCCATGTGGGGGCCTCAGG + Intergenic
1029374826 7:100171338-100171360 CGCCGCCGTGTCGGGACATCGGG + Exonic
1033477213 7:141702262-141702284 CGCCTCCGCGGCGGGGCCCCGGG - Intergenic
1035312701 7:157979891-157979913 AGCTGCCCAGTCGGGGGCTCTGG - Intronic
1035676976 8:1462807-1462829 CGCCGCCGTGTGGGGGCCTGAGG - Intergenic
1048554022 8:135457749-135457771 TGCTGCCGCGTCTGGCCCCCGGG + Exonic
1049396471 8:142403270-142403292 CGGCTCCGCGCCGGGGCCTCTGG - Intergenic
1053306208 9:36986344-36986366 CGCGGCCGCGGCGGGGCCCGGGG - Intronic
1057708077 9:97412153-97412175 GGCGGCCGCGGCGGGGCCCCTGG + Exonic
1061015975 9:127980933-127980955 GGCTGCAGCGTCGGGGCCGCAGG - Intergenic
1061582632 9:131546753-131546775 CGCTGCCTGGCGGGGGCCTCGGG - Intergenic
1062158715 9:135068117-135068139 CTCTGCCGGGTCAGGACCTCAGG + Intergenic
1062363707 9:136199137-136199159 CGCGGGGACGTCGGGGCCTCAGG + Intronic
1187403598 X:18983936-18983958 CGCTGCGGCCTGGGAGCCTCGGG - Exonic
1189075024 X:37905862-37905884 CGCCGCCGCCTGGGGGCATCCGG + Intronic
1195278913 X:103310727-103310749 CGGTCCCGCGGCGGGGCCCCGGG + Exonic
1195599156 X:106726678-106726700 GGCTGCCGCGTCGGGCTCTGGGG - Exonic