ID: 1105389466

View in Genome Browser
Species Human (GRCh38)
Location 13:19960281-19960303
Sequence GCTCACGTTACCCGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 43}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105389461_1105389466 0 Left 1105389461 13:19960258-19960280 CCAGACGACGGGCTTCTGCAGCT 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1105389466 13:19960281-19960303 GCTCACGTTACCCGGGAGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 43
1105389456_1105389466 28 Left 1105389456 13:19960230-19960252 CCTGCTGCTGCAATACCAACCTC 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1105389466 13:19960281-19960303 GCTCACGTTACCCGGGAGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 43
1105389457_1105389466 13 Left 1105389457 13:19960245-19960267 CCAACCTCAGCAACCAGACGACG 0: 1
1: 0
2: 1
3: 2
4: 55
Right 1105389466 13:19960281-19960303 GCTCACGTTACCCGGGAGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 43
1105389460_1105389466 9 Left 1105389460 13:19960249-19960271 CCTCAGCAACCAGACGACGGGCT 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1105389466 13:19960281-19960303 GCTCACGTTACCCGGGAGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105389466 Original CRISPR GCTCACGTTACCCGGGAGGA GGG Intronic
900732640 1:4272308-4272330 TCTCACGTAACCTGGGAGGTAGG + Intergenic
901235372 1:7664748-7664770 CACCACGTTGCCCGGGAGGATGG - Exonic
903682635 1:25107303-25107325 GCTCAGCTGACCCGGGAGAAGGG - Intergenic
918237381 1:182593510-182593532 GCTCATGTTACCCAGGAGAGGGG + Intergenic
920175576 1:204099528-204099550 GCCCAAGCTACTCGGGAGGATGG - Intronic
1062822789 10:547535-547557 GTTCACATTATCCAGGAGGAAGG + Intronic
1075885498 10:125896229-125896251 GCTCCCGATTCCCGGGAGGGCGG + Intronic
1084940361 11:72609367-72609389 GCTCACTTTCCCCAGAAGGAAGG + Intronic
1089905682 11:122035828-122035850 GCCCATGCTACCCTGGAGGAGGG + Intergenic
1094424741 12:30306053-30306075 GCCCACAATACCTGGGAGGAGGG - Intergenic
1101609794 12:106279980-106280002 GCTCATGGTACCCTGCAGGATGG - Intronic
1104013925 12:124950103-124950125 GCCCACGGTACCCGAGATGAGGG + Intronic
1104920358 12:132287424-132287446 GCTCAAGTTACACAGGCGGATGG - Intronic
1105389466 13:19960281-19960303 GCTCACGTTACCCGGGAGGAGGG + Intronic
1111788769 13:92826154-92826176 GATCACGTTACCAGGCAGAAGGG + Intronic
1117337715 14:54768770-54768792 GCTAAGGTCACCCGGGAAGAAGG + Intronic
1124407406 15:29404682-29404704 GCTTAGGGTACCCTGGAGGATGG - Intronic
1128236948 15:66074122-66074144 GCTCAGGTTACCCCTGGGGAAGG - Intronic
1131273831 15:90963853-90963875 GCCCCAGCTACCCGGGAGGATGG - Intergenic
1132457037 16:29741-29763 GCTCAGGTTCCCCGGGAGCCTGG + Intergenic
1142482128 17:225588-225610 GCTCACACTTCCCGGGAGCAGGG + Intronic
1145745905 17:27319508-27319530 GCTCATGTCACCCAGGGGGATGG - Intergenic
1150463454 17:65371971-65371993 GCTGACCTTGCCAGGGAGGAAGG - Intergenic
1160169332 18:76539958-76539980 GCTCACGTGACTGTGGAGGAGGG - Intergenic
1163012188 19:14433291-14433313 GGTCACGTGACCCCGGAGGTCGG - Intronic
1164206298 19:23061600-23061622 ACTCACATTACCTGGGAGCAAGG + Intergenic
1164294432 19:23897209-23897231 ACTCACATTACCTGGGTGGAAGG - Intergenic
1175962333 20:62643274-62643296 GCTCCCCTGACCAGGGAGGATGG + Exonic
1182425727 22:30271091-30271113 GCTGACGTGGCCCGGGAAGAGGG - Intergenic
962866456 3:139451574-139451596 CCTCATGTTAGCCGGGAGAACGG - Intergenic
969093208 4:4712448-4712470 GCTTACGTTTCCCAAGAGGAGGG + Intergenic
982712176 4:158768865-158768887 GCTCACGTAACCCCGGCGGGAGG - Intergenic
984699041 4:182806857-182806879 GCGGACGATTCCCGGGAGGAAGG - Intergenic
1000747272 5:165049158-165049180 GCTCAAGTTACCCTCAAGGAAGG - Intergenic
1002638872 5:180621197-180621219 GCTCACGTTCACCAGGAGGTCGG + Exonic
1022675413 7:32495265-32495287 GCTTACGTGACCCGGGCGGCTGG - Intronic
1026538730 7:71261948-71261970 GCTCACGGCTCCCGGGAAGAGGG - Intronic
1037919934 8:22798625-22798647 ACTCACGGTTCCCGAGAGGAGGG - Intronic
1042484439 8:69335062-69335084 GCCCACGATACCAGTGAGGAAGG - Intergenic
1044734874 8:95269018-95269040 GCTCAGGTTAACCGGGCGGGAGG - Exonic
1044870100 8:96611106-96611128 GCTCACGTTACAGGGAAGGAGGG + Exonic
1049468877 8:142766507-142766529 CCTCACTTTACCCAGGAGGACGG + Intronic
1062371452 9:136241260-136241282 GCTCACTGGACTCGGGAGGATGG - Intronic
1062383649 9:136299610-136299632 GCTCCCATTGCCCGGGATGAAGG + Intronic
1197699662 X:129589305-129589327 GCTGACATTACCAGGAAGGATGG + Intronic
1197706261 X:129636797-129636819 GCACACGTTACCTGGGAGTATGG + Intergenic
1200399324 X:156009985-156010007 GCTCAGGTTCCCCGGGAGCCTGG - Exonic