ID: 1105390330

View in Genome Browser
Species Human (GRCh38)
Location 13:19971131-19971153
Sequence CAGGTAAGGGGAAGAATTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105390324_1105390330 21 Left 1105390324 13:19971087-19971109 CCTAGATTGTAGGTAGGGATCAA 0: 1
1: 0
2: 0
3: 2
4: 65
Right 1105390330 13:19971131-19971153 CAGGTAAGGGGAAGAATTGTAGG 0: 1
1: 0
2: 2
3: 12
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105390330 Original CRISPR CAGGTAAGGGGAAGAATTGT AGG Intronic
903854958 1:26331620-26331642 TAGGGAAGGGGAAGAAATGGAGG + Intronic
903953800 1:27011646-27011668 CAGATAAAGGGAAGAGTTGGAGG + Intronic
905445729 1:38027441-38027463 CAGGTGAGTGGAGGAATTGGGGG + Intergenic
907200672 1:52724056-52724078 TAGGTGAGAGGAAGAATTGCTGG + Intergenic
907592269 1:55686520-55686542 CAGGCAAGGGGAAGAGGGGTAGG - Intergenic
908926176 1:69257838-69257860 CAGGTACAGGGAAGGAATGTAGG - Intergenic
910425581 1:87117308-87117330 CACCTAAGGGGAAGAAGTGCAGG - Intronic
910995560 1:93100991-93101013 CAGGGAAGGGAAGAAATTGTGGG + Intronic
913409026 1:118530487-118530509 CATGTAAGGGGAAGACTGATAGG - Intergenic
914194267 1:145436951-145436973 CAGGTGAAGAGAAGAATTCTGGG + Intergenic
914475593 1:148019827-148019849 CAGGTGAAGAGAAGAATTCTGGG + Intergenic
914675426 1:149904231-149904253 CAGATTAGGGGAGGAACTGTGGG + Exonic
915312510 1:155011589-155011611 CTGGTAGGGGGAAGAACTGGGGG - Intronic
916118570 1:161508774-161508796 CAGTGAAGGGAAGGAATTGTTGG + Intronic
917081407 1:171260153-171260175 CACGTAAGAGGAAGAATGGGAGG + Intronic
917625492 1:176841929-176841951 CAGGGAAGGGCAAGAGATGTGGG - Intronic
917828591 1:178851865-178851887 CAGGGATGGGGGAGAATTGTTGG + Intronic
921571167 1:216780343-216780365 CAGGGAAAGAGAAGAATTGCTGG - Intronic
923914380 1:238485746-238485768 GAGGGAAGGGAAAGAATTATTGG + Intergenic
924749855 1:246876280-246876302 TAGGTAGGGGGAAGATTTTTTGG - Intronic
1062977161 10:1692583-1692605 CAGTGAAGGGGAGGAATTGGAGG + Intronic
1067185004 10:44020071-44020093 CAGGTAATGGAAAGAACTGAAGG - Intergenic
1068388382 10:56360718-56360740 CAAGGAAGGGGAAGAATGCTGGG + Intronic
1068961541 10:62871689-62871711 CAGGTAACAGGAACAATTTTAGG + Intronic
1069632893 10:69908165-69908187 CAGGAGAGGGGCAGAAATGTTGG + Intronic
1069851501 10:71408477-71408499 CAGGTGAGGGGGAGAATTTGGGG - Intronic
1070619726 10:77999961-77999983 CAGGTAACCTGAAGAAATGTAGG - Exonic
1072559334 10:96556278-96556300 CAGGTAAGAGGCAGTATTGTTGG - Intronic
1074007482 10:109442701-109442723 TAGGTAAGGGGATGGAGTGTTGG - Intergenic
1075257138 10:120934278-120934300 CAGATAAGGGGAGGCATTGGGGG - Intergenic
1078129919 11:8604970-8604992 TAGGAAAGGGGAAGAATGGGAGG + Intergenic
1080879075 11:36302261-36302283 CGGGGATGGGGAAGAATTTTGGG + Intronic
1082751093 11:57018634-57018656 CATGAAAGGGCAAGAATTGGGGG - Intergenic
1087633526 11:100677843-100677865 TAGGCAAGGGGAAAAATGGTAGG - Intergenic
1089067951 11:115676310-115676332 CAGGGAAGAGGAAGGTTTGTGGG - Intergenic
1089599697 11:119605712-119605734 CAGGGAAGGGGAAGAAGGGATGG - Intergenic
1090590912 11:128266870-128266892 CTGATAAGGGGAAGAATGATAGG - Intergenic
1090948071 11:131449076-131449098 CAGGGAAGGGGAAGAAGGGAGGG + Intronic
1091334077 11:134753674-134753696 CAGGTAAGGAGAAGGATTGTGGG - Intergenic
1091671646 12:2456497-2456519 CAGGGAAAGGGGAGAACTGTGGG - Intronic
1092156500 12:6285226-6285248 CAGGCCAGAGGAAGAAATGTAGG + Intergenic
1093196574 12:16136579-16136601 AGGGTGAGGGGAAGATTTGTTGG + Intergenic
1095247272 12:39937540-39937562 AAGGTAAGGAGAAGAAATGGAGG - Intronic
1095946563 12:47757245-47757267 CAGGGAGGGGAAAGAATGGTGGG - Intronic
1096418816 12:51438271-51438293 AAGGCAAGGGGGAGAAGTGTAGG - Intronic
1096859789 12:54516990-54517012 AAGGCAAGAGGAAGAAATGTTGG + Exonic
1097370540 12:58774194-58774216 CAAGTATGGGGAATAATTGAAGG - Intronic
1099628964 12:85115593-85115615 CAGGTATGGGGAACAATTCTAGG - Intronic
1101083117 12:101209149-101209171 CAGGCAAGGGGAAAGATTTTTGG - Intronic
1101499019 12:105283984-105284006 CAGGTAAGGGGCTGACTGGTAGG + Intronic
1105290990 13:19053294-19053316 CAGGTCAGAGGAAGAGTGGTCGG - Intergenic
1105390330 13:19971131-19971153 CAGGTAAGGGGAAGAATTGTAGG + Intronic
1105503547 13:20991751-20991773 CATTTAAGGGGAAGAACTGTGGG + Intronic
1106935545 13:34714663-34714685 CAGGTAAGAGGAGGAAGAGTGGG + Intergenic
1108455490 13:50609567-50609589 CTGTTCAGGGGAAGAATTGGAGG - Intronic
1109498009 13:63200237-63200259 CAGGTAATTGCAAGAATTTTAGG - Intergenic
1111054858 13:82936239-82936261 CAGTTAATGGGAAGAAGTATAGG - Intergenic
1112870363 13:103963463-103963485 AAGGTAAGGGGAATACTTTTAGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114483934 14:23052172-23052194 CAGGTAAGGGAATGACTTGAGGG + Intronic
1114658665 14:24331188-24331210 CAGGTATGAGGAAGAATGGCTGG - Exonic
1114758937 14:25290200-25290222 CAGGTAAGGAGGAGAATTTCAGG + Intergenic
1120535072 14:85684350-85684372 AGGGTAAGGGAAAGAATTCTTGG - Intergenic
1121579014 14:95012430-95012452 GAAGTAGGGGGAAGAATTGGAGG - Intergenic
1121579229 14:95014340-95014362 GAAGTAGGGGGAAGAATTGGAGG - Intergenic
1122309827 14:100787503-100787525 CAGGGACGGGGAAGAAATGTGGG - Intergenic
1124001565 15:25764745-25764767 CAGGTGATGGGAAGAAGTGAAGG - Intronic
1124504430 15:30261142-30261164 CAGGTACGGGGACGAATTTAAGG + Intergenic
1124739121 15:32277493-32277515 CAGGTACGGGGACGAATTTAAGG - Intergenic
1134821581 16:17251523-17251545 CAGCAAAGGGGAAGAAATGCAGG + Intronic
1138015949 16:53428821-53428843 AAGATAAGGGAAAGAAGTGTTGG + Intergenic
1138196992 16:55059152-55059174 CAGGTAAGGGGATAGATTGATGG + Intergenic
1139255742 16:65540631-65540653 CAGTTGTGGGGAAGAATAGTTGG + Intergenic
1141000456 16:80302712-80302734 GAGGTGAGAGGCAGAATTGTGGG - Intergenic
1141032604 16:80602725-80602747 CAGGAAAGGGGAAGAAGGGGAGG + Exonic
1141342089 16:83212777-83212799 CAGGGTAGGGGGAGAATTGCTGG - Intronic
1142823720 17:2493796-2493818 CAGGAAGGGGGAAGATTTCTGGG + Intronic
1143208349 17:5162996-5163018 CAGGAAAGGGTAAGAATTTAGGG + Exonic
1143623709 17:8096088-8096110 AAGGGGAGGGGAAGAATTGGAGG - Intronic
1144711712 17:17405638-17405660 CAGGGAATGGGAAGCATTGTAGG + Intergenic
1145107854 17:20134848-20134870 GAGAAAAGGGAAAGAATTGTAGG + Intronic
1146532830 17:33624533-33624555 CAGGTATGGGTAAGGATTCTAGG + Intronic
1147561887 17:41514354-41514376 CATGAAGGGGGATGAATTGTGGG + Intronic
1147575633 17:41597677-41597699 GAGGGAAGGGGAAGAAGAGTTGG + Intergenic
1147780980 17:42941832-42941854 CTGCTAAGGGGAAGAAAAGTTGG + Intergenic
1149390841 17:56189060-56189082 CAGGTATAGGGAAGAGGTGTGGG - Intronic
1149625843 17:58080221-58080243 CAGGGAAGGGGAACAAGTCTGGG + Intergenic
1150095043 17:62366599-62366621 CAGGAAAGGGGAAATATTGCAGG - Intergenic
1151666455 17:75547873-75547895 AAGGTGAGGGGAGGAAGTGTAGG + Intronic
1154328445 18:13409298-13409320 CAGGGAAGGGGGAGATGTGTGGG + Intronic
1154935934 18:21056773-21056795 TAGGCAAGGGGGAGAATTGTAGG - Intronic
1157709660 18:49841528-49841550 TAGGTAAGGGTAGGAAATGTGGG - Intronic
1157797555 18:50588896-50588918 ACGGTAATGGGAAGAACTGTTGG + Intronic
1157842849 18:50975670-50975692 CAGGTACTGTGAAGAGTTGTAGG - Intronic
1159938091 18:74384584-74384606 CAGTTTGGGGGAAGAATGGTGGG - Intergenic
1160338049 18:78060200-78060222 CAGGTAAGGGAGAGAATGGGGGG - Intergenic
1166428232 19:42698702-42698724 CAAGTAGGGGGAAGAATATTTGG - Intronic
927051225 2:19331244-19331266 AAGGTAAGGGGAAACAATGTGGG - Intergenic
928125424 2:28612206-28612228 CAGGGAAAGGGGAGACTTGTCGG + Intronic
929719241 2:44350672-44350694 GGGGTAAGGAGAAGAATTGGAGG - Intronic
929818158 2:45252328-45252350 CCGGAGAGGGGAGGAATTGTTGG + Intergenic
930495637 2:52138393-52138415 CTGGTTAGGGAAAGAAGTGTAGG + Intergenic
930774812 2:55161268-55161290 CAGAAAAGGGAAAGAAATGTAGG - Intergenic
931201800 2:60104803-60104825 CAGGTGAGGGAAAGAAGAGTGGG + Intergenic
931840725 2:66145368-66145390 CAGGGAAGGGGAAAAAATGATGG - Intergenic
933937195 2:87216421-87216443 CAGGTAAGGAAGAGAGTTGTTGG - Intergenic
936355948 2:111749403-111749425 CAGGTAAGGAAGAGAGTTGTTGG + Intergenic
939521914 2:143242009-143242031 CAGGAAATGGGAAGAAATATGGG - Intronic
939756981 2:146126375-146126397 GAGGTAGGGGAAAGAATTGAAGG - Intergenic
939955925 2:148527610-148527632 CAGGTAACAGGAAGAGATGTGGG + Intergenic
940542333 2:155037185-155037207 TAGGTAAGAGGAAGAAAAGTAGG + Intergenic
940852662 2:158703061-158703083 CAGGTACTGGGAAGAATGGAGGG + Intergenic
940965889 2:159836830-159836852 CAGCAAAGGGGAAGAAATGCAGG - Intronic
945366633 2:208962779-208962801 CAGGTAAGAGAAAGAAATGAGGG + Intergenic
945516664 2:210770875-210770897 CAGGCAAGGGAAAGAAATGAAGG + Intergenic
945929867 2:215843950-215843972 AAGGTGAAGGGAGGAATTGTCGG - Intergenic
946673228 2:222128723-222128745 CAGGTAAGGGGATGTCTTCTGGG + Intergenic
947161508 2:227219978-227220000 CAGGGAAGGTGAAGAAATCTTGG - Intronic
1169078062 20:2774400-2774422 CATGTGAGGAGAAGAATTGGGGG - Intergenic
1169666068 20:8037633-8037655 CAGTAAAAGGAAAGAATTGTTGG + Intergenic
1169681285 20:8216937-8216959 CTGGTAAGGGGGAGAATAGGAGG - Intronic
1171307214 20:24116845-24116867 GGGGGAAGGGGGAGAATTGTAGG + Intergenic
1173006893 20:39146795-39146817 GAGGTGAGAGGAAGAATTGAGGG - Intergenic
1173442226 20:43087885-43087907 CTGGGAAGGGGAAGAATGGATGG + Intronic
1173448519 20:43141666-43141688 ATGGTAAGGGGAAGAATTAATGG + Intronic
1173590084 20:44217895-44217917 CAGATAAGGTTAAGAATTGTAGG - Intergenic
1173877460 20:46383292-46383314 CAGCTAAGAGGAAGAACTCTTGG + Intronic
1175802888 20:61811213-61811235 CAGGTGAAGTGAAGAATTGCTGG + Intronic
1175806296 20:61830999-61831021 CAGGGAAAGGGAAGAACTCTGGG + Intronic
1176161285 20:63650212-63650234 CAGTGAAGGGGAAGGATGGTGGG - Intronic
1177552929 21:22649268-22649290 GAGGAAAGGGAAAGAATGGTCGG + Intergenic
1178285771 21:31324046-31324068 CAAGAAAAGGGAAGAATTGGTGG + Intronic
1179026005 21:37678907-37678929 CATGTAAGGGGAAGGAACGTAGG - Intronic
1179213860 21:39349440-39349462 CAGGTATCCAGAAGAATTGTGGG - Intronic
1180069423 21:45428780-45428802 CATGAAAAGGGATGAATTGTGGG - Intronic
1182585528 22:31342459-31342481 CAGAAAAGGGGAAGAGTGGTTGG + Intronic
1184943545 22:47785197-47785219 GAGGTAACGGGAAGAATGGGAGG + Intergenic
951933265 3:27993720-27993742 TAGGTAAGGTGGAGAGTTGTAGG + Intergenic
954273813 3:49529553-49529575 CAGGGAGGGGGAAGCATTTTAGG + Intronic
954291071 3:49650320-49650342 CAGAAAAGGGGGAGAACTGTGGG - Intronic
955765844 3:62343265-62343287 GAGGTCAGGGGTAGAATGGTAGG - Intergenic
956226700 3:66967939-66967961 CAGGTAATGGTAAGTATGGTAGG - Intergenic
956232426 3:67031690-67031712 GAGGTAAGGGCTAGAATGGTTGG - Intergenic
956870862 3:73416534-73416556 CAGGTTAGGGTAAGAATAGTAGG - Intronic
957569894 3:81933096-81933118 CAGGTGTGGGGAAGAACTGTAGG + Intergenic
959499257 3:107086937-107086959 CAAGTAGGGGGAAGCATTGGTGG + Intergenic
959813735 3:110650836-110650858 CAGGTAATATGAAGAATAGTGGG + Intergenic
959933025 3:112003087-112003109 CAGGTAGCAGGAAGAACTGTAGG + Intronic
960417747 3:117406062-117406084 CAGGTAAGAGGAAGGAATTTTGG + Intergenic
961049292 3:123733347-123733369 CAGGCAAGGGGAAGAAAGGGCGG + Intronic
964430795 3:156604250-156604272 CTGGGAAGGGGAAGCATTTTAGG - Intergenic
964616214 3:158668823-158668845 TAGAGAAGGTGAAGAATTGTAGG - Intronic
964778033 3:160301329-160301351 CAGGAAAGGAAATGAATTGTGGG - Intronic
965014517 3:163140048-163140070 TAGGAAAGGGGAAGAATTAGTGG - Intergenic
965390967 3:168103071-168103093 AAGGTAACAGGAGGAATTGTTGG + Intergenic
965533597 3:169801585-169801607 CAGGTAAGGGGAAGAAGTGGGGG - Intronic
966187753 3:177243651-177243673 CACGAAAGGGGAAGAACTTTTGG - Intergenic
967012872 3:185453003-185453025 CTGGAGAGGGGAAGAATTGGTGG + Intronic
967262949 3:187662213-187662235 CAGGTAAGGGAAATAATAATTGG + Intergenic
969049151 4:4360407-4360429 GAGGAATGGGGAAGAATTGGGGG + Intronic
969381664 4:6803316-6803338 AAGGTAAGAGAAAGATTTGTAGG + Intronic
970210252 4:13702486-13702508 CAAGTGAGAGGAAGAAATGTGGG - Intergenic
972816570 4:42652934-42652956 ACGGTGAGGGGAAGAATAGTAGG - Intronic
972816588 4:42653082-42653104 ACGGTGAGGGGAAGAATAGTAGG - Intronic
976987314 4:91317820-91317842 CAGGCAAGTGGAACAATTGGGGG + Intronic
979513140 4:121576533-121576555 CAGGGAAGTGGCAAAATTGTAGG + Intergenic
981480748 4:145236646-145236668 AGGGAAAGGGGAATAATTGTAGG + Intergenic
982560583 4:156924607-156924629 TAGGGAGGGGGAAGAAATGTCGG + Intronic
984694404 4:182765037-182765059 GAGATACGGGGAAGAATTGTAGG + Intronic
986227105 5:5826198-5826220 CAGGTAAGGTGAAGTACTGGGGG + Intergenic
988660832 5:33266415-33266437 CTGGTAAGAGACAGAATTGTAGG + Intergenic
988841054 5:35084450-35084472 TAGGTAAGGGGAAGGAAAGTGGG - Exonic
994257022 5:97609551-97609573 CAGGTGAGGGGAATTATTCTTGG + Intergenic
994336336 5:98570814-98570836 GGTGTCAGGGGAAGAATTGTTGG + Intergenic
994923661 5:106085403-106085425 CAGGTAAGGGTAAAAGTTGGTGG + Intergenic
995410923 5:111856097-111856119 GAGGCAAGGGGAAGCATGGTGGG + Intronic
997771823 5:136562126-136562148 TGGGTAAGGAGAAGAATTGGAGG + Intergenic
999516507 5:152307284-152307306 CAGTTAAGGCTAAGAAATGTTGG - Intergenic
1001156466 5:169276559-169276581 CAGGTAAGTGCAAGATTTGAGGG - Intronic
1001244677 5:170097083-170097105 CAGGTTAGGTGAAGAATAGAGGG + Intergenic
1001464939 5:171955531-171955553 GAGGTAAAGGGGAGAAATGTTGG + Intronic
1002382569 5:178840894-178840916 CAGGTTAGGGGCAGAATCCTTGG - Intergenic
1004129158 6:12902454-12902476 AAGGTAAGGGGAAGATTGTTGGG - Intronic
1007373035 6:41439320-41439342 CAGCTATGGGGAAGAATTCCTGG - Intergenic
1008708815 6:54198380-54198402 AAGGTATGAGGAAGAATTGAGGG + Intronic
1010355676 6:74929988-74930010 CAGGGAGGGGGAAGAATGGGAGG + Intergenic
1012496712 6:99841621-99841643 CAGGGAAGGGGAAGATTGGCAGG + Intergenic
1013367672 6:109447625-109447647 CAGGAAAGGGGATAAAATGTGGG + Intronic
1014678017 6:124391836-124391858 TAGGTAGGGGGAAGGATAGTAGG - Intronic
1018223232 6:161602994-161603016 CAGGTCAAGGGAAGTAATGTGGG - Intronic
1022116083 7:27261943-27261965 CAGGTAAGGAGAAAAATTAAGGG - Intergenic
1024397953 7:48890448-48890470 CAGGGGAGGGGAAGACTTGGAGG - Intergenic
1029936058 7:104425146-104425168 CAGTGAAGGGGAAGGAGTGTTGG + Intronic
1030906928 7:115197221-115197243 CAGGAAAAGGGAAGAGTTCTGGG + Intergenic
1031214882 7:118877342-118877364 AAGGAAAGGGGTAGATTTGTTGG + Intergenic
1032500671 7:132397435-132397457 CAGGTAGTAGGAAGAATTGGGGG + Intronic
1034787992 7:153942795-153942817 CAGGGAAGAGGCAGAATGGTAGG - Intronic
1035702723 8:1648885-1648907 CTTGAAATGGGAAGAATTGTGGG + Intronic
1037472291 8:19222687-19222709 CAGCTTAGGGGAAAAAATGTAGG + Intergenic
1037486938 8:19356703-19356725 CAGGAAAAGAGGAGAATTGTGGG + Intronic
1038489875 8:27963133-27963155 CAGGAAAGGGGAAGAAGAGATGG + Intronic
1041868093 8:62599630-62599652 CTGTAAAAGGGAAGAATTGTAGG + Intronic
1043390203 8:79784413-79784435 AAGGGAAGGGGAAGAAATGCTGG + Intergenic
1043779677 8:84315500-84315522 CAGGTCTAGGGGAGAATTGTAGG + Intronic
1045312847 8:101018167-101018189 CAGGAAAGGGGGAGAAAGGTTGG + Intergenic
1046020306 8:108657147-108657169 CAGGTTAGAGGGAGAATTCTTGG + Intronic
1047318833 8:123759721-123759743 CAAGTCAGGGAAAGAAATGTGGG - Intergenic
1047597635 8:126394855-126394877 CAGGGAAGGGAGAGAAATGTGGG - Intergenic
1048761531 8:137800981-137801003 CAGCTAAGGAGAAGAAGTGCAGG + Intergenic
1054874497 9:70081157-70081179 CAGGGAAGGGGAAGAAGGGCAGG + Intronic
1055066637 9:72125689-72125711 CAGGTCAATGGCAGAATTGTGGG + Intronic
1058457132 9:105147993-105148015 GAGGTGAAGGGATGAATTGTAGG - Intergenic
1059944956 9:119399961-119399983 CAAGTAAAGGCAAGAATTGCTGG + Intergenic
1185833766 X:3325718-3325740 CAGGTAAAAGGAAGAATCTTTGG + Intronic
1187591942 X:20726286-20726308 CAGGTAAGGTTAAGCTTTGTGGG - Intergenic
1188005774 X:25014790-25014812 CAGGGAAAGGAAAGAACTGTTGG - Intronic
1189208120 X:39259301-39259323 AAGGAAGGGGGAGGAATTGTTGG - Intergenic
1190291810 X:48998134-48998156 CAGGTAAGGGGATCCCTTGTGGG - Exonic
1190427393 X:50345942-50345964 CAGGTAGGGAGAAGAATTAGGGG + Intronic
1190967330 X:55313200-55313222 GAGGTGAGGGGAAGCATTGATGG - Intergenic
1192429573 X:71103152-71103174 CAGGGAAGGGGAAGAAGGGCAGG - Exonic
1192781044 X:74293859-74293881 CAGGGAAAGTGAAGAATTGAAGG - Intergenic
1192807154 X:74521132-74521154 CAGGTAAGGCTAAGAGTTGGTGG + Exonic
1193307675 X:79968803-79968825 CAGGTAAGAGAAAGAAATGAAGG - Intergenic
1193448071 X:81629676-81629698 CAGGTCTTGGGAAGAAGTGTAGG + Intergenic
1193569474 X:83124867-83124889 CAGAAAAGGGGATGATTTGTGGG - Intergenic
1195042742 X:101029102-101029124 CAAATAAGAGGAAGAATAGTAGG - Intronic
1195319989 X:103713912-103713934 AAAGAAAGGGAAAGAATTGTAGG - Exonic
1198892161 X:141409992-141410014 CAGGGAAAGGGAAGTATTTTAGG + Intergenic
1199542016 X:148967908-148967930 GGGGTAAGGGGAAGAACAGTGGG - Intronic
1199931412 X:152526890-152526912 AAGGCAAGGGGAACAATTGTAGG - Intergenic
1200813328 Y:7506511-7506533 CAGGTAAGGGGTGATATTGTGGG - Intergenic