ID: 1105395325

View in Genome Browser
Species Human (GRCh38)
Location 13:20028042-20028064
Sequence CTGGAATAAAGCAGAATTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 222}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105395325 Original CRISPR CTGGAATAAAGCAGAATTGT TGG (reversed) Intronic
905384102 1:37587777-37587799 ATGAAATAAAGCAGAGTTTTTGG - Intronic
909335934 1:74474038-74474060 CTGGCATAGAGCAGAATTTCTGG + Intronic
910568475 1:88673814-88673836 CTCTAATAAAGGAGAATTTTAGG + Intergenic
912258062 1:108081327-108081349 CTGGATTTGAGAAGAATTGTGGG - Intergenic
913088802 1:115462126-115462148 CTGTCATCCAGCAGAATTGTAGG - Intergenic
913539388 1:119804263-119804285 CTGAAATAAAACAGAAGAGTGGG - Intronic
916156012 1:161849267-161849289 TTGGAATAAAACAGACATGTTGG - Intronic
916461250 1:165027168-165027190 CTGCAATAAGGCAGAATTTTGGG + Intergenic
917477141 1:175378689-175378711 ATGGAAAGAAGCAGACTTGTGGG + Intronic
918176536 1:182051214-182051236 ATAGAATAAAGCAGAAGTGATGG - Intergenic
920613178 1:207462398-207462420 CTGGAAAAAATCAGTGTTGTTGG + Intronic
921075315 1:211695904-211695926 TTGGAATCAGGCAGAACTGTAGG - Intergenic
922378560 1:224996651-224996673 CTGTAATCAAGCAGAACTGCTGG + Intronic
922609617 1:226915668-226915690 CTGATGTATAGCAGAATTGTAGG - Intronic
924109744 1:240686776-240686798 CTGGAATACAAAAGAATTATAGG + Intergenic
1064091869 10:12392391-12392413 CAGGAACAAAGTAGAATGGTAGG - Intronic
1064627470 10:17275881-17275903 CTGGACTAAAAGAAAATTGTTGG + Intergenic
1067404048 10:46004254-46004276 ATGGAATGAAGCAGGATTGTTGG - Intergenic
1068303045 10:55170581-55170603 CTGGTAGAAAGCATAATTGATGG + Intronic
1070797500 10:79225216-79225238 CTGAAATAAAGCAGAGATGATGG - Intronic
1071039593 10:81290484-81290506 CAGGAATAAAGCCCACTTGTTGG - Intergenic
1072425068 10:95323247-95323269 CTGAAATACAGCAGACTTGATGG - Intronic
1073865900 10:107803329-107803351 CAGGAGTAAAGCAGGATTCTAGG + Intergenic
1074591191 10:114814994-114815016 CAGGAAAAAAGCAAAAATGTGGG - Intergenic
1075770324 10:124929129-124929151 CTGGAATGAAGCAAACTTTTGGG + Intergenic
1077719560 11:4614097-4614119 CTGGAATAAAACAGAAGCTTAGG - Intergenic
1078118460 11:8480504-8480526 CTGGAACAGAGCAGCATTATTGG + Intronic
1079829675 11:25247366-25247388 CTGGAATAAGCCAGAAATATGGG + Intergenic
1080769180 11:35324820-35324842 CTGGAAATAAGCAAATTTGTTGG - Intronic
1084726342 11:70944806-70944828 CTGGAATCAGGTAGAATTGGAGG - Intronic
1085005952 11:73090523-73090545 CTGTAATTAAGAAGTATTGTAGG - Intronic
1085138341 11:74115468-74115490 AAGGAAGAAAGCAGAATTCTAGG - Intronic
1087676975 11:101174892-101174914 GTGCTATAAAGCAGAATTATAGG - Intergenic
1091264281 11:134258395-134258417 GTGGAGTAAAGCAGAAGAGTGGG - Intronic
1093342556 12:17996911-17996933 CAGTAATAAAGCAGCATTGATGG + Intergenic
1093423789 12:19004626-19004648 TTGGAATAAATCAGAACTGCAGG + Intergenic
1094247911 12:28323516-28323538 GTGCAATAAAACAGAAATGTAGG - Intronic
1095475941 12:42587867-42587889 CTTGATTAAAGCAGAATCTTTGG + Intronic
1095994325 12:48066950-48066972 CTGGAAGAAAGTAGAACTATGGG + Exonic
1096304918 12:50465635-50465657 GGGGAATAAAGCAGCAGTGTTGG + Intronic
1098288353 12:68932240-68932262 CTGAAATAATGCAGTTTTGTTGG - Intronic
1098462041 12:70742690-70742712 CTGGAAAAAAACAGAATTCGAGG + Intronic
1098990545 12:77060766-77060788 CTGGAAAGAAGGAGAGTTGTTGG - Intronic
1099799124 12:87434901-87434923 CTGGAAAATAGCAGAACAGTGGG - Intergenic
1100770377 12:97914855-97914877 CTTGACTAAAGCAGTATTGGTGG - Intergenic
1103690224 12:122766537-122766559 CTGGGATAAAGCACACTTCTAGG - Intronic
1105395325 13:20028042-20028064 CTGGAATAAAGCAGAATTGTTGG - Intronic
1106441690 13:29779739-29779761 CAGGTATAAAACAGTATTGTGGG + Intronic
1107079052 13:36354695-36354717 CTGTAATAAACCAGAACTGTGGG + Intronic
1109072285 13:57785458-57785480 CTTGAATAAAGTATAATTGATGG + Intergenic
1109626002 13:64975642-64975664 CTGGAAAAGAGTAGAATTTTGGG + Intergenic
1111443577 13:88314106-88314128 TTGGAAAAAAGTAAAATTGTAGG - Intergenic
1113867072 13:113533352-113533374 CTGGCTTAAAGCAGAAGTGCTGG - Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1115305784 14:31932076-31932098 CTTGAATAAAGCAGAGTGGAAGG + Intergenic
1116101297 14:40440612-40440634 CTGGAATACAGAAGAATTCAGGG - Intergenic
1117137419 14:52750559-52750581 CTGGACTTAAGCAGAGATGTGGG + Intronic
1117529639 14:56647220-56647242 CTAGAAAACAGCAGAAATGTTGG - Intronic
1117633804 14:57721957-57721979 CTGGAAGAAAACAGGAGTGTTGG - Intronic
1117743366 14:58842237-58842259 CAGGAATAAATTATAATTGTGGG - Intergenic
1118694018 14:68366536-68366558 CTGGACTAAAGCAGCCTTGAAGG + Intronic
1119409912 14:74424139-74424161 CTGTATTCAAGCAGAATTGAGGG + Intronic
1120649927 14:87119716-87119738 CTGGAAAATAGCAGAACAGTGGG - Intergenic
1121237127 14:92400138-92400160 CTGGAAAAAATCAGAGTTGGAGG + Intronic
1124697355 15:31875704-31875726 CTTGAAAAAAGCTGAATTGGGGG - Intergenic
1124867003 15:33502167-33502189 CTTTAATAAAGGAAAATTGTAGG + Intronic
1125047027 15:35253625-35253647 ATGGGAGAAAGCAGAAATGTGGG - Intronic
1126517788 15:49555231-49555253 CTCTTATAAAGCAGATTTGTTGG + Intronic
1126748636 15:51852867-51852889 CTCCAATACAGCATAATTGTTGG + Intronic
1127000195 15:54494544-54494566 TTGGAACATAGCAGCATTGTTGG + Intronic
1127363861 15:58268832-58268854 CTGAAGTAAATCAGAAATGTGGG + Intronic
1127914105 15:63441460-63441482 CTGGCATAAGGCAGATTTGTGGG - Intergenic
1128069319 15:64784354-64784376 CTGGAAAAAAGAAGATTTCTGGG + Intergenic
1128871447 15:71159170-71159192 CTGGCATAAAGCAGACATATAGG - Intronic
1129534438 15:76300580-76300602 TTGGTAGGAAGCAGAATTGTAGG - Intronic
1130031841 15:80322043-80322065 CGGGAATAAAGCACAGTTATGGG - Intergenic
1130082253 15:80743915-80743937 CTGGAACAAGGCAGTATTTTTGG - Intronic
1130817449 15:87452890-87452912 CTAGAAAAAAGCAGTAATGTGGG + Intergenic
1132109115 15:99089283-99089305 GTGGAATAAAGGAGAAGTATGGG - Intergenic
1133727510 16:8551152-8551174 CTGGTAAAAACCAGAATTCTAGG - Intergenic
1133842837 16:9425522-9425544 CTGGAACAAGGCAGAATTAGTGG + Intergenic
1135263266 16:20999485-20999507 CTGAAATAATCCAGAAGTGTGGG + Intronic
1137429736 16:48408864-48408886 CTGGAAGAATGCAGAAGTGTTGG + Intronic
1137527660 16:49250332-49250354 CTGGAATTAAGAAAAATTGCTGG + Intergenic
1138613807 16:58148396-58148418 CTCCAGTAAAGCAGTATTGTGGG - Intergenic
1140566145 16:76044644-76044666 CTGGAATACAGCATGATTGTTGG + Intergenic
1140650673 16:77084664-77084686 CTTGAACAAAGCAGTATTGGAGG + Intergenic
1140836902 16:78803140-78803162 GTGGAATAAATCAGAACTGTTGG - Intronic
1143669984 17:8390061-8390083 CTGGAGCAAAGCAGAAATTTTGG + Intergenic
1147487638 17:40832920-40832942 CTGGAAGAGATCAGACTTGTAGG + Intronic
1149960509 17:61104667-61104689 CTTTAATGAAGCAGAATTGATGG - Intronic
1150302547 17:64058493-64058515 CTGGAATAAATTATAATTTTGGG - Intronic
1152889236 17:82870839-82870861 CTGGAATACAGCAGGCATGTTGG + Intronic
1153101597 18:1476977-1476999 CTGGATTAAAGCAGCACTGCTGG + Intergenic
1156093285 18:33497662-33497684 CTGGAAAACAGCTGATTTGTTGG + Intergenic
1156993034 18:43433278-43433300 CTGGAATAAAGAATATTTATTGG - Intergenic
1158011580 18:52734833-52734855 AGGGATTTAAGCAGAATTGTAGG + Intronic
1158292995 18:55962850-55962872 CTGGCTTAAAGCAGAATTTAAGG - Intergenic
1158590286 18:58773293-58773315 CTGGGAAATAGCAGAATAGTGGG - Intergenic
1158603712 18:58876602-58876624 GTGGAGTAATGCAGAAATGTAGG - Intronic
1160423208 18:78763095-78763117 CTGGAACAAAGCAGCAAGGTGGG + Intergenic
1163964935 19:20737134-20737156 CTGTAAAATAGCAGAACTGTGGG - Intronic
1164138905 19:22439960-22439982 CTGTAAAAAAGCAGAACTGTGGG - Intronic
1164514484 19:28922228-28922250 CTGGAATAAATTAGAACTTTTGG + Intergenic
1165215745 19:34271089-34271111 ATGGAATAAAGTAGAATGTTTGG + Intronic
1166249161 19:41554454-41554476 CTGAGATATAGCAGAATTATAGG + Intronic
1166976909 19:46610159-46610181 CTGCAATAAAACAGTCTTGTCGG + Exonic
925369550 2:3334735-3334757 CAGGAATAAAATAGAATTCTTGG + Intronic
926880856 2:17541985-17542007 CTAAAATAAAATAGAATTGTTGG + Intronic
932117146 2:69062254-69062276 TTGGAAAAATGCAGAAATGTGGG - Intronic
932117722 2:69068326-69068348 GTGCTATAAAGCAAAATTGTGGG + Intronic
932410480 2:71544059-71544081 GTGGAACAAAGCAGAACTGCCGG - Intronic
935017660 2:99199581-99199603 CTGGAAAAAAGAAAATTTGTTGG + Intronic
936892254 2:117385520-117385542 CTGGAATAAAACAGAGGTGCCGG - Intergenic
938179905 2:129171015-129171037 CAGGAATAAAGCAACAGTGTTGG + Intergenic
938659617 2:133472177-133472199 ATGGAAACAAGCAGAATTTTAGG - Intronic
939169497 2:138678197-138678219 ATAGAATAAAGCAAAATTGAAGG - Intronic
939685781 2:145198476-145198498 CTGCAATAAAGCTTTATTGTAGG - Intergenic
939911364 2:147987751-147987773 CTGGAATAAGAAAGTATTGTAGG + Intronic
940010006 2:149042457-149042479 CTGGAAGAAAGCAGAAGTGGAGG + Intronic
940220338 2:151345005-151345027 ATTGAACAAAGCAGAATTCTCGG - Intergenic
941037396 2:160583388-160583410 ATGGAAAATAGCAGAAATGTTGG - Intergenic
942757905 2:179363840-179363862 GTGGAAGAAAGGAGAATGGTTGG - Intergenic
943439233 2:187905388-187905410 CTTGATTATAGGAGAATTGTTGG - Intergenic
943631161 2:190253957-190253979 CTGGAAAGAAGCAGAATTGGGGG - Intronic
943703611 2:191012771-191012793 CTGGAGCAAAGCAGAAATGTTGG - Intronic
944330704 2:198462927-198462949 CTGACATACAACAGAATTGTTGG + Intronic
945850400 2:214999314-214999336 CTAGTATAAAGCAGAAATGTTGG + Intronic
945916391 2:215708840-215708862 CTGGAATAAAGGATTCTTGTAGG + Intergenic
947075521 2:226340277-226340299 ACGGAATAAAGCATAATTTTGGG + Intergenic
1169593581 20:7172542-7172564 CTGGAAGATGGCAGAATTATGGG - Intergenic
1170146834 20:13184724-13184746 ATGGCAAAAAGCAGAAGTGTGGG - Intergenic
1170505032 20:17016479-17016501 CTGGAACAAAGCAGACATATAGG - Intergenic
1172053253 20:32135915-32135937 GTGAAATAATTCAGAATTGTGGG + Intronic
1174934836 20:54855960-54855982 ATGGAATAAAGCAAATTTGCAGG + Intergenic
1177721567 21:24914010-24914032 TTGGAATAGAGGTGAATTGTAGG - Intergenic
1182466944 22:30523037-30523059 CTGGAAAAAATCAAAAGTGTAGG + Exonic
1183313769 22:37126249-37126271 CTTGAAAAAAGCTGAATTATTGG - Exonic
1184551248 22:45205319-45205341 CTGGAAGAAAGCAGATTTGGAGG + Intronic
950959783 3:17093554-17093576 CTGGAATTCAGAAGAATGGTTGG - Intergenic
951009577 3:17660785-17660807 CTGGAATAAGGCAGACTATTTGG + Intronic
952508106 3:34026035-34026057 CTGGAATAAAGAAGAATGCTTGG - Intergenic
956929570 3:74027811-74027833 GTGGAATATGGCAGTATTGTTGG + Intergenic
957404440 3:79758940-79758962 CTGGAAGAAATCAAAATTATTGG + Intronic
959383156 3:105667056-105667078 CTAGCTTAAAGGAGAATTGTTGG - Intronic
959456353 3:106567289-106567311 ATGGAATATTGAAGAATTGTGGG + Intergenic
959927496 3:111940083-111940105 CTGGAACAAAGTTGAATTCTGGG - Intronic
960194024 3:114742877-114742899 CTTGGGTAAAGAAGAATTGTTGG + Intronic
962332127 3:134487095-134487117 TTTTAATAAAGCAGTATTGTAGG + Intronic
962876150 3:139537624-139537646 CTGGCAGAAAGCAGGACTGTGGG + Intronic
963271573 3:143290648-143290670 CTGAAATAAAGCAGAAGAGTGGG + Intronic
964793365 3:160473335-160473357 GTGGAAGAAAGCAGCATTCTTGG - Intronic
965778105 3:172255159-172255181 CTGGCTTAAAGAAGAAATGTAGG - Intronic
967072600 3:185974580-185974602 CTGGAATTCAGCAGAAGTTTTGG + Intergenic
967728870 3:192888177-192888199 CTGGAATAAAGCTGATTGCTAGG - Intronic
969942686 4:10750279-10750301 CTGTAATAAAGCAGATTTCCAGG - Intergenic
970632074 4:17958232-17958254 CAGGAAAAAAACAGAATTGTGGG + Intronic
971962934 4:33512280-33512302 CTGGAAAATAGCAGAACAGTGGG - Intergenic
972266441 4:37464551-37464573 CTGGACTAGAGCAGAATGGGAGG + Intronic
972555884 4:40180849-40180871 CTGGTATAAAGAAAAACTGTAGG + Intergenic
972682280 4:41317918-41317940 GTGGAATACAGCAGAAGTGATGG - Intergenic
973209067 4:47595219-47595241 GTGTAATAAAAAAGAATTGTGGG + Exonic
974078790 4:57192194-57192216 CTGGAGGATGGCAGAATTGTTGG + Intergenic
975083928 4:70314105-70314127 CTAGAATAAATCAGAATGTTTGG + Intergenic
976164900 4:82244256-82244278 ATAGAATAAAGCAGAAGTGATGG - Intergenic
977115194 4:93015692-93015714 TAGGAGTAAAACAGAATTGTGGG - Intronic
977208136 4:94186793-94186815 CTGGAATACAGTAGAAGTGATGG + Intergenic
977882603 4:102222497-102222519 CTTGAATAAAGGAGAAGTGATGG + Intergenic
980751398 4:137094685-137094707 AAAGAATAAAGCAGAATGGTGGG + Intergenic
981017979 4:139994166-139994188 TTGGAATGAAACAGAATTTTGGG - Intronic
983220055 4:165035362-165035384 CTATAATAAACCATAATTGTTGG - Intronic
983241562 4:165239186-165239208 AAGGAATAAAGAAAAATTGTGGG - Intronic
983698765 4:170565977-170565999 CTGGATTTAACAAGAATTGTGGG + Intergenic
988387119 5:30579075-30579097 CTGGAATATATGATAATTGTAGG - Intergenic
991622057 5:68555288-68555310 CAGGAGCAAAGCAGAATTGTGGG + Intergenic
994079809 5:95695847-95695869 CTTGAATACAGCAGAAATGATGG + Intronic
994124998 5:96159030-96159052 CTGGAAAAAGGCAGAAGTCTAGG + Intergenic
998538445 5:142956070-142956092 TTGGTATTAAGCATAATTGTGGG + Intronic
998807454 5:145932821-145932843 CTGTTATAAAGGAGAAGTGTAGG + Intergenic
998891785 5:146753957-146753979 CTTAAATCAAGCAGAATTGTAGG + Intronic
999160620 5:149493879-149493901 CTGGTATAAAGCATTATTTTAGG - Intronic
999197707 5:149793726-149793748 CTTGAAGACAGCAGACTTGTAGG + Intronic
999387674 5:151166552-151166574 ATGGAAAAAAACAGAATTTTAGG - Intergenic
1000258972 5:159567777-159567799 CTAGAATAAACAAGGATTGTGGG + Intergenic
1000509130 5:162160278-162160300 CTGAAATAAAGAAGAAATTTAGG + Intergenic
1002973457 6:2049206-2049228 CTGGAATAATACATAATTTTTGG - Intronic
1004788687 6:18998943-18998965 GAGGAAGAAAGCAGAACTGTGGG - Intergenic
1008587984 6:52966296-52966318 CTGGAATAAAGCAGTGGGGTCGG + Intergenic
1010497654 6:76554736-76554758 CTGCTATGAAGCAGAAATGTGGG - Intergenic
1012662250 6:101915530-101915552 ATGGAATAAAACAGTATTTTAGG + Intronic
1012769460 6:103411491-103411513 CTGGCATAAACTAGATTTGTTGG - Intergenic
1013675850 6:112461750-112461772 CTGGTAAATAGCAGAATAGTGGG + Intergenic
1014002356 6:116378764-116378786 CTAGAATAAAAAAGAAATGTGGG - Intronic
1014118204 6:117690077-117690099 GTGGAGTAATGCAGAAGTGTAGG - Intronic
1014723837 6:124952162-124952184 CTGTAATAAACTATAATTGTGGG - Intergenic
1015375418 6:132504544-132504566 CTGGAATACTGCAAAATTGTTGG + Intronic
1015447462 6:133324243-133324265 CTAGAATACAGCATAATTTTTGG - Intronic
1015505471 6:133981945-133981967 CTTGAATAAAGGAGAAATGTTGG - Intronic
1016770040 6:147838960-147838982 CTGGAATAAATCACAGTTTTTGG + Intergenic
1017047235 6:150358368-150358390 CTGTAATAAATCACAACTGTTGG - Intergenic
1018722454 6:166582854-166582876 ATGGAATAAAGCAGTATAATAGG + Intronic
1024113527 7:46171206-46171228 CTGTAAAACAGCAGAATTATAGG + Intergenic
1024615282 7:51106606-51106628 CAAGAATAAAGCAGAATCGATGG - Intronic
1024951320 7:54863572-54863594 GTTCAATAAAGCACAATTGTGGG - Intergenic
1027978904 7:85191727-85191749 CTTGAACAAAGCAGAAGTGTTGG - Intergenic
1028453809 7:91016622-91016644 CAGGTCTTAAGCAGAATTGTAGG + Intronic
1029480681 7:100810809-100810831 TTGGAATAAAGCAGCAGTGAAGG + Intronic
1029783368 7:102758831-102758853 ATGGAATATAGCAAATTTGTAGG - Intronic
1030302912 7:107992231-107992253 CTGGAATAAAGAAGAAACCTAGG - Intronic
1031108387 7:117574361-117574383 CTGGAATAAAATAAAATAGTGGG - Intronic
1034260019 7:149749408-149749430 CTGGAAGAAAGCAGTTGTGTGGG + Intergenic
1037486938 8:19356703-19356725 CAGGAAAAGAGGAGAATTGTGGG + Intronic
1038470964 8:27820164-27820186 CTGGAATGAAGCAGAAAAGAGGG - Intronic
1038824763 8:30988621-30988643 CTCAAAGACAGCAGAATTGTTGG + Intergenic
1039531504 8:38267392-38267414 CTGGAAGAAAGCAGCATGGTTGG + Intronic
1039587952 8:38722311-38722333 CTGGAATAAAGCAAGAGTTTGGG + Intergenic
1040574142 8:48636036-48636058 CTTGAATAAAGCAGATGTGATGG - Intergenic
1040989075 8:53329797-53329819 CTGGCTTAAAGAAGAAATGTGGG - Intergenic
1042860608 8:73309478-73309500 CTAGAATATATCAGACTTGTTGG + Intronic
1044458079 8:92412222-92412244 CTGGAATAAAGGAAGATTTTGGG + Intergenic
1044966714 8:97580885-97580907 CTGCAAAAAAGAAAAATTGTAGG + Intergenic
1045375600 8:101570944-101570966 GTGGAATAAAAAAGAAGTGTTGG - Intronic
1045406767 8:101874471-101874493 TTGGGATATAGCAGAAGTGTGGG - Intronic
1046453400 8:114423510-114423532 CTGGAATAAATCCCAATTGATGG + Intergenic
1048286178 8:133143377-133143399 CAGGAATAAAATAGAATCGTGGG + Intergenic
1051180979 9:14411797-14411819 ATAGAATACAGCAGAATTGATGG + Intergenic
1051320244 9:15895720-15895742 AGTGACTAAAGCAGAATTGTGGG - Intronic
1052713372 9:32085244-32085266 TTGTAATAAAGCAGAATAATTGG - Intergenic
1053064925 9:35061372-35061394 TTAGAGTAAATCAGAATTGTTGG - Intronic
1055182583 9:73406239-73406261 CTAGAATAAAGAAGAAATATAGG + Intergenic
1056061964 9:82892773-82892795 CAGGAATAAAGCAAAGTTGAGGG + Intergenic
1056989949 9:91401362-91401384 ATGGAATAAGGCAGAAATGAGGG - Intergenic
1057894221 9:98894203-98894225 ATGGGAAAAAGCAGCATTGTCGG - Intergenic
1058511428 9:105722873-105722895 CTAGATTATAGTAGAATTGTGGG + Intronic
1059314896 9:113415797-113415819 CTGGAATAAAGCACCAGTGGTGG + Intronic
1059998575 9:119937677-119937699 CTGGACTAAAGCAGAAAAGACGG + Intergenic
1060572799 9:124658342-124658364 CTGGAAGAAAGCGGATTTGCTGG - Intronic
1186287731 X:8064115-8064137 ATGGAATGAACAAGAATTGTTGG - Intergenic
1186391783 X:9167826-9167848 CTGGGAAAAGGCAGAATTGAAGG + Intergenic
1186607678 X:11109155-11109177 GTGGGAGAGAGCAGAATTGTGGG + Intergenic
1186720388 X:12297502-12297524 GTGGGAAAAAACAGAATTGTGGG + Intronic
1189669105 X:43388652-43388674 ATAGAATACAGCAGAAGTGTTGG - Intergenic
1191975619 X:66867968-66867990 CAGGATTAAAGCAGCAGTGTAGG + Intergenic
1192556130 X:72091114-72091136 CTGGAAAGAAGTGGAATTGTTGG + Intergenic
1193653364 X:84167478-84167500 TTTGAATAAAGCAAAACTGTAGG + Intronic
1194995908 X:100591239-100591261 CTGGAATAAAGCTGAGTTGGAGG + Intronic
1198894390 X:141436330-141436352 TTAGGATAAAGCAGAATTGTAGG - Intergenic
1200359898 X:155593247-155593269 CTGAAATCAGGCAGAGTTGTTGG - Intronic