ID: 1105395864

View in Genome Browser
Species Human (GRCh38)
Location 13:20033806-20033828
Sequence TAATAGTAACAGATGTATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105395864_1105395868 1 Left 1105395864 13:20033806-20033828 CCATGATACATCTGTTACTATTA 0: 1
1: 0
2: 1
3: 18
4: 195
Right 1105395868 13:20033830-20033852 GGTGTGTGGTAGGAATGTGATGG 0: 1
1: 0
2: 2
3: 33
4: 340
1105395864_1105395867 -9 Left 1105395864 13:20033806-20033828 CCATGATACATCTGTTACTATTA 0: 1
1: 0
2: 1
3: 18
4: 195
Right 1105395867 13:20033820-20033842 TTACTATTAAGGTGTGTGGTAGG 0: 1
1: 0
2: 0
3: 14
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105395864 Original CRISPR TAATAGTAACAGATGTATCA TGG (reversed) Intronic
903669360 1:25026321-25026343 TAATAATAATAAATGTATCGAGG + Intergenic
904018054 1:27439303-27439325 TAGTAGTAATAGTAGTATCATGG + Intronic
906962833 1:50429370-50429392 TAATAGTAATTTATATATCAAGG + Intergenic
911237682 1:95429158-95429180 TAAAAGTGACAGAGGTACCAAGG - Intergenic
914640226 1:149599195-149599217 TAATAGTAACATATGTAGGCCGG - Intergenic
917403939 1:174683239-174683261 TAATATTAAAAGATCTATTATGG - Intronic
918877291 1:190064174-190064196 GATTAGTAACAGATGGATCGGGG + Intergenic
920668588 1:207985384-207985406 TAATAGTAACAAATCTGTCTTGG - Intergenic
921173848 1:212575290-212575312 TAATAGTAACAGAAATTACATGG - Intronic
921958298 1:221006993-221007015 AAATAGTATCAAAAGTATCAAGG - Intergenic
922702502 1:227770064-227770086 TGATAGGAACAGATGTGCCATGG + Intronic
1064283956 10:13976119-13976141 TAATAGTAGCAAAAGTCTCATGG - Intronic
1066287321 10:33981060-33981082 TAATAGTCTCAGATTTCTCAGGG + Intergenic
1066323255 10:34327112-34327134 CAATAGAAACTGATTTATCATGG + Intronic
1067995180 10:51264510-51264532 TAGTATTCACATATGTATCACGG + Intronic
1068674955 10:59761190-59761212 TCATAGAAACAGATGTAGAAAGG - Intergenic
1069996320 10:72344215-72344237 CAATAGAAACTGATGTATGAGGG - Intronic
1072873620 10:99148415-99148437 TAATAGTCTCAGATGAATCCTGG + Intronic
1073406066 10:103299290-103299312 TAAGACTAACACATGTATCCGGG + Intergenic
1074298423 10:112211886-112211908 AAAGATTAACAGATGTATGAGGG + Intronic
1076925931 10:133487016-133487038 AAATAATAACAGATGAAGCAAGG - Intergenic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1079804573 11:24912980-24913002 TAATAGTGACATAAGGATCATGG + Intronic
1081100694 11:38998239-38998261 AACTAGTAAGAGATGAATCAAGG + Intergenic
1085446668 11:76605238-76605260 TAATAGTAGCACTTGTCTCAAGG + Intergenic
1089930657 11:122307645-122307667 TCATAGTAACAGAGGCATGATGG - Intergenic
1090882713 11:130848397-130848419 TCCTAGTAACATATGTAACAGGG - Intergenic
1091267188 11:134280567-134280589 TGATGGTAACTGATGTATCCAGG + Intronic
1092699804 12:11215578-11215600 TAATTGTAACAAATATACCATGG + Intergenic
1095237372 12:39813475-39813497 AAATAGTAACAGATGAAATATGG - Intronic
1096319864 12:50602158-50602180 TAATAGAACGAGATGTAGCAGGG + Intronic
1096464963 12:51843247-51843269 TAATAGTAAATGAAGTCTCACGG + Intergenic
1098016685 12:66112387-66112409 TAAAAGTAACACATGTATGTTGG - Intergenic
1098750493 12:74287398-74287420 AACTACTAACAGATTTATCAAGG + Intergenic
1100352583 12:93798690-93798712 TAATAGTAACAGCTGTGGCTTGG - Intronic
1100651366 12:96592987-96593009 TAATAATAACAGATTTGTCTAGG - Intronic
1100747257 12:97660055-97660077 AAATGGTAACTGATATATCAGGG + Intergenic
1100836588 12:98572360-98572382 TTATAGTCACAGTTTTATCAAGG + Intergenic
1101338052 12:103814237-103814259 CAATGGTAACAGCTGTATGAAGG + Intronic
1102602407 12:114041676-114041698 TAATTTTGACAAATGTATCATGG - Intergenic
1102799316 12:115717700-115717722 TAACAGTAACAGATGTTGCCTGG + Intergenic
1104765156 12:131325687-131325709 TAATAGGAATAGATGTGTGAGGG - Intergenic
1105395864 13:20033806-20033828 TAATAGTAACAGATGTATCATGG - Intronic
1106778521 13:33032242-33032264 TAATGGGAACAGATGTATCTGGG - Intronic
1107618450 13:42198024-42198046 AAATATTAAGAGATGTATTAAGG - Intronic
1108400438 13:50036556-50036578 AAATATTAACAAATGTGTCAGGG + Intergenic
1110951171 13:81493312-81493334 TAAAAGCTACATATGTATCATGG + Intergenic
1111370363 13:87309058-87309080 TAACAATAAAAGATGTATCTTGG - Intergenic
1111678628 13:91416972-91416994 TAAAAGTAAAAAATGTTTCAAGG - Intronic
1112787082 13:102962976-102962998 TACTTGTGACAAATGTATCATGG - Intergenic
1112862011 13:103842150-103842172 TTATAGTAACTGATGTAGTATGG + Intergenic
1114442270 14:22758867-22758889 GAATAGTACCAGATATATAATGG + Intergenic
1118583867 14:67332405-67332427 TAATAGTAACATCTGTAATATGG - Intronic
1119312616 14:73662052-73662074 TCACAGTAACAGATGGTTCATGG + Intronic
1120230190 14:81833431-81833453 TAATAGGAGCAGATTTGTCATGG - Intergenic
1120978571 14:90271411-90271433 TAACAGTAACCCATGTAACATGG + Exonic
1124867426 15:33506526-33506548 TAATAGTGATAAATGTGTCAAGG - Intronic
1125632225 15:41156602-41156624 TAGTTTTTACAGATGTATCATGG + Intergenic
1126640438 15:50819432-50819454 TAACAGGAACAGATTTATTAAGG + Intergenic
1127748877 15:62011141-62011163 TAATATAAAAAGGTGTATCAGGG + Intronic
1130083212 15:80753439-80753461 TAGTTTTGACAGATGTATCACGG + Intronic
1130190281 15:81728168-81728190 TAATAATAACTGAACTATCATGG + Intergenic
1130873166 15:87988457-87988479 TACTTGTGACAAATGTATCATGG + Intronic
1136090293 16:27914774-27914796 TAATAATAACATATAAATCATGG + Intronic
1138009475 16:53364009-53364031 TAACACTAACAGATGTGTGAGGG - Intergenic
1140117075 16:72051219-72051241 AAATAGTAGCAGATGTAACAAGG - Intronic
1140159018 16:72465285-72465307 TAAGAGTTACACATGTATAAAGG - Intergenic
1143207431 17:5154148-5154170 TAATAGTAACATATGAAATAGGG + Intronic
1149306314 17:55349880-55349902 TTATACTAACTGAAGTATCAGGG - Intergenic
1153301485 18:3595796-3595818 TAATCCTAACAGATGTAACAGGG - Intronic
1154379777 18:13838551-13838573 TATTAGGAAAAGATCTATCATGG - Intergenic
1155135083 18:22983161-22983183 TAAAAGTAATACTTGTATCATGG - Intronic
1156655149 18:39276192-39276214 TAAGGGTAAGAGATGTTTCAGGG - Intergenic
1157680182 18:49599285-49599307 TCATGCTAACAGATATATCATGG + Intergenic
1159458345 18:68692435-68692457 GAATAGTTACAGATGAATGAAGG - Intronic
1163220688 19:15917450-15917472 TTACAGTAACAAATGTAGCATGG + Intronic
1165043672 19:33087053-33087075 TAATGGTAACAGCTATTTCATGG - Intronic
928703289 2:33920736-33920758 TTATAAAAACAGATGTATTAGGG - Intergenic
931833545 2:66076169-66076191 AAATACCAACATATGTATCAAGG + Intergenic
934803544 2:97193697-97193719 TAATAGTAACAGAGGAGTAATGG - Intronic
937539603 2:122932784-122932806 TAATAAGAACAGATGCATAAAGG + Intergenic
938670744 2:133584094-133584116 TAAAAGTAACATATTTATTATGG - Intergenic
940793859 2:158056311-158056333 TAATTGTAACAAATGTACCATGG - Intronic
941708551 2:168686827-168686849 TAATATTAATACATGCATCAAGG - Intronic
942577236 2:177376898-177376920 TAATAGTAACTGCTGTTTCTGGG - Intronic
942687745 2:178551563-178551585 TATTAGAAACAAATATATCAAGG - Intronic
943502870 2:188713611-188713633 TAATAATGTCAAATGTATCATGG - Intergenic
943534961 2:189137310-189137332 TAATAATAACATATATATCAAGG + Intronic
943584441 2:189721462-189721484 TGATAGTAACATATTGATCATGG + Intronic
943875618 2:193063562-193063584 CCATAGTAAAAGATGTATTAAGG + Intergenic
943996468 2:194772498-194772520 TAATTGTAACAGATGAAACATGG + Intergenic
944085320 2:195839828-195839850 AAATAGTAACAGGTCTATCCAGG - Intronic
1169001537 20:2171370-2171392 TAAGAGGAACAGCTGTATCAGGG - Intronic
1169924311 20:10766819-10766841 AAATAGGAACAGATGAATCCAGG + Intergenic
1170343158 20:15351920-15351942 TGTTTGTACCAGATGTATCAGGG - Intronic
1170995714 20:21355724-21355746 TAATAGTTACACATGTATTTTGG + Intronic
1171187391 20:23132641-23132663 TAATAGCAACGTATGTCTCATGG + Intergenic
1172087207 20:32395744-32395766 TAAGAGTAACAGATTTAACATGG - Intronic
1175164111 20:57031012-57031034 TAATAGTAACACATGTCTAGGGG - Intergenic
1175673130 20:60923328-60923350 TAATTGTGACAAATGTATCATGG - Intergenic
1177925097 21:27204153-27204175 TATGAGCAAAAGATGTATCATGG - Intergenic
1178823406 21:35995083-35995105 TTATAGTCACAGATGTCACAAGG + Intronic
1183150350 22:36032138-36032160 TAATACTAAGAGATGTGTCAGGG - Intergenic
949116058 3:324997-325019 TAATAATAACTGATGCATAATGG - Intronic
951638733 3:24810192-24810214 TAATAGTAACAGGTATACTATGG + Intergenic
952606432 3:35152683-35152705 AAAAAGTAACAGATGAGTCAGGG - Intergenic
952699852 3:36315775-36315797 TAATACTAACCTATGTATCCAGG - Intergenic
952970323 3:38646684-38646706 GAAAAGTGACAGATGTTTCATGG - Intronic
954602881 3:51884711-51884733 AGATAGAAACAGATTTATCATGG + Intergenic
955048492 3:55385011-55385033 TAGTTGTGACAAATGTATCATGG + Intergenic
957393521 3:79610837-79610859 GAATTGTAACACAGGTATCATGG + Intronic
957577152 3:82023135-82023157 CAATAATAACACATTTATCAAGG + Intergenic
957590546 3:82191648-82191670 TTATAGTAGCAGATGTTTTATGG + Intergenic
957946481 3:87069613-87069635 GAATAGTCAGAGATGTAGCAAGG + Intergenic
958876430 3:99622892-99622914 CAAAGGTAACATATGTATCAAGG + Intergenic
959340337 3:105121374-105121396 TAATAATAACACCTGTCTCAAGG - Intergenic
959391025 3:105773873-105773895 GAACAGTAACACATGTATCATGG - Intronic
960869620 3:122235584-122235606 TAATAGTATCAGAAGAATCCTGG + Intronic
961309827 3:125989519-125989541 TAATTGTAACAGATTTTTAAAGG + Intergenic
961323530 3:126095620-126095642 TTATAGGAACAGATTTATTATGG - Intronic
962359792 3:134728789-134728811 AAATATTAACAGATTTATCTTGG + Intronic
962496064 3:135939990-135940012 CAATAGTAACAAAAGTAGCATGG - Intergenic
963181080 3:142357121-142357143 TAAAAGTAAAAGTTATATCAGGG + Intronic
963221726 3:142820330-142820352 TAAAAGTAACATATGTTTCATGG - Intronic
963584693 3:147171094-147171116 TAATAGTTAAAGATATATTAAGG + Intergenic
964962292 3:162441814-162441836 TGATAGTTACAGCTGTATAAAGG + Intergenic
964994047 3:162852423-162852445 TAAATGTAACACATATATCAAGG + Intergenic
966302258 3:178492867-178492889 TAGTAGTAACATATGTATCAAGG + Intronic
966475454 3:180339604-180339626 TAATAATAATAAATGTCTCATGG + Intergenic
966600593 3:181771219-181771241 TAAAAATAACGGATGAATCAGGG + Intergenic
967225872 3:187290726-187290748 TAATAGTAAAAGATGTGTTTAGG + Intronic
969561978 4:7954779-7954801 TCATAGTAACAGGTCTTTCAAGG + Intergenic
970302444 4:14695676-14695698 TAATAATAATAGATGATTCATGG + Intergenic
970629534 4:17925300-17925322 TAATACTAAGAGATGTCTTAAGG - Intronic
973661572 4:53112722-53112744 TAATAATAACAGATTCCTCAAGG + Intronic
974230343 4:59105179-59105201 TCATACTAACAGATTTTTCAGGG - Intergenic
974355688 4:60809868-60809890 TAATAATGACAACTGTATCATGG - Intergenic
977052130 4:92141792-92141814 TAATACTAAGAGATGCATAAAGG - Intergenic
977155581 4:93568890-93568912 AAATGGTAACAGGTGTCTCAGGG - Intronic
981909998 4:149967943-149967965 TAATATTAACACAATTATCAAGG + Intergenic
982281676 4:153689601-153689623 TTATAGAAACAGATTTATTATGG + Intergenic
982821647 4:159947465-159947487 TAATAGTAACAGGTCAATCATGG + Intergenic
983290283 4:165794187-165794209 TAATATTGTCAGAGGTATCATGG - Intergenic
983399958 4:167250254-167250276 GAGTAGTAACAAATGTATAATGG - Intergenic
983522732 4:168727405-168727427 TAATAGTAGCTGATGTGACATGG + Intronic
983525558 4:168757158-168757180 AAATACAAACAGATGTTTCAAGG + Intronic
984393158 4:179164823-179164845 TAATAGTAACACTTATATTAAGG + Intergenic
985501296 5:248584-248606 TTATAGAAGCAGATTTATCATGG - Intronic
985735590 5:1579049-1579071 TTATAGGAGCAGATTTATCATGG + Intergenic
986266117 5:6192773-6192795 TGATTGTAACAAATGTACCAAGG + Intergenic
987197885 5:15545803-15545825 AAAAAGTAAAAGATGTATTAGGG + Intronic
988358437 5:30205281-30205303 TTAAAGTAACAGAGATATCATGG + Intergenic
990660960 5:58014585-58014607 AAGTAGTAACAGAAGTATCTGGG - Intergenic
993406345 5:87516105-87516127 TTATAGGAGCAGATTTATCATGG - Intergenic
996927169 5:128841363-128841385 TACAAGTAACAGATGAAGCATGG + Intronic
1000945266 5:167414928-167414950 AAATATTAACTGATGTACCAAGG - Intronic
1005775113 6:29122970-29122992 TATTAATAACAGATACATCAAGG + Intergenic
1005781175 6:29194206-29194228 TATTAATAACAGATACATCAAGG + Intergenic
1007641646 6:43345264-43345286 TAATAATAACAGTTGTCTCTAGG + Intronic
1008448433 6:51620870-51620892 TAATATTAGTAGATGTGTCATGG - Intronic
1008953987 6:57194114-57194136 TAATATTAACAAATGTATAATGG + Intronic
1009266132 6:61556828-61556850 TAATAGTTACTGATTTATCAAGG + Intergenic
1009277215 6:61698522-61698544 TAATAGAAACAGAGCAATCAGGG - Intronic
1009590161 6:65658376-65658398 TAGTTGCAACAGATGTATCATGG + Intronic
1009810552 6:68658127-68658149 TAATAATAACAGCTATCTCATGG - Intronic
1010497587 6:76554146-76554168 TAATTGTAACAGAGGTGGCAGGG - Intergenic
1011976132 6:93301795-93301817 TTGTGGTAACTGATGTATCAAGG - Intronic
1012419465 6:99047872-99047894 TAAAAGTAACAGAAGTAGGATGG + Intergenic
1013730507 6:113159049-113159071 TAATACTAACAAAAGTGTCATGG - Intergenic
1015162606 6:130170092-130170114 TAATAGGTACACATGTACCATGG + Intronic
1015427566 6:133089579-133089601 TGATAAAAACAGATGTATTATGG + Intergenic
1016144934 6:140658582-140658604 TAATAGTAACAAATGTGTTATGG - Intergenic
1018594404 6:165462916-165462938 TTATAGTAGCAGATTTATTATGG - Intronic
1027629935 7:80591110-80591132 TAATAATAACAGAAACATCAAGG + Intronic
1027895492 7:84037773-84037795 TAATAATAACAAATATATAATGG + Intronic
1028763401 7:94521430-94521452 TAATAATAGCAGATATGTCAAGG + Intronic
1030508346 7:110453085-110453107 GAATAGTAGAAGTTGTATCAGGG - Intergenic
1031429050 7:121643517-121643539 TAATAGCAACAGAAGAAACAAGG + Intergenic
1032309757 7:130774121-130774143 TAAGAATAAAAGATGTAACAGGG - Intergenic
1033064521 7:138141211-138141233 CAATATAAAAAGATGTATCAAGG - Intergenic
1033927161 7:146477385-146477407 TAAAAGTAAAATATGTATAATGG - Intronic
1034514811 7:151567527-151567549 TAATAGGAACAGAGGGAGCATGG - Intronic
1036608410 8:10328667-10328689 TAGAAGTTACAGATGTCTCATGG - Intronic
1041065172 8:54075764-54075786 TAATAGGAGCAGATTTATTATGG - Intronic
1042406735 8:68414355-68414377 TGAAAGTGAAAGATGTATCAAGG + Intronic
1043772959 8:84227694-84227716 TAATAGTAACAGGGGAGTCAGGG - Intronic
1044469068 8:92544335-92544357 TAGTTGTAACAGATCTTTCACGG - Intergenic
1045714435 8:105025248-105025270 TAATAATAACAAAGGTATCATGG - Intronic
1046265523 8:111824555-111824577 AAATAGTAATAAATGTTTCAGGG + Intergenic
1046360027 8:113139853-113139875 TAATAGAAAAAGCAGTATCATGG + Intronic
1046726886 8:117685418-117685440 AAATAGTTACTTATGTATCATGG + Intergenic
1047793841 8:128233706-128233728 TAATAGTAACAGAAGAGTAAAGG - Intergenic
1047822043 8:128531514-128531536 TAGAAGTGACAGATATATCAAGG - Intergenic
1047893532 8:129339854-129339876 TAATAATAACAGATACTTCAAGG + Intergenic
1047898358 8:129392279-129392301 TAATTGTAACCTATGTTTCAAGG - Intergenic
1048405105 8:134111014-134111036 TAATATGAACAGATGGATGAAGG - Intergenic
1050484552 9:6119902-6119924 TTTTAGTAACAGTTGTATTAGGG + Intergenic
1051742455 9:20264996-20265018 TAATAGACCCAGATGTACCAGGG - Intergenic
1052159784 9:25243130-25243152 TAAAACAAAAAGATGTATCATGG + Intergenic
1053194311 9:36103860-36103882 TAAGACTAACAGAGGTATAAGGG - Intronic
1055315036 9:75026565-75026587 TAGTAGTAACAGAGGGAGCAAGG - Intronic
1056498273 9:87182239-87182261 TAATAGTAACATATCAATGATGG + Intergenic
1058617090 9:106842153-106842175 TAACAGTAGCAGATGTAATATGG - Intergenic
1059800246 9:117742877-117742899 TAATATAAAAAGATGTATCTGGG + Intergenic
1186218061 X:7321589-7321611 TACTAGAAACAGAGGTTTCAGGG - Intronic
1186629084 X:11328997-11329019 TAATAATTACAGAGGTATTATGG + Intronic
1186825354 X:13334280-13334302 TCATAGTAACAGAAGTGTTAGGG - Intergenic
1189928201 X:45979770-45979792 AACTAGTAATTGATGTATCATGG - Intergenic
1193314379 X:80047030-80047052 TTATAGGAGCAGATGTATTATGG - Intergenic
1194637673 X:96365284-96365306 TTATAGTAACAGAAGTCTCTTGG - Intergenic
1195215248 X:102693276-102693298 AAATAGTAACAAATGAATCCAGG + Intergenic
1196987418 X:121290228-121290250 TCAAATTAACACATGTATCACGG - Intergenic
1197552066 X:127903234-127903256 TGACAGTAACAGATAGATCATGG + Intergenic
1198012319 X:132570470-132570492 TAATATTTACTGATTTATCAAGG + Intergenic
1198495074 X:137184094-137184116 TAATTGTGACAAATGTACCATGG - Intergenic