ID: 1105406889

View in Genome Browser
Species Human (GRCh38)
Location 13:20140628-20140650
Sequence GTGTGGGCATGGCTGGAAGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 438}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105406889_1105406903 29 Left 1105406889 13:20140628-20140650 CCGTCTTCCAGCCATGCCCACAC 0: 1
1: 0
2: 2
3: 41
4: 438
Right 1105406903 13:20140680-20140702 TCTGGTGTGGAGGCAGAATGGGG 0: 1
1: 0
2: 2
3: 37
4: 378
1105406889_1105406894 1 Left 1105406889 13:20140628-20140650 CCGTCTTCCAGCCATGCCCACAC 0: 1
1: 0
2: 2
3: 41
4: 438
Right 1105406894 13:20140652-20140674 CATAAATAGCCTTCCCTGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 94
1105406889_1105406901 27 Left 1105406889 13:20140628-20140650 CCGTCTTCCAGCCATGCCCACAC 0: 1
1: 0
2: 2
3: 41
4: 438
Right 1105406901 13:20140678-20140700 GCTCTGGTGTGGAGGCAGAATGG 0: 1
1: 0
2: 2
3: 36
4: 325
1105406889_1105406896 11 Left 1105406889 13:20140628-20140650 CCGTCTTCCAGCCATGCCCACAC 0: 1
1: 0
2: 2
3: 41
4: 438
Right 1105406896 13:20140662-20140684 CTTCCCTGTCAGGACAGCTCTGG 0: 1
1: 0
2: 1
3: 27
4: 201
1105406889_1105406900 19 Left 1105406889 13:20140628-20140650 CCGTCTTCCAGCCATGCCCACAC 0: 1
1: 0
2: 2
3: 41
4: 438
Right 1105406900 13:20140670-20140692 TCAGGACAGCTCTGGTGTGGAGG 0: 1
1: 0
2: 2
3: 25
4: 322
1105406889_1105406899 16 Left 1105406889 13:20140628-20140650 CCGTCTTCCAGCCATGCCCACAC 0: 1
1: 0
2: 2
3: 41
4: 438
Right 1105406899 13:20140667-20140689 CTGTCAGGACAGCTCTGGTGTGG 0: 1
1: 0
2: 2
3: 21
4: 207
1105406889_1105406902 28 Left 1105406889 13:20140628-20140650 CCGTCTTCCAGCCATGCCCACAC 0: 1
1: 0
2: 2
3: 41
4: 438
Right 1105406902 13:20140679-20140701 CTCTGGTGTGGAGGCAGAATGGG 0: 1
1: 0
2: 2
3: 24
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105406889 Original CRISPR GTGTGGGCATGGCTGGAAGA CGG (reversed) Exonic
900171193 1:1269751-1269773 GTGTGGCCATGGCTGGGCGCGGG - Intronic
900397800 1:2460353-2460375 GTGTGGGCATGGCTTAGAGCTGG - Intronic
900771518 1:4548389-4548411 ATGAGGGCATGGGTGGAAGGTGG + Intergenic
900819369 1:4874363-4874385 GTGTTGGCATGGCTGGGTGCTGG + Intergenic
901401677 1:9019142-9019164 GTTTGGCCAAGGCTGGAAGCAGG - Intronic
901576187 1:10202938-10202960 GTGGGGGCAATGCTGGAAGAAGG - Intergenic
901665082 1:10821383-10821405 GTGTTGGCGTGGCTGAAATACGG - Intergenic
901811490 1:11769168-11769190 GTGGGGGCAAGGCAGGAAGTTGG - Intronic
902609179 1:17587367-17587389 AGGTGGGCATGGCTGGAACTGGG - Intronic
902828345 1:18992966-18992988 GGGTGGGCATGAATGGAAGAGGG - Intergenic
903026446 1:20432979-20433001 GTGTGTGCATGTGTGGAAGTAGG - Intergenic
903320355 1:22539293-22539315 GGGTGGGAAAGGCTGGCAGAGGG - Intergenic
904330611 1:29755763-29755785 GGGAGGGCCTGGCTGGAAGAAGG - Intergenic
904355269 1:29934501-29934523 CTGTGGGCAGGGCTGGGAGGAGG + Intergenic
904416063 1:30361832-30361854 GGGAGGGCCTGGCTGGAAGAAGG + Intergenic
904821069 1:33244799-33244821 GTGTGGGCCTGGCTTGGAGGAGG + Intergenic
904894094 1:33801159-33801181 GAGGGGGCATGGAAGGAAGAGGG - Intronic
904894203 1:33801900-33801922 CTGTGTGCTTTGCTGGAAGAAGG + Intronic
905823818 1:41014727-41014749 GTTTGGGTATGGCTGGCATATGG - Intergenic
905915821 1:41683611-41683633 GTATGGCCATGGCTGGAGGCTGG + Intronic
906103028 1:43275200-43275222 GTGTGTGCATGGCAGGGGGAAGG - Intergenic
906673284 1:47675837-47675859 ATGAGGGCAGGACTGGAAGAGGG - Intergenic
907389884 1:54151404-54151426 CTGTGGGTAGGGCTGGGAGAAGG - Intronic
907585474 1:55613109-55613131 CTGTGGGCATTGCTGGAATTTGG + Intergenic
908475807 1:64487040-64487062 GTGTGTGAAGGGCTGAAAGAAGG + Intronic
909450865 1:75796780-75796802 GTTTGGGAATGGCTGGAAGCAGG + Intergenic
911053956 1:93695139-93695161 GGGTGGGCAGGGAAGGAAGAAGG - Intronic
911094989 1:94047795-94047817 GAGGGGGCATGGGAGGAAGAAGG - Intronic
911357325 1:96838380-96838402 TTGTGAACATGGCTGGATGAGGG + Intergenic
912030725 1:105240060-105240082 GAGTGGCCATGGCTGCAAGGAGG - Intergenic
912690958 1:111804356-111804378 GTGTGGGGAAGGCTGACAGATGG - Intronic
912741101 1:112198301-112198323 CTGTTAGCATGTCTGGAAGATGG - Intergenic
913216691 1:116626884-116626906 CTGTGGGCATGGCTGGCCTAGGG - Intronic
914685037 1:149970934-149970956 GTCTGGGTTTGGCTGGGAGAAGG + Intronic
914812272 1:151037671-151037693 GTGTGAGGGTGGCTGGGAGAAGG + Intronic
915457501 1:156050662-156050684 CTGTGGGAATGACAGGAAGAGGG - Intronic
915489884 1:156245060-156245082 GAGGGGGCAGGGCTGGAAGTGGG + Intronic
915608316 1:156969432-156969454 CTGTGTGCAGGGCAGGAAGAGGG + Intronic
917968298 1:180192211-180192233 GTGTGGGCAGCACTGAAAGAAGG + Intronic
918115853 1:181496944-181496966 GTGTGGGCTTGTCTGGAGGTGGG + Intronic
918238297 1:182600554-182600576 GGGTGGGCATGGCTGAGGGAGGG + Intronic
920273177 1:204782548-204782570 ATGTGGCTATGGCTGGATGAAGG - Intergenic
920657576 1:207888005-207888027 GTGGGGGCAGGGGTGGGAGAAGG + Intronic
920677221 1:208046584-208046606 GTGTGTGCATGGCCTGAAGCAGG + Intronic
922565683 1:226600331-226600353 GTGTGGGCATGGCCAGGATATGG + Intronic
922741035 1:228014342-228014364 GTGTGGACAGGCCTGGAAGGTGG - Intronic
923362653 1:233226800-233226822 GTGTGGGCATGGGGAGAGGAGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1062996771 10:1873343-1873365 GGGTGGGCAGAGCTGTAAGATGG + Intergenic
1063979767 10:11444159-11444181 GTTGGGGCATGGCTGGGTGATGG - Intergenic
1064057084 10:12106764-12106786 GAGTGGGCATCCCTGGAAAATGG - Intronic
1067435273 10:46272567-46272589 GTTTGGGCATGGCCAGAGGAAGG - Intergenic
1067438443 10:46294753-46294775 GTTTGGGCATGGCCAGAGGAAGG + Intronic
1068923133 10:62506377-62506399 GTGTGGGTATGGCTGAAAAGGGG - Intronic
1070088933 10:73264946-73264968 GAGTGGGCATGGGTAGAGGAGGG - Intronic
1070718415 10:78739440-78739462 GTGTGGGCCTTGCTGGGAGAGGG - Intergenic
1070780311 10:79133740-79133762 GTCTGGGCACTGCTGGAGGAGGG - Intronic
1070829686 10:79410799-79410821 GTCTGGGGATGGGTGGCAGAGGG + Intronic
1072086563 10:92085282-92085304 GTCTGGTCATGGTGGGAAGATGG + Intronic
1074104088 10:110376026-110376048 GCGAGGGCATGGATGGAGGAGGG - Intergenic
1074976051 10:118582590-118582612 GTGTGAGCATGGCTTGGAGTAGG + Intergenic
1075131058 10:119740269-119740291 GTGGGGGCAGGGCAGGAAGTTGG + Intronic
1076726342 10:132415931-132415953 GTGTGAGCATGAATGTAAGAGGG - Intronic
1076774716 10:132688317-132688339 CTGGGGGCAGGGCTGCAAGAAGG - Intronic
1076826914 10:132973816-132973838 GGGCAGGCATGGCTGGCAGAGGG - Intergenic
1077140000 11:1020117-1020139 ATGTGAGCGTGGCTGGAAGGAGG + Exonic
1077306407 11:1870523-1870545 GTGTGGGGGTGTCAGGAAGAGGG + Intronic
1077311521 11:1890928-1890950 GTGTGGGCTGGGGTGGGAGACGG + Intronic
1077379104 11:2219986-2220008 GGGTTGGCATGACTGAAAGAGGG - Intergenic
1077647911 11:3942547-3942569 GAGTGGGCCTAGCTGGAACATGG + Intronic
1078836785 11:15037871-15037893 GTGTGAGTGTGGCTAGAAGAGGG + Intronic
1080961969 11:37171386-37171408 GTGTGCGTGTGGTTGGAAGAGGG + Intergenic
1081583096 11:44365866-44365888 GTGTGGGCATGGATGGGGTAGGG - Intergenic
1081787284 11:45756525-45756547 GAGTGGGCCTGGCTGGGAGAGGG + Intergenic
1083429900 11:62608923-62608945 TGGTGGGCTTGGCAGGAAGAGGG - Intronic
1084586807 11:70067170-70067192 GTTTGGACATGGCTGGAAGGTGG - Intergenic
1085615295 11:77993472-77993494 ATGTGAGGATGGGTGGAAGAGGG + Intronic
1089756230 11:120689439-120689461 GGGTGGGTATGGCTGGATCATGG - Intronic
1091449457 12:563316-563338 GTGTGGGCAGGGCAGGAGGCTGG - Exonic
1091756552 12:3056175-3056197 GTTTGGGTATGGCTGGGAGGGGG - Intergenic
1092218836 12:6699854-6699876 ATGGGGGCATGGTGGGAAGAAGG + Intronic
1092913749 12:13171375-13171397 GTGTGGGAATGGCAGGAAGCGGG + Intergenic
1094123518 12:26998723-26998745 GTGTGGGGATGGATTGGAGAGGG - Intronic
1094656006 12:32419919-32419941 GTGTGGCCACTGCTGGGAGAAGG + Intronic
1094763413 12:33561706-33561728 GTGTGGGCATGGTGGGATGATGG - Intergenic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1096546808 12:52345698-52345720 GTGGGGGAATGGCTTGAAGAAGG + Intergenic
1097177941 12:57154146-57154168 GGGTGGGCATCTCTGCAAGAGGG + Intronic
1098347722 12:69524059-69524081 GTGGCAGCATGGCTGGAGGAGGG + Intronic
1099300941 12:80893683-80893705 TAGTGGGCATGCCTGAAAGAAGG + Intronic
1101331550 12:103761573-103761595 GAGTGGGGATGGCAGGAAGCAGG - Intronic
1102119589 12:110429809-110429831 GTGTGGGCACAGGTGGAAGATGG + Intergenic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1102959805 12:117085134-117085156 GGGTGGACAGGGCTGGCAGAAGG + Intronic
1103793861 12:123490199-123490221 GTGTGGGGACGGCTGTCAGATGG - Intronic
1103912638 12:124360746-124360768 GGGTGGGCATTGCGGGCAGAGGG - Intronic
1104614010 12:130253666-130253688 GTGTGTGCTTGGGTGGAAGAGGG + Intergenic
1105291882 13:19058575-19058597 GTGTGGGCAGGGCTCCAAGGAGG + Intergenic
1105406889 13:20140628-20140650 GTGTGGGCATGGCTGGAAGACGG - Exonic
1105722916 13:23134665-23134687 GTGAGGGCACAGGTGGAAGATGG - Intergenic
1106076282 13:26464065-26464087 CTCTGGCCAGGGCTGGAAGAGGG + Intergenic
1106079808 13:26490710-26490732 GTCGGGGCATGGCTGGAGGGAGG - Intergenic
1108682313 13:52790694-52790716 GTGCAGGCAGGGCTGGAAGAGGG - Intergenic
1109253753 13:60052172-60052194 GTAAGGGCATGGCAGGAACAGGG + Intronic
1112744581 13:102512250-102512272 GTGAGGGCATGGCAAGAAGGTGG + Intergenic
1113426547 13:110213114-110213136 GTGGGGGGAAGGCTGGAAGGAGG + Intronic
1113633012 13:111900621-111900643 GTGTGGGTTTGGCTGCATGATGG + Intergenic
1115347900 14:32362834-32362856 GTGTGGGGAGGGCTGGAAGTGGG + Intronic
1115545683 14:34462879-34462901 GTGTGTGCATGGGTGGGGGAAGG - Intergenic
1115776399 14:36720060-36720082 GGGTGGGCCTGGCTGGCAGAGGG - Intronic
1115895151 14:38078090-38078112 GTGTTGGCATGGCAGGACAATGG - Intergenic
1116469370 14:45269327-45269349 ATGTAGGCAAGGCTAGAAGATGG - Intergenic
1117537115 14:56713013-56713035 GTGTGCGTAGGGCTGGAACAAGG - Intronic
1119842057 14:77800480-77800502 GAGTGGGCAGAGCTGGAGGAGGG + Intronic
1120828184 14:88974164-88974186 ATGTGGGCATTCCAGGAAGAGGG + Intergenic
1121113710 14:91329499-91329521 GTGTGGGAAGTGCTGCAAGAGGG - Intronic
1121326055 14:93020171-93020193 GTGGGGGCAGGGCTGGGAGACGG + Intronic
1122784169 14:104156283-104156305 GTGAGGGAGTGGCTGGGAGAAGG + Intronic
1122795881 14:104205980-104206002 GTGTGTGCAGGGCTGGGAGCTGG + Intergenic
1124855271 15:33381557-33381579 GAGTGGTCAGGGCAGGAAGAAGG - Intronic
1126891791 15:53213356-53213378 GAGAGGGCAGGGCTGGAAGGAGG + Intergenic
1127622827 15:60750983-60751005 GTGAGGACTTGGCTGGCAGAAGG + Intronic
1128146855 15:65336800-65336822 GTTTGGGCATGGGTGGAAACGGG - Intronic
1128152875 15:65374268-65374290 GTGGGGTCATGGCTGAAAAAGGG - Intronic
1128781197 15:70359822-70359844 GTGTGGGCCTGGCTGGGTGCAGG + Intergenic
1129506663 15:76087201-76087223 GTGTGGAGAAGGCTGAAAGAGGG + Intronic
1129525701 15:76212732-76212754 CTGTGGGCAAGGCTGGCAGAGGG - Intronic
1129654772 15:77516759-77516781 GTGTGGGCATTCCGGGAAAAGGG + Intergenic
1129661730 15:77556532-77556554 GTCTGGGCATGTCTGGGAGCAGG - Intergenic
1129673053 15:77617579-77617601 GTGTGGGAAGGGGTGGGAGAAGG - Intronic
1131231357 15:90661984-90662006 GTGAGTGCAAGGATGGAAGAAGG - Intergenic
1131327792 15:91465739-91465761 GTGTGAGGATAGCTGGAACAGGG - Intergenic
1132074690 15:98810134-98810156 GTGTGGGGGTGGCTGGCGGAGGG + Intronic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1133013021 16:2925329-2925351 GTATGGGAATGGATGGACGATGG - Intronic
1133160349 16:3907749-3907771 GTGTGGGCAGGGCCTGCAGAGGG + Intergenic
1133653577 16:7836778-7836800 GTGTAAGCCTGGCTGAAAGATGG - Intergenic
1133760616 16:8795868-8795890 GTGTGGGCAAGGCTGAAGAAAGG - Exonic
1134488442 16:14677779-14677801 GTGGGTGGATGGATGGAAGATGG + Intronic
1135046880 16:19163204-19163226 CTGTGGGCATGGCTGGAAATAGG - Intronic
1135101909 16:19613433-19613455 GTGCAGGCATGGCTGGATGCAGG + Intronic
1136145495 16:28313938-28313960 GGGTGGGCATTGCTGGAGGCTGG - Intronic
1136543755 16:30943852-30943874 GAGGGGGCATGGTGGGAAGAAGG - Intronic
1136553324 16:30993272-30993294 ATGGGGGCTGGGCTGGAAGAGGG + Intronic
1136554860 16:31001677-31001699 GTGTGTGCATAGCAGGGAGAGGG - Intronic
1136570001 16:31090997-31091019 GTGCGGGTATGGCAGGAGGAGGG + Exonic
1137578689 16:49620777-49620799 GGGTGGGGATGGCTGGATAAGGG - Intronic
1137935233 16:52628739-52628761 GTGTGGTCATGACTAGAGGATGG + Intergenic
1137940392 16:52677953-52677975 GTGTCTACATGGCTGAAAGAAGG - Intergenic
1137942175 16:52699067-52699089 GTTTAGGCATGGCTGGAGCAAGG + Intergenic
1138457908 16:57131897-57131919 GTGTGAGCATGGCTCCCAGAGGG - Intronic
1140341996 16:74173627-74173649 GTGAGGGCACGGCAAGAAGACGG - Intergenic
1140552029 16:75876691-75876713 GTGGGGGCAGGGGTGGAACAAGG - Intergenic
1140650614 16:77084061-77084083 CTGAGGGCAAGGCTTGAAGAGGG + Intergenic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1142081589 16:88152107-88152129 GTGAGGCCATGGGTGGAGGAGGG + Intergenic
1142225505 16:88875337-88875359 GGGTGGGCAGGGCTGGAGGATGG + Exonic
1142226997 16:88882330-88882352 GTGTGGGCATGGCTGTGCGTGGG + Intronic
1143101670 17:4507937-4507959 GATTGGGCCTGGCTGGAGGAGGG + Intronic
1143107890 17:4538495-4538517 GTGTGTGCATGGATGGGAGGTGG - Exonic
1143287407 17:5800546-5800568 GTGTGGCTAGGGCTGGATGAAGG + Intronic
1143471418 17:7178223-7178245 GTGTGGGAACAGCTGGAAGCTGG - Intronic
1143858301 17:9869212-9869234 GTGAGGGTAAGGCTGGAGGAGGG - Intronic
1144662344 17:17079383-17079405 TTGTGGACTTGGCTGGAAGTAGG + Intronic
1146453220 17:32991047-32991069 GGGTGTGCATGGATGGAAGTGGG - Intronic
1146595407 17:34164018-34164040 TGGGGGGCATGGCTAGAAGAAGG - Intronic
1146790410 17:35747703-35747725 GTGTGGGGGAGGCTGGAGGAAGG - Intronic
1147621347 17:41869934-41869956 GCGGGGGCATGGCTGGAGGCTGG - Intronic
1148201618 17:45753365-45753387 GTGTGCGCATGGATGGGGGAAGG + Intergenic
1148201625 17:45753396-45753418 GTGTGCGCATGGATGGGGGAAGG + Intergenic
1148201633 17:45753427-45753449 GTGTGCGCATGGATGGGGGAGGG + Intergenic
1148201641 17:45753458-45753480 GTGTGCGCATGGATGGGGGAGGG + Intergenic
1148201648 17:45753489-45753511 GTGTGCGCATGGATGGGGGAAGG + Intergenic
1148795543 17:50195007-50195029 GGGTGGGCTGGGCTGCAAGAAGG + Intronic
1148906428 17:50915246-50915268 GGCTGGGCATGGCAGGAGGAGGG + Intergenic
1149007618 17:51821944-51821966 GTGTGGGCTGGGCTGGAAAGGGG - Intronic
1150714136 17:67557170-67557192 GTGAGGGCATAGCAAGAAGATGG - Intronic
1151135491 17:71942634-71942656 GTGGGGGCACTTCTGGAAGAAGG - Intergenic
1151418664 17:73983505-73983527 TTGTGGGCAGGGCTGGGCGAGGG - Intergenic
1152427076 17:80223921-80223943 GGGCGGCCATGGCTGGGAGAAGG - Intronic
1152615271 17:81334924-81334946 GTGAGGGCGTGGATGGCAGAGGG - Intergenic
1152922015 17:83070417-83070439 GGGTGGGCAGGGCTGGGAGGTGG + Intergenic
1154043068 18:10877715-10877737 GTGGAGGCCTGGCTGGCAGAGGG - Intronic
1154066724 18:11113505-11113527 GGGTGGGCAGAGCAGGAAGAAGG - Intronic
1154173657 18:12067923-12067945 GTGGGGGGATGGCTGGGAGCCGG + Intergenic
1154948323 18:21183969-21183991 GTGTGGGGATGGGTGGAGGGAGG + Intergenic
1155612630 18:27684185-27684207 GGGTGGGAATGAATGGAAGAGGG - Intergenic
1156455330 18:37290049-37290071 GGAGGGGCATGGCTGGGAGAGGG + Intronic
1156570227 18:38244183-38244205 GTGTGTGCATGGCAGGAAGTAGG - Intergenic
1157493400 18:48139115-48139137 GGCTGGGCAGGCCTGGAAGATGG + Intronic
1157739111 18:50076326-50076348 GTTTGGGCATGGATGGAACATGG - Intronic
1157824639 18:50801691-50801713 GGGTGGGGGTGGCTTGAAGAGGG + Intronic
1158062831 18:53366810-53366832 GAGTGGGCAAGGCCGGAGGATGG - Intronic
1158348569 18:56540743-56540765 GTGGGGACATGGCAGGAAGTGGG + Intergenic
1158547300 18:58407034-58407056 GTGTGGGAAAGGCTGGAGGGAGG - Intergenic
1160767888 19:816517-816539 CTGGGGGCATGGGTGGAGGATGG - Intronic
1160895244 19:1399390-1399412 GTGTGGGCCTGGCTGTGGGATGG - Intronic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1160978556 19:1806203-1806225 GTGTGGGGAGGGTTGGCAGAGGG - Intronic
1161009233 19:1952198-1952220 GTGGGTGCAGGGCTGGACGAGGG + Intronic
1161048955 19:2151860-2151882 GTGTGAGCGTGGCTGGATGTGGG + Intronic
1161151420 19:2712060-2712082 GTGGGGGCTGGGCTGGCAGATGG + Intergenic
1161345635 19:3767586-3767608 GTGTCGGCCTGGCGGGAAGTGGG + Intronic
1161490075 19:4556788-4556810 GTGTGGCCAGGGCTGGCAGTTGG + Intronic
1161901924 19:7125582-7125604 GTGAGGGCTTGGGTGGAAGGTGG - Intronic
1162300191 19:9840497-9840519 GTCTGGGCATGGTTGAGAGATGG - Intronic
1162544486 19:11320447-11320469 GCGGGAGCATGGCTGGAAGCTGG + Intronic
1162790888 19:13062383-13062405 GTGTAGCCATGGTTTGAAGAAGG + Intronic
1162811018 19:13164316-13164338 GCGGGGGCATGGCTGGAGGGAGG + Intergenic
1162902866 19:13805629-13805651 GTGGAGGCATGGATGGATGATGG + Intronic
1162937624 19:13989258-13989280 GTGAGGGGATGGGTGGAAGTGGG + Intronic
1162950816 19:14071405-14071427 CAGTTGGCATGGCTGGAGGAAGG + Intergenic
1163674087 19:18646709-18646731 ATGCGGGCATGGCGGGCAGAAGG - Intronic
1163744101 19:19034523-19034545 GAGTGGGTGTGGCTGGTAGAGGG + Intronic
1163829357 19:19540477-19540499 GTGAGGGCGGGGCTGGATGACGG + Intronic
1166118105 19:40667843-40667865 GTGTGGGGGTGGCAGGAACACGG + Exonic
1166284268 19:41814164-41814186 GTGTGGGAAGGACTGGCAGATGG - Intergenic
1166377266 19:42334477-42334499 ATTTGGGCCTGGCTGGAGGAAGG - Intronic
1166687260 19:44802795-44802817 GAGTGGGCATGGCTGGGGTAGGG + Intergenic
1167043970 19:47039377-47039399 TGGTGGGCATGGTTGGAGGAGGG - Intronic
1167936192 19:52910656-52910678 GTTAGGACATGGCAGGAAGATGG + Intergenic
1167944042 19:52973162-52973184 GTCAGGACATGGCAGGAAGATGG + Intergenic
1167993256 19:53378679-53378701 GTCAGGACATGGCAGGAAGATGG - Intronic
1168323620 19:55525737-55525759 GTGTGGGCACGGCGGGAACCTGG + Intergenic
1168327020 19:55543764-55543786 GTGTGGGCATGGGTGGAGTTGGG - Intronic
925177496 2:1795607-1795629 GTGGGGGCCTGGCTGGGAGCTGG + Intronic
925254621 2:2472550-2472572 CTTTAGGCATGGGTGGAAGATGG - Intergenic
925918421 2:8623536-8623558 GGGTGGGCAGGGGTAGAAGAGGG - Intergenic
926670235 2:15570210-15570232 GTGTGGGAATCCATGGAAGACGG - Intergenic
927154790 2:20215307-20215329 GTATGGGCTGGGCTGGCAGATGG - Intronic
929655229 2:43724274-43724296 GAGTGAGCATAGATGGAAGAAGG + Intronic
929834466 2:45382285-45382307 TTGTGGGCCTGGCTATAAGAAGG + Intergenic
930892031 2:56401210-56401232 GTGAGGGCAAGGATAGAAGAAGG - Intergenic
932411247 2:71549297-71549319 GGGTGGGCATGGCTGGGAGAAGG - Intronic
932576792 2:72966784-72966806 CTGTGGGCCTGGCAGCAAGAAGG - Intronic
935044597 2:99469091-99469113 GTGGGGCCATGACTGGATGAAGG + Intronic
935698038 2:105786830-105786852 GTGGGAGCAGGGCTGGTAGAAGG - Intronic
935714717 2:105929746-105929768 GCTGAGGCATGGCTGGAAGAGGG - Intergenic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
936562766 2:113556065-113556087 GTCTGGCTTTGGCTGGAAGAAGG - Intergenic
938941796 2:136176076-136176098 GTGTTGGCATGCCAGGAAGTGGG + Intergenic
940751053 2:157628218-157628240 GTGCGCGCATGGCTGGGAGCTGG - Intronic
941751842 2:169142554-169142576 GAGTGGGGATGGCTGGAAGGAGG - Intronic
941995973 2:171602431-171602453 CTGAGGGATTGGCTGGAAGATGG - Intergenic
943307024 2:186275672-186275694 GTGAGGACATGGCAGAAAGATGG - Intergenic
944318377 2:198307524-198307546 GTGTGGGGAGGACTGGAATAAGG + Intronic
945412507 2:209528092-209528114 GGGTGGGCAGGGGGGGAAGATGG - Intronic
948229214 2:236337352-236337374 GTGTGGGCTGGGCAGGAGGAGGG - Intronic
948672260 2:239576074-239576096 GTTTGGGCAGGGCTTGGAGAGGG + Intergenic
948768148 2:240233798-240233820 CTGTGGGCAGGGCCGGAGGAGGG - Intergenic
948990557 2:241551853-241551875 GGGTGGGCAGGGCAGGAAGTGGG - Intergenic
1169842043 20:9949446-9949468 TTGGGGGCATAGCTGGAAGGTGG + Intergenic
1170866419 20:20161860-20161882 GAGAGGGCGTGGCTGGAGGAGGG - Intronic
1171298224 20:24037324-24037346 GTGGAGGCATTGCTGAAAGAGGG - Intergenic
1172638784 20:36428440-36428462 GTGTGAGCTTGGCTGGCAGGTGG + Intronic
1172705842 20:36881405-36881427 GTGAGGTCATTGCTGGAGGAAGG + Intronic
1173153078 20:40584375-40584397 AGCTGGGCATGGGTGGAAGAGGG - Intergenic
1173217443 20:41098742-41098764 GGATGGCCAAGGCTGGAAGATGG - Intronic
1173383984 20:42571807-42571829 GTGAGGGCATGGCTTGGACAAGG - Intronic
1173873841 20:46357583-46357605 GTGAGGGCAGAGCAGGAAGAGGG - Intronic
1174394685 20:50239677-50239699 GCCTGGGAATAGCTGGAAGAAGG + Intergenic
1174520210 20:51123549-51123571 GTGTGGGCATGCCTGGAGTGTGG + Intergenic
1174584118 20:51594213-51594235 GTTTGGGCATTCCTGCAAGAAGG + Intergenic
1175598672 20:60255496-60255518 GGCTGGGTCTGGCTGGAAGAAGG + Intergenic
1175933262 20:62503375-62503397 GTCTGGGCATGGCAGGGAGGAGG - Intergenic
1176587871 21:8607153-8607175 GTGTGAAGATGCCTGGAAGAGGG + Intergenic
1176605601 21:8827890-8827912 GAGTGAGCATGGCAGGAATAGGG + Intergenic
1177187587 21:17815029-17815051 CTGTGGGCATGGCTCTAAGTTGG - Intronic
1178290792 21:31366311-31366333 GTGTGGTCATGGCAAGAATAAGG - Intronic
1178540573 21:33446108-33446130 GTGTGGGCATGGCTGGCTTTGGG - Intronic
1179726508 21:43344140-43344162 GTGTGGGCAGGGCTGGAGGGGGG + Intergenic
1179879160 21:44286312-44286334 GTGTGGGGACGGCTGGGGGAAGG - Intronic
1180024994 21:45155948-45155970 GTGGGTGGATGGCTGGATGATGG - Intronic
1180270703 22:10584152-10584174 GTGTGAAGATGCCTGGAAGAGGG + Intergenic
1180347898 22:11719494-11719516 GAGTGAGCATGGCAGGAATAGGG + Intergenic
1180355677 22:11837596-11837618 GAGTGAGCATGGCAGGAATAGGG + Intergenic
1180382577 22:12154729-12154751 GAGTGAGCATGGCAGGAATAGGG - Intergenic
1180728603 22:17964347-17964369 CTGTGTACATGGCTGGGAGACGG - Intronic
1180731271 22:17984308-17984330 GTGTTGGCCTGGCTGGCAGCAGG - Intronic
1180818044 22:18805262-18805284 CTGTGGGCATGGCTGGCCTAGGG - Intergenic
1180935167 22:19620670-19620692 CTGAGGGCATGGCGAGAAGACGG + Intergenic
1181161164 22:20960748-20960770 GTGTGGGCAAGGAGGTAAGATGG - Intergenic
1181204262 22:21239717-21239739 CTGTGGGCATGGCTGGCCTAGGG - Intergenic
1181349482 22:22244898-22244920 GTGGGGGCAGGGCAGGATGAAGG - Intronic
1181453424 22:23038800-23038822 GGGAGGGCCTGGCTGGGAGAAGG + Intergenic
1181487570 22:23241316-23241338 GGGGGGGAATGGCAGGAAGAGGG - Intronic
1182124181 22:27804392-27804414 GTGTGTGAGTGGCTGAAAGAAGG + Intergenic
1182811906 22:33123875-33123897 GGGTGGGCTTGGCTGCTAGAGGG + Intergenic
1182904256 22:33921871-33921893 GTGTGAGAATGGATGGAAGGAGG + Intronic
1183281720 22:36935927-36935949 GTGTGGGGATGCCTGGGACAGGG + Intronic
1184405395 22:44297982-44298004 GGCTGGGCTGGGCTGGAAGATGG + Intronic
1184460546 22:44635305-44635327 GAGGGGGCATGGCAGGGAGAAGG + Intergenic
1184707392 22:46224058-46224080 TTGTGGGTGTGGGTGGAAGAGGG - Intronic
1185284857 22:49995647-49995669 GTGGGGGCAGGGCTGGGAGGTGG - Exonic
1203222660 22_KI270731v1_random:55698-55720 CTGTGGGCATGGCTGGCCTAGGG + Intergenic
1203268169 22_KI270734v1_random:31116-31138 CTGTGGGCATGGCTGGCCTAGGG - Intergenic
949139485 3:614592-614614 GTGTGAAGATGCCTGGAAGACGG - Intergenic
950190784 3:10974793-10974815 AGGAGGGCATGGCTGGCAGATGG + Intergenic
953127672 3:40107562-40107584 GAGTTGGCCTGGCTGAAAGAGGG + Intronic
953311279 3:41882117-41882139 GTGTGGCAGTGCCTGGAAGATGG - Intronic
953392830 3:42543770-42543792 GTGATGGCATGGCTGGGTGATGG - Intergenic
953874712 3:46660070-46660092 GTGTGGTCACAGCAGGAAGAGGG - Intergenic
955312631 3:57904762-57904784 GTGTGGGCCAGGGTGGAGGAGGG + Intronic
955339925 3:58117385-58117407 GGGTGGGCTTAACTGGAAGAGGG + Intronic
956386681 3:68726643-68726665 GTGGGGGCATGGGTTGAAGTAGG - Intergenic
957151930 3:76497433-76497455 GGGAGGCCATGGCGGGAAGAAGG - Intronic
958989648 3:100827986-100828008 GTTTGGGAATGGCTGCAAGTGGG + Intronic
961002567 3:123383910-123383932 GTGTGTGCATGCCTTGAGGAAGG - Intronic
961332930 3:126153650-126153672 GTCTGAGCAGGGCTGGGAGAGGG + Intronic
961457181 3:127030063-127030085 AGGTGGGCCTGGCTGGCAGATGG + Exonic
961647778 3:128401536-128401558 GTGTGAGCATGGCAGGCAGAGGG + Intronic
961736411 3:129004515-129004537 GTGGGGGGATGGATGGATGATGG - Intronic
962318092 3:134371143-134371165 CTGTGGGCATAGCCGGTAGAGGG + Exonic
962391241 3:134974616-134974638 GTTTAGGCAAGGCTTGAAGAAGG - Intronic
962902799 3:139775752-139775774 GTGGGGACATGGCAGGAAGGTGG + Intergenic
964443729 3:156739080-156739102 GTGTGGACAAGTCTGGAGGATGG - Intergenic
966834750 3:184040554-184040576 TTGTGGACATGCCTGGAGGACGG - Intergenic
967251256 3:187541634-187541656 GTTTAGGCATGGCTGGATGGAGG + Intergenic
968456572 4:703599-703621 GTTTGGGCATGAGAGGAAGAGGG + Intergenic
968458238 4:709623-709645 GTGCGGGCTTGCCTGGAAGTTGG + Intronic
968819362 4:2837922-2837944 CAGTGAGAATGGCTGGAAGATGG - Exonic
968943461 4:3651427-3651449 GCGTGGGCAGGGCAGGCAGAGGG + Intergenic
969219650 4:5751601-5751623 GTGTGGCCATGGCTGGTCAAGGG + Intronic
969352229 4:6604441-6604463 GGGTGGGAGTGGCTGGAGGATGG + Intronic
969599149 4:8165640-8165662 GTGTGGGCATGGAAGGGATAAGG + Intergenic
969827812 4:9771916-9771938 GCGTTGGAATGGGTGGAAGAGGG + Intronic
972386005 4:38566165-38566187 GTATGGATATGGCTGGAAAAAGG - Intergenic
973372509 4:49263099-49263121 GAGTGAGCATGGCAGGAATAGGG - Intergenic
973388494 4:49532042-49532064 GAGTGAGCATGGCAGGAATAGGG + Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
976862790 4:89686981-89687003 ATTTGGGCATGGCTTGAAGCAGG + Intergenic
977879565 4:102188401-102188423 GGGTGGGCCTGGCTGGCAGTTGG + Intergenic
977951573 4:102976907-102976929 GGGAGGCCAAGGCTGGAAGATGG + Intronic
978383236 4:108152811-108152833 GTGGTGGTATGGCTGGAAGGTGG - Intronic
981332350 4:143526520-143526542 GTATGGGTATAGCTGGAAGAAGG + Intronic
983900601 4:173129238-173129260 GTGTGTTCACGGATGGAAGATGG + Intergenic
984840721 4:184065071-184065093 GGGTGGGCGTGGCTGGAGAAAGG - Intergenic
985655208 5:1128137-1128159 GAGTGGGCGTGGCTGGGAGGTGG + Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
986301493 5:6481673-6481695 ATGTGGGCAAGGCTGGGGGAAGG - Intronic
986320160 5:6624455-6624477 GTTTTGGCATGTTTGGAAGATGG - Intronic
986428436 5:7657555-7657577 ATGTGTGCATGGCAGGGAGATGG - Intronic
986508411 5:8476783-8476805 GTGTTAGCAGTGCTGGAAGAGGG - Intergenic
986721027 5:10562050-10562072 GTCTGGACATTTCTGGAAGATGG - Intergenic
986728853 5:10620011-10620033 AGGTGGGCATGGCTGTAGGATGG + Intronic
987200994 5:15578021-15578043 GTGTGGTCATGGATGTAACACGG + Intronic
987574515 5:19707916-19707938 GTGTGGCCATGGCATGCAGATGG - Intronic
988523106 5:31963853-31963875 GTGTGGGCATGCCTGGGTGCTGG - Intronic
988841343 5:35086851-35086873 GTGTGGGGATGGCAGAAAGATGG - Intronic
989270351 5:39525996-39526018 GCGTGGGGATGGGTGGAGGAAGG - Intergenic
989304559 5:39938391-39938413 GTGGTGGCATGGTGGGAAGAGGG - Intergenic
992062159 5:73063830-73063852 TTGTGGGCCTGGCTGGTTGAGGG - Exonic
992225685 5:74618132-74618154 GTGTGGGCAGGGCAGGTATAGGG - Intergenic
993525172 5:88956398-88956420 GGGTGGGGATGCCTGGACGAGGG + Intergenic
994107537 5:95962962-95962984 GTGTAGGCGTGGCTAAAAGAGGG + Intergenic
994358795 5:98826525-98826547 GTCTAGGCAGGGCTGGGAGAGGG + Intergenic
995619017 5:114002663-114002685 GTGTGGGCTTGGCAGGTAGGGGG + Intergenic
996103489 5:119470292-119470314 GTGTGGGCATGGTGGGATGATGG + Intronic
997223499 5:132191094-132191116 GTGTTCGCATGGCAGAAAGAGGG + Intergenic
997614972 5:135240096-135240118 GTGTGGGCGGGGCTGGAGGTGGG - Intronic
997975340 5:138438788-138438810 GTGTGGGCAGGGCAGGAGGTGGG + Intergenic
998080986 5:139274593-139274615 ATTTGGGGATGGCTGGAAAAAGG + Intronic
999069199 5:148725733-148725755 GACTTGACATGGCTGGAAGAAGG + Intergenic
999143535 5:149378294-149378316 CTTGGGGGATGGCTGGAAGAGGG - Intronic
999156951 5:149464885-149464907 GTGAGGGTCTGGCTGGAAGATGG - Intergenic
1001259963 5:170220006-170220028 GTGTGGGCAAGACTGGATAAAGG + Intergenic
1001525497 5:172425780-172425802 GTGTGGAAACGGCTTGAAGAGGG + Intronic
1001557311 5:172645540-172645562 GTATTGCCATGGCTGGAAGGAGG - Intronic
1001577544 5:172773945-172773967 TTGTGGGCCTGGCTGCCAGAGGG + Intergenic
1001629005 5:173160644-173160666 GTGTCGGCAGGGCTGGGTGAGGG + Intronic
1001678909 5:173541718-173541740 GTGTGGGCATGGCCAGGAGCAGG + Intergenic
1002090244 5:176800797-176800819 GTGTGTGCATGTCTGGATGTGGG + Intergenic
1002108330 5:176891344-176891366 GCGTGGCCAGGCCTGGAAGAGGG - Intronic
1002136186 5:177109157-177109179 GTGTGGGGAAGGCAGGAGGAGGG + Intergenic
1002188615 5:177467661-177467683 GGGTGGGGATGGCGGGAGGATGG - Intronic
1002193861 5:177491969-177491991 GTGGGGGCCTGGGTGGAAGTGGG + Intronic
1003814951 6:9829095-9829117 GAGAGGCCATGGCTGGAAGTAGG + Intronic
1005036634 6:21561373-21561395 CAGTGGGCAGGGCTGGAAGTGGG - Intergenic
1006395877 6:33787513-33787535 ATGTGGCCTTGGCTGGAAGCTGG + Intronic
1006439119 6:34042428-34042450 GTGAGGACATGGCAGGAGGATGG + Intronic
1006474327 6:34245012-34245034 GTGAGGGCACAGGTGGAAGATGG - Exonic
1007288517 6:40765934-40765956 GTGTGTGGAGGGCAGGAAGAGGG - Intergenic
1007323277 6:41042125-41042147 GTGGGGCCTTGGCTGGAGGAGGG + Intronic
1007395161 6:41573539-41573561 ATGGGGGCTGGGCTGGAAGAGGG + Intronic
1011184296 6:84657289-84657311 GTGAGGACACGGCTAGAAGATGG + Intergenic
1013115580 6:107101323-107101345 GGGTGGGGATGGCAGCAAGAGGG + Intronic
1013612778 6:111810690-111810712 GTGTAGGCATGTGTGGAAGTGGG - Intronic
1016292171 6:142538036-142538058 GTTGGGGCATGGGCGGAAGATGG - Intergenic
1016559909 6:145384410-145384432 GTGGGGGCATGGAAGGAAGAAGG + Intergenic
1016627803 6:146192867-146192889 AGGTGGGCACAGCTGGAAGAAGG + Intronic
1018034705 6:159872043-159872065 GGGTGGTGATGGCAGGAAGATGG + Intergenic
1018767353 6:166944854-166944876 GTGTGGGCCTGGTGGGCAGAGGG - Intronic
1018767433 6:166945135-166945157 GTGTGGACGTGGGTGGATGAGGG - Intronic
1019694414 7:2437172-2437194 GTGTGGACACAGCTGGAGGATGG - Intergenic
1020011860 7:4809575-4809597 GTGTCTGCAGGGCTGGAAGTGGG - Intronic
1020842585 7:13238380-13238402 GTGTGGTCCTGGCTGCAAGCAGG + Intergenic
1023257249 7:38324083-38324105 TTGTGGGCATGGCAAGAAAAGGG + Intergenic
1023772026 7:43566536-43566558 GTGTGGGGAGGACTGGGAGAAGG + Intergenic
1027352698 7:77327817-77327839 GAGCGGGGATGGCTGGAGGAGGG - Intronic
1027439456 7:78203188-78203210 GTTTGGGCATTGCAGGAAGAAGG - Intronic
1032388344 7:131539678-131539700 CTGAGGGCGGGGCTGGAAGAAGG + Intronic
1032772667 7:135075193-135075215 GAGTGGGTATGGCTTTAAGAGGG - Intronic
1034297831 7:149990058-149990080 GTGTGGGGAGGGATGGATGAAGG - Intergenic
1034345766 7:150384288-150384310 GTGTGGGCACTGGTGGGAGATGG + Intronic
1034398451 7:150845843-150845865 GTGTGAGCATGGCTGGCTGCTGG - Intronic
1034427810 7:151023845-151023867 GTGTGGGTGTGGGTGGGAGAGGG - Intronic
1034467049 7:151235903-151235925 GTGTGGGCATGTCTTAGAGATGG + Intronic
1034746956 7:153531380-153531402 ATGTGGGCAAGGATGAAAGAGGG - Intergenic
1035288256 7:157819757-157819779 GTGTGCCCATGGCTGGCAGTGGG - Intronic
1035470173 7:159104554-159104576 GTGAGGGCCTGGCTGGGAGGAGG - Intronic
1035470215 7:159104691-159104713 GTGAGGGCCTGGCTGGAAGGAGG - Intronic
1035905091 8:3500725-3500747 GTGTGGGCTTGACTGGATGGAGG + Intronic
1036137563 8:6175878-6175900 GAGAGGGCAGGGCAGGAAGAGGG - Intergenic
1036382144 8:8243262-8243284 ATGTAGGCATAGCTGGAAGGTGG + Intergenic
1036390362 8:8319140-8319162 GTGTGGGCAGGGCAGGCACAGGG + Exonic
1037901585 8:22692234-22692256 GTGTGGGGACGGCGGGGAGAAGG - Intronic
1038195112 8:25360188-25360210 ATGTGGGCATGGCAGAAAGGTGG - Intronic
1039406646 8:37318712-37318734 GCGAGGGCAGGGCTGGAAGGTGG - Intergenic
1039750021 8:40470163-40470185 GTGTGGGGATTGCAGGGAGAAGG + Intergenic
1040802734 8:51361512-51361534 ATGTAGGCATAGCTGGAAGGTGG - Intronic
1041017113 8:53601722-53601744 GTGAAGGCATACCTGGAAGAGGG - Intergenic
1041100996 8:54396347-54396369 GTGTGGGCATTGCGGGGAGAAGG + Intergenic
1041648507 8:60277989-60278011 CAGTGGGCAGGGGTGGAAGAAGG + Intronic
1044208511 8:89521260-89521282 GTGTGGGCATAGCTTGAAGGGGG - Intergenic
1045393239 8:101735726-101735748 TTGTGTTCATGGCTGAAAGAAGG + Intronic
1047473782 8:125205302-125205324 GTATGTGCTTGGCAGGAAGAGGG + Intronic
1048293661 8:133198877-133198899 GTATGGGCAAGCCTGGTAGAGGG - Intronic
1048369924 8:133768370-133768392 GAGGTGGCAGGGCTGGAAGAAGG + Intergenic
1048544375 8:135372683-135372705 GTGAGGACATGGGGGGAAGATGG + Intergenic
1048726879 8:137396274-137396296 GTCAGGGGATGGTTGGAAGAAGG - Intergenic
1048787111 8:138062358-138062380 CGGAGGGCATGGCCGGAAGAAGG + Intergenic
1049065991 8:140314596-140314618 GTCTGGGGATGGTTGGGAGAAGG - Intronic
1049258234 8:141625146-141625168 GTGTGGGGTTGGCTGGAGCAGGG + Intergenic
1049576370 8:143391750-143391772 CTGTGGCCTTGGCTGGAGGAGGG - Intergenic
1049889965 9:59634-59656 GTCTGGCTTTGGCTGGAAGAAGG + Intergenic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1050350254 9:4734384-4734406 GTGTGGGCATGGGAGCAGGAGGG - Intronic
1051593058 9:18795953-18795975 CTGTGGTCATGGCTTGAAGCAGG + Intronic
1053458823 9:38252680-38252702 GAGTGGGTATGGCTGCATGAAGG - Intergenic
1053731444 9:41060909-41060931 GTCTGGCTTTGGCTGGAAGAAGG + Intergenic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1054697067 9:68371186-68371208 GTCTGGGTTTGGCTGGAAGAAGG - Intronic
1055295080 9:74825914-74825936 GGGTAGGAATGGCTGGGAGAAGG - Intronic
1056136269 9:83632189-83632211 GAGTGGGAATGGCGGGGAGATGG - Intronic
1056998380 9:91484868-91484890 GCATGGGCTGGGCTGGAAGAGGG + Intergenic
1057250528 9:93497660-93497682 GTGTGGCCAGGTTTGGAAGAAGG + Intronic
1057749945 9:97784341-97784363 TAGTGGGAATGGCTGGAAGGCGG - Intergenic
1058038515 9:100279366-100279388 GTATGGGCTTGGCTGGTAGAAGG - Intronic
1059525234 9:114985063-114985085 GTGTGAGCATGTGTGGAAGAGGG + Intergenic
1060039390 9:120286721-120286743 GTGAGGGCCTGCCTGGCAGAGGG + Intergenic
1060054724 9:120403680-120403702 GTGTGGGCCTGTCTGCAGGATGG + Intronic
1060147981 9:121268336-121268358 GCGGGGGCATCGCTGGAAAAGGG + Intronic
1060821241 9:126662651-126662673 GTGTGGGCTGGGCTGGGAGCCGG + Intronic
1060850916 9:126874688-126874710 GTGTGTGCACAGCTGGAACAAGG - Intronic
1061136889 9:128739908-128739930 GTGTGGGCAGGGCAGGGAGCGGG - Intronic
1061451267 9:130668084-130668106 GTGTGGATGTGCCTGGAAGATGG + Intronic
1062130463 9:134889897-134889919 CTGTCGGGAGGGCTGGAAGAAGG + Intergenic
1062412728 9:136433116-136433138 GGGTGGGCGCGGCTGGAAGGTGG - Intronic
1062538291 9:137030425-137030447 GTGAAGGCCTGGCTGGAAGAGGG - Exonic
1203376440 Un_KI270442v1:381448-381470 GTTTGGGCCGGGCTAGAAGAGGG - Intergenic
1203552994 Un_KI270743v1:179898-179920 GAGTGAGCATGGCAGGAATAGGG + Intergenic
1203617877 Un_KI270749v1:85737-85759 GTGTGAAGATGCCTGGAAGAGGG + Intergenic
1185495289 X:549972-549994 GTGGGTGGATGGATGGAAGAAGG - Intergenic
1185867909 X:3639407-3639429 GTGGGTGCATGGATGGATGAAGG + Intronic
1187963961 X:24592570-24592592 GAGTGGGCAAGGCTGGAATCAGG - Intronic
1188590698 X:31831084-31831106 GTGTGGGCATCTCAGTAAGAGGG - Intronic
1189570515 X:42291010-42291032 GTGGCTGCATGGATGGAAGAGGG + Intergenic
1189693776 X:43642927-43642949 GAGTTGGCATGGGTGGAGGAAGG - Intergenic
1190767852 X:53490245-53490267 GGGTGGTCGTGGCAGGAAGAGGG + Intergenic
1192171049 X:68855026-68855048 TTGTGGGCCTGGCTCGAAGGTGG + Intergenic
1192244554 X:69361781-69361803 GTGGGGGCAGGGGTGGGAGATGG + Intergenic
1192348229 X:70330735-70330757 AAGTGGGCATGACTAGAAGAAGG + Intronic
1192800128 X:74457762-74457784 GTGTGGGAATGGCAAGTAGATGG - Intronic
1192924237 X:75738684-75738706 GGGTGGGGATAGCTGGAAGAAGG - Intergenic
1193811100 X:86052847-86052869 CTTTTGGCATGGCTGTAAGAAGG - Intergenic
1195884597 X:109625334-109625356 GTGGGGGCGAGGCTGGGAGACGG + Intronic
1197743103 X:129910847-129910869 GTGTTGGCATGGCTAGAAATAGG + Intronic
1197888481 X:131242412-131242434 GTGGGGGGATTGCTGAAAGATGG + Intergenic
1197990257 X:132309933-132309955 GGGTGGGACTGGCTGTAAGATGG + Intergenic
1198019621 X:132645070-132645092 GTGGGGGAAAGGCTGGAAGAAGG - Intronic
1199979505 X:152913245-152913267 TTGTGGGCATGACAGGAAGCAGG - Intergenic
1200089124 X:153626201-153626223 GGGTGGGCAAGGCTGGGACATGG - Intergenic