ID: 1105408617

View in Genome Browser
Species Human (GRCh38)
Location 13:20151468-20151490
Sequence GTGACTTCCCGCCAGCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105408617_1105408623 29 Left 1105408617 13:20151468-20151490 CCCCCATGCTGGCGGGAAGTCAC 0: 1
1: 0
2: 0
3: 4
4: 97
Right 1105408623 13:20151520-20151542 CTCCCGATACCCCGGAGAAGTGG 0: 1
1: 0
2: 0
3: 4
4: 75
1105408617_1105408622 21 Left 1105408617 13:20151468-20151490 CCCCCATGCTGGCGGGAAGTCAC 0: 1
1: 0
2: 0
3: 4
4: 97
Right 1105408622 13:20151512-20151534 GTGTCAGACTCCCGATACCCCGG 0: 1
1: 0
2: 0
3: 3
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105408617 Original CRISPR GTGACTTCCCGCCAGCATGG GGG (reversed) Intronic
900437365 1:2637562-2637584 GTGCCTCACAGCCAGCATGGGGG - Intronic
900493982 1:2967878-2967900 GTCACTGCACTCCAGCATGGAGG + Intergenic
900798383 1:4723258-4723280 GTGACATCCAGCCACCCTGGCGG + Intronic
901272350 1:7961970-7961992 TTGACTGACCGCCAGCGTGGTGG + Intronic
902160286 1:14524348-14524370 GTGACATCCTGGAAGCATGGAGG + Intergenic
902194909 1:14791263-14791285 GCATCTTCCCGCCAGCTTGGGGG + Intronic
902919345 1:19657048-19657070 GGGTCTGCCCGCCAGGATGGGGG - Exonic
905991842 1:42344488-42344510 AGGGCTCCCCGCCAGCATGGTGG + Intergenic
906647264 1:47484054-47484076 CTGCCTTCCCGCCAGGCTGGTGG - Intergenic
909896625 1:81078821-81078843 TTAACCTCCCACCAGCATGGTGG - Intergenic
911061320 1:93750688-93750710 GTGGCTTCCCCACAGCGTGGTGG - Intronic
911646486 1:100342470-100342492 GTGTCTTCCTGCCAGCAAGCGGG + Intergenic
915195099 1:154183272-154183294 CTGCCTTCCCGCCTGCCTGGCGG - Intronic
915674338 1:157516275-157516297 GTGACTTCCCCCAACCACGGAGG - Intronic
919860752 1:201738220-201738242 CAGACTTCCCCCTAGCATGGGGG - Intronic
921701627 1:218274980-218275002 GAGAGTTCCCACCAGCATGAAGG + Intergenic
922362002 1:224831589-224831611 GTGGCTTCCCCACAACATGGTGG - Intergenic
1062818920 10:519514-519536 CTGATTTCCCACCAGGATGGAGG - Intronic
1070689280 10:78512624-78512646 GAGACTTCTGGCCAACATGGTGG + Intergenic
1075586454 10:123661950-123661972 CTGACTTCCCTCCAGCTTGAAGG + Intergenic
1080269128 11:30432126-30432148 GCCACTGCCCTCCAGCATGGGGG + Intronic
1082701806 11:56441596-56441618 GTGGCTTCCCTCCACCAGGGAGG + Intergenic
1083282952 11:61638636-61638658 GTGACCTCTCGCCAGCATCGGGG + Intergenic
1089348011 11:117804004-117804026 GTGACTGGCCACCAGCATTGTGG + Intronic
1089671142 11:120057873-120057895 GAGGCTTCCCGCCAGGATGTTGG + Intergenic
1091764576 12:3110390-3110412 GAGACTTTTGGCCAGCATGGTGG - Intronic
1099446212 12:82754694-82754716 GTCACTACCCTCCAGCCTGGGGG + Intronic
1101542063 12:105674387-105674409 TTGGCTTCCTGGCAGCATGGCGG - Intergenic
1105408617 13:20151468-20151490 GTGACTTCCCGCCAGCATGGGGG - Intronic
1106098362 13:26670552-26670574 GTGAGTTCCCGCCTTCATGAAGG + Intronic
1106236219 13:27862736-27862758 GTGACTTCCTCACAGCATGGTGG + Intergenic
1108585459 13:51866469-51866491 GTGACCTCCCCACAGCGTGGCGG - Intergenic
1112159009 13:96849012-96849034 GTCACTTCCTACCAGCATTGAGG - Intergenic
1119406012 14:74400132-74400154 GTGACTTGCCTCCAGGCTGGAGG - Intergenic
1119765291 14:77183873-77183895 GTGGTTTCCCTCCAGTATGGTGG - Intronic
1119787336 14:77323385-77323407 GTCACTGCCCTCCAGCCTGGGGG - Intronic
1130832464 15:87615606-87615628 ATGACCTCTTGCCAGCATGGTGG + Intergenic
1132706457 16:1245640-1245662 GTGCCTTCCCGCCCGTGTGGTGG + Intergenic
1132857427 16:2052993-2053015 ATGACTTCCTGCCAGCATTCCGG + Intronic
1134348958 16:13418550-13418572 TGGACTTCCCCCCAGTATGGCGG + Intergenic
1139819289 16:69707732-69707754 GTGACTGAGGGCCAGCATGGTGG - Intronic
1139938886 16:70590785-70590807 GAGACTTCCACCCAGGATGGAGG - Intronic
1141081975 16:81060785-81060807 CTGACGTGCGGCCAGCATGGAGG + Intronic
1144704032 17:17355681-17355703 CTGACTTCCCTGCAGCAGGGAGG + Intergenic
1145406916 17:22607855-22607877 GTCACTGCCCTCCAGCCTGGGGG - Intergenic
1146292234 17:31616774-31616796 GTCACTTCACTCCAGCCTGGGGG + Intergenic
1150871600 17:68918039-68918061 GTGATTACCCGCCAGGATGTCGG + Exonic
1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG + Intronic
1154355391 18:13620372-13620394 GTCACTTCCTTCCAGCACGGGGG + Intronic
1155750269 18:29413601-29413623 GTGACTGCACTCCAGCCTGGGGG + Intergenic
1160799238 19:960180-960202 GTGACCTCCCTCCAGCGGGGTGG - Intronic
1163471489 19:17500003-17500025 TCTACTTCCTGCCAGCATGGAGG + Intronic
1166141599 19:40808178-40808200 GTCACTTCCCACCAGGATGCAGG + Exonic
925374939 2:3377683-3377705 GTCGCTTCCCCGCAGCATGGAGG - Exonic
930007752 2:46911632-46911654 GTGATTTTCAGCCGGCATGGTGG + Intronic
932965816 2:76473524-76473546 GCGACTTGGCCCCAGCATGGTGG + Intergenic
934809168 2:97266354-97266376 TTGAATTCTCCCCAGCATGGAGG - Intergenic
934828337 2:97490815-97490837 TTGAATTCTCCCCAGCATGGAGG + Intergenic
936074775 2:109394815-109394837 CTGGCTTCCCTGCAGCATGGAGG + Intronic
937271894 2:120658282-120658304 GAGACTTCCTCACAGCATGGTGG - Intergenic
937905431 2:127050667-127050689 GTCACTCCCAGCCAGCAAGGTGG - Intronic
945502376 2:210591915-210591937 GTGGTTTCCAGCCAGCAGGGAGG - Exonic
947835156 2:233169956-233169978 GTGACTTCCTGCCACAGTGGAGG + Intronic
947874271 2:233458170-233458192 GTAACTTCTCGCCAGCTAGGAGG + Intronic
948574064 2:238938525-238938547 GTGACTTCCCACCCGGGTGGCGG + Intergenic
949003755 2:241633596-241633618 CTGACTGCCTGCCACCATGGTGG + Exonic
1175184871 20:57173370-57173392 GTGGTTTCTGGCCAGCATGGGGG - Intronic
1175784155 20:61701592-61701614 GTGCCTTCCAGCCAGCACAGCGG + Intronic
1175812957 20:61868649-61868671 GGGACATCCGCCCAGCATGGAGG - Intronic
1179837184 21:44043827-44043849 TTGGCTTCCCCACAGCATGGTGG - Intronic
1181478250 22:23181395-23181417 GGGACCCCCCGCCAGCGTGGCGG + Exonic
950753253 3:15148691-15148713 TTGACTCCTCCCCAGCATGGAGG - Intergenic
959210090 3:103367653-103367675 GTAAATAGCCGCCAGCATGGAGG - Intergenic
960492407 3:118333409-118333431 GTGACTTCCAGGCAGCTAGGAGG - Intergenic
970163090 4:13209069-13209091 GTGGCTTCAAGCAAGCATGGAGG - Intergenic
970519419 4:16867098-16867120 TGGACTTCCCCACAGCATGGAGG - Intronic
974673295 4:65058519-65058541 GTGACTGCCCTCCACCAGGGAGG - Intergenic
985881114 5:2640078-2640100 GTGGGTTCCAGCCAGCATTGGGG - Intergenic
986311151 5:6551947-6551969 GGGGCTTCCCTTCAGCATGGGGG - Intergenic
997393945 5:133541413-133541435 GAGTGTTCCAGCCAGCATGGTGG + Intronic
1002227811 5:177737247-177737269 TTGCCTTCCCTCCACCATGGAGG - Intronic
1016940929 6:149482407-149482429 GTGACTTCCAGTCAGGACGGAGG - Intronic
1019208640 6:170385542-170385564 TTGAATTCCCACCAGCAAGGAGG - Intronic
1019280391 7:196907-196929 GTTACTCCCAGGCAGCATGGAGG - Intronic
1019349199 7:545644-545666 TTGCCTTCCCGCCAGCAGTGTGG - Intergenic
1019540328 7:1548330-1548352 GAGAGGTCCCGCCAGCACGGGGG - Intronic
1019780684 7:2938107-2938129 GTGCCTTCCCGCCAGCTGGCTGG + Intronic
1029904611 7:104078822-104078844 GTGACTTCCAGGGAGCATGCTGG + Intergenic
1029963948 7:104718533-104718555 GTGACTTTCCCTCAGCATCGTGG + Intronic
1035268366 7:157704950-157704972 GAGCCTTCCTGCAAGCATGGAGG - Intronic
1037907471 8:22723995-22724017 TTGCCTTCCTGCCAGCCTGGGGG + Intronic
1038325778 8:26571703-26571725 CAGACTGCCGGCCAGCATGGGGG - Intronic
1039449800 8:37663297-37663319 GAGAATTCCCGCCAGCAAGAAGG - Intergenic
1047002678 8:120588547-120588569 CTGACTTCCTGGCAGCAAGGAGG + Intronic
1049498320 8:142947152-142947174 GAGTCTTCCGGCCAGCCTGGGGG + Intergenic
1049961506 9:742218-742240 GTGACTGACCGCCAGCATGAGGG - Exonic
1054777735 9:69138179-69138201 GGGACCTCCAGACAGCATGGAGG - Intronic
1062401098 9:136372993-136373015 GTCCCTTTCTGCCAGCATGGTGG + Intronic
1062408397 9:136409088-136409110 AAGACTTCCTGCCAGCATGGTGG - Intronic
1062639447 9:137510803-137510825 GTGACTTTCCGCCCACACGGGGG - Intronic
1186407713 X:9318211-9318233 GTGACTTCCAGGGAGGATGGAGG + Intergenic
1188287329 X:28343792-28343814 GTTACTGCCCTCCAGCCTGGGGG - Intergenic