ID: 1105409810

View in Genome Browser
Species Human (GRCh38)
Location 13:20161690-20161712
Sequence AAGTGTGTCTGAAGAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 298}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105409810_1105409813 -1 Left 1105409810 13:20161690-20161712 CCTGCTTCTCTTCAGACACACTT 0: 1
1: 0
2: 2
3: 29
4: 298
Right 1105409813 13:20161712-20161734 TAATTTAGCCGGCAGGCACACGG 0: 1
1: 0
2: 0
3: 3
4: 53
1105409810_1105409812 -8 Left 1105409810 13:20161690-20161712 CCTGCTTCTCTTCAGACACACTT 0: 1
1: 0
2: 2
3: 29
4: 298
Right 1105409812 13:20161705-20161727 ACACACTTAATTTAGCCGGCAGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105409810 Original CRISPR AAGTGTGTCTGAAGAGAAGC AGG (reversed) Intergenic
901744765 1:11364934-11364956 AATTGTGACTGAAGTGAAGGGGG - Intergenic
902615607 1:17621963-17621985 AAGGGTCTCTGGGGAGAAGCAGG + Intronic
903484901 1:23682405-23682427 AAGTTTGTTTGAAGAAAAGGTGG + Intergenic
904500757 1:30911547-30911569 CAGTGTCTTTGAAGAGCAGCAGG - Intergenic
904656885 1:32055483-32055505 ATGTGGGTCTCAAGAGAAGAGGG - Intronic
907803225 1:57792294-57792316 AAATGTGTCTGATGAGAACAAGG - Intronic
907850587 1:58250982-58251004 AAGTGTGTCGGCACTGAAGCAGG + Intronic
909144608 1:71914268-71914290 AATTCTGTCTATAGAGAAGCTGG - Intronic
909496620 1:76286107-76286129 AAATATGTCTGAAGAGTAACAGG + Intronic
910257940 1:85267753-85267775 AAGTGTAGTTGAAGAGAAGATGG + Exonic
912134170 1:106638889-106638911 AAGAGTCAGTGAAGAGAAGCTGG + Intergenic
912495094 1:110086383-110086405 AAGTGTGGCTGAGGAAGAGCTGG - Intergenic
912623957 1:111192595-111192617 AAGTGACTCTGAAGAGAAGAGGG + Intronic
912799467 1:112712084-112712106 GAGTGGGTCTGAAGAGAACCAGG - Intronic
912972218 1:114294197-114294219 AAGTGTTTCAGATGACAAGCAGG + Intergenic
913250335 1:116908125-116908147 CAGTGTGTATGAACAGAACCAGG + Intergenic
913547902 1:119887600-119887622 ATGTGTTTGTGAAGAGAAGAAGG - Intergenic
914418745 1:147508992-147509014 AAGTGTGTCTTAGGTGATGCTGG - Intergenic
915727648 1:158029713-158029735 AATTGTGTCTGAACATTAGCAGG - Intronic
916829719 1:168478193-168478215 AAGTGTCTCTGATGAAAAGAAGG - Intergenic
917397067 1:174604628-174604650 AAAAGTGTCTGGAGAGAAGGTGG - Intronic
917633886 1:176916914-176916936 AAGTGAGGCTGGAGAGAGGCTGG - Intronic
918136924 1:181681945-181681967 AAGTGTGGCTGAAGAGAAGTAGG - Intronic
918737900 1:188089676-188089698 AAGTGTGACTGAATAGATGCAGG - Intergenic
921362423 1:214342293-214342315 AACTGTGTCTGCAAAGAAGAAGG - Intergenic
921677586 1:217993493-217993515 AAGTGTGTGTGAGGAGAGGGTGG - Intergenic
921932975 1:220770391-220770413 AAGTGTGTCTTCAGAGACGGTGG + Intronic
922006060 1:221531846-221531868 AAGTGTGTATGAAGGGGAGGGGG + Intergenic
922481436 1:225942088-225942110 ATGTGTGTTTGAAGAGACACAGG - Intergenic
923377973 1:233385404-233385426 AAGTGTGTCTTCTGAAAAGCTGG - Intergenic
924177359 1:241405723-241405745 CAGTGTGGCTGATGAGAAGGGGG + Intergenic
924465932 1:244299263-244299285 TTGTGTCTCTGCAGAGAAGCAGG - Intergenic
1063402366 10:5758591-5758613 TTGTGTGACAGAAGAGAAGCAGG - Intronic
1063451171 10:6151265-6151287 CAAGGTGTCTGAAGAGCAGCGGG + Intronic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1066500436 10:35988456-35988478 AGGTGAGTCTGAAGAGATGTAGG + Intergenic
1066628325 10:37432687-37432709 AGGTGAGTCTGAAGAGATGTAGG + Intergenic
1068290996 10:55001365-55001387 AAGTGTGTGTGTAGAGCAGGGGG - Intronic
1068874923 10:61985727-61985749 ACGTGTGTATGATGAGAATCAGG + Intronic
1070266037 10:74904149-74904171 CAGTGAGTCTCCAGAGAAGCTGG - Intronic
1071735542 10:88294957-88294979 AAGTGTGACAAAAGAGAAGGTGG - Intronic
1072531847 10:96327016-96327038 ATGTGTGTCTGAAGCAAGGCAGG - Intronic
1074281374 10:112054880-112054902 ACTTGTGTCTGAAGAGAGGAAGG - Intergenic
1074680509 10:115902216-115902238 AAGTGTGTCTGCAGAGCATGGGG - Intronic
1075454760 10:122577918-122577940 CAGAGTATCTGCAGAGAAGCAGG - Intronic
1077332336 11:1989137-1989159 GGGTGTGTCTGGAGAGAAGGGGG + Intergenic
1077986340 11:7355108-7355130 AAGTGTGTGAGAAGAGTTGCAGG - Intronic
1078164722 11:8872065-8872087 CAGTGTGTATGAACATAAGCAGG + Intronic
1079985409 11:27195129-27195151 GAGTGTGTCTGGAGAAATGCTGG - Intergenic
1081586340 11:44386577-44386599 AATTGAACCTGAAGAGAAGCAGG - Intergenic
1084960435 11:72713431-72713453 AAGGGTGGCAGAGGAGAAGCTGG + Intronic
1085124746 11:73992263-73992285 AAGAGTCTATGAAAAGAAGCCGG + Intergenic
1085746355 11:79117890-79117912 AGGTATGTCTGAAGGGAAGGGGG - Intronic
1086862542 11:91941992-91942014 AAGTGGATCAGAAGAGAAGGTGG + Intergenic
1087229386 11:95642854-95642876 AAATGTTTCTCAAGAGAAGAAGG + Intergenic
1091168704 11:133502112-133502134 AAGCGTGGCAGAAAAGAAGCTGG + Intronic
1091176228 11:133560600-133560622 ACGTCTGACTGGAGAGAAGCTGG - Intergenic
1091187940 11:133663311-133663333 ATGTGGGTCTGCAGAGAGGCTGG - Intergenic
1202815318 11_KI270721v1_random:44313-44335 GGGTGTGTCTGGAGAGAAGGGGG + Intergenic
1091848530 12:3676908-3676930 AAGAGTGTTGGAAGAGGAGCAGG - Intronic
1092180691 12:6444824-6444846 AAGCATGTTTGAAGAGCAGCAGG + Intergenic
1092958260 12:13570276-13570298 AACTGTGTCTGAAAGGAAGAAGG + Intronic
1095605324 12:44060627-44060649 AAGTATGTCTGGAGAGGAGCAGG + Intronic
1096010049 12:48205379-48205401 CATAGTGTTTGAAGAGAAGCTGG + Intergenic
1096284101 12:50283354-50283376 AAGAGGGTGTGGAGAGAAGCCGG + Intronic
1096943380 12:55375003-55375025 AAGTGTCTCTTAAGAGAAAGGGG + Intergenic
1097216803 12:57420486-57420508 AAGTGTGTGTAATGAGAAGTAGG - Intronic
1097235489 12:57536573-57536595 CAGCGTCTCTGAAGAGATGCTGG - Intronic
1098630580 12:72716998-72717020 AATTTTGTCTAAGGAGAAGCTGG - Intergenic
1098908494 12:76185864-76185886 AAGTGGGGGTGAAGAGAAGGTGG - Intergenic
1099631514 12:85152317-85152339 CAGTGTTTGTGAAGGGAAGCGGG - Exonic
1100125390 12:91418399-91418421 AAGTGTCTTTGAAGAAGAGCTGG + Intergenic
1100406895 12:94279740-94279762 AAGTGTCACTGAATGGAAGCTGG - Intronic
1100521716 12:95381609-95381631 AAGGGAGGATGAAGAGAAGCGGG + Intergenic
1101232767 12:102757900-102757922 ATGCCTGGCTGAAGAGAAGCAGG + Intergenic
1101503073 12:105321741-105321763 AAGAGGGTCTGGAGAGTAGCAGG + Intronic
1102409212 12:112702640-112702662 AAGAGTGACTGAAGAGAAGAGGG + Intronic
1104227981 12:126855243-126855265 AAGCGTGGATGAAGAGAGGCTGG + Intergenic
1104474946 12:129063592-129063614 TGGTGGGTCTGCAGAGAAGCTGG - Intergenic
1104807352 12:131598186-131598208 TTGGGTGTCTGAAGAGAACCTGG + Intergenic
1104955511 12:132463380-132463402 CAGTGTGCCTGAGGAGAAACAGG + Intergenic
1105409810 13:20161690-20161712 AAGTGTGTCTGAAGAGAAGCAGG - Intergenic
1105786742 13:23757569-23757591 AAGAGTGAAGGAAGAGAAGCTGG + Intronic
1105815445 13:24032136-24032158 AATTCTTGCTGAAGAGAAGCCGG - Intronic
1107604912 13:42048212-42048234 AAGTGTCTCTGGAGAGATTCGGG + Intronic
1108275721 13:48807596-48807618 TGGTGTGGCTGGAGAGAAGCGGG - Intergenic
1111416356 13:87950422-87950444 AAGTATTTCAGAAGAGATGCTGG - Intergenic
1111650706 13:91087615-91087637 AATGCTGTGTGAAGAGAAGCAGG - Intergenic
1112647634 13:101353364-101353386 ATGATTGTCTGAAGTGAAGCTGG - Intronic
1115809010 14:37085076-37085098 AATTGTGTCTGAAGTGGAGAGGG + Intronic
1115833345 14:37367529-37367551 AAGTGTATCTGAAGAAAAAGAGG - Intronic
1115964096 14:38867324-38867346 AACTGAGTCTGAAGAATAGCAGG - Intergenic
1116815654 14:49581258-49581280 AAGTGTGACAGAAGGGAAGCTGG - Intronic
1118074610 14:62284354-62284376 AAGTGAGTGGAAAGAGAAGCGGG - Intergenic
1120403417 14:84063203-84063225 AAGTGTGACTGAGGGGGAGCTGG + Intergenic
1120754474 14:88229363-88229385 AAGTGGGTCTAAGGAGAACCAGG - Intronic
1121548409 14:94779867-94779889 AGGTGTGACTGAAGAGACACAGG - Intergenic
1121851924 14:97229133-97229155 TGGTGTGTCTGATGAAAAGCAGG + Intergenic
1122796041 14:104206775-104206797 GTGTGTGTGTGAAGGGAAGCAGG + Intergenic
1122815543 14:104310382-104310404 AAACATATCTGAAGAGAAGCAGG + Intergenic
1123923086 15:25084306-25084328 AAGTCAGTCTGCAGAGATGCAGG - Intergenic
1124583211 15:30980737-30980759 AAGTGGGGGTGAAGAAAAGCGGG + Intronic
1124856683 15:33396105-33396127 CATAGTGGCTGAAGAGAAGCAGG + Intronic
1126141574 15:45443666-45443688 TAGTGTGTCTGAACAGTGGCCGG - Intronic
1127534032 15:59873352-59873374 AGGTGTGTCTGAAGAAACGATGG - Intergenic
1130891656 15:88138560-88138582 CAGTGTGGCTGAAGAGGAGGAGG - Intronic
1131538136 15:93254282-93254304 GAGTGTCTCAGAACAGAAGCCGG - Intergenic
1131943077 15:97588664-97588686 AAATGTGTGTGAATAGAGGCTGG - Intergenic
1132791301 16:1690188-1690210 AAGCGGGTCTGAAGACGAGCAGG + Intronic
1133507656 16:6427984-6428006 AAATGTGTTTGATGAGAGGCCGG + Intronic
1133687807 16:8182827-8182849 CAGTGAGTCTGAAGTGAAGCGGG + Intergenic
1133846367 16:9457683-9457705 AAGTTTGTCTGAGGAAATGCAGG + Intergenic
1134747830 16:16601557-16601579 AAGTGTGTGTGGAAAGAAGGAGG + Intergenic
1135874571 16:26186317-26186339 AAGTCTCTCTGAAGGGAAGAAGG - Intergenic
1136243803 16:28961539-28961561 AAGTGTCTCTGAAGATATGGGGG + Intronic
1138541935 16:57693544-57693566 AAGTGGGTATGAAGAGAAAAAGG + Intergenic
1141159920 16:81622410-81622432 GAGTGTGTCTGAAGACAGGCGGG + Intronic
1141298898 16:82794978-82795000 GAGAGATTCTGAAGAGAAGCAGG + Intronic
1142368440 16:89663685-89663707 GGGTGTGTCTGAAGGGCAGCAGG + Intronic
1142711440 17:1725934-1725956 CATTGTGTCTCAAGAGGAGCAGG + Exonic
1143370308 17:6435250-6435272 GAGTGGCTCTGATGAGAAGCCGG - Intergenic
1143488084 17:7266231-7266253 CAGTGAGTTTGGAGAGAAGCTGG - Intergenic
1144570732 17:16396910-16396932 AAGTCAGTCTGCAGAGGAGCAGG - Intergenic
1145125062 17:20293308-20293330 AAGTGTGTGTGAAGAGGTTCTGG - Intronic
1147053213 17:37813712-37813734 CAGTCTGGCTGCAGAGAAGCTGG - Intergenic
1147497089 17:40926966-40926988 AAGTGTGTCTGATGAGTTGGAGG - Intronic
1147665882 17:42147788-42147810 AAGTGTGTGTTAAAAGAAGTGGG + Intronic
1148989985 17:51657472-51657494 AGGTGGGTCTGGAGAAAAGCAGG + Intronic
1150125159 17:62630464-62630486 AAGGCTGTCTGGAGAGAGGCAGG + Intronic
1151530344 17:74700294-74700316 AAGTGAGGCTGGAGTGAAGCAGG - Intronic
1155208208 18:23578701-23578723 AAGTGCTGCTGGAGAGAAGCTGG - Intronic
1155311499 18:24528864-24528886 ATGTTTGTGTGAAGAGAGGCAGG + Intergenic
1158486276 18:57868866-57868888 AAGTGATTCTGATGAGAAACTGG + Intergenic
1158849641 18:61482525-61482547 TAGTGTTTCTGGAGAGAAGGTGG - Intronic
1158978872 18:62739080-62739102 AAGTATGTCTGAAGAGCTCCAGG + Intronic
1159598146 18:70403201-70403223 AAGAATTTCTGCAGAGAAGCTGG + Intergenic
1160075688 18:75674525-75674547 GAGTGTGCCTGAACAGAATCTGG - Intergenic
1161768153 19:6217933-6217955 AGGTGTGTATGGAGAGCAGCTGG - Exonic
1165530939 19:36400809-36400831 AATTATGTATGAAGGGAAGCTGG - Intronic
1166066366 19:40361566-40361588 CAGTGTGTCTGCAGTGAAGTGGG - Intronic
1166303472 19:41924828-41924850 CGGTGTTTCTGGAGAGAAGCAGG + Intronic
1166881534 19:45933481-45933503 AACTGTGATTGAAGAGAAGCAGG - Intergenic
1167029168 19:46945713-46945735 AAGTGAGGCTGAGGAGAGGCTGG - Intronic
925848745 2:8059352-8059374 GAGTGTTTCTGAAAAGAAGAGGG - Intergenic
925986814 2:9223066-9223088 AAGTGTGACTTGAGAGATGCAGG - Intronic
927416820 2:22888729-22888751 GAGTGTGTCTGTAGAGACGTGGG - Intergenic
930851511 2:55965936-55965958 AGGTGTGTGTGAAGGGAAGGAGG + Intergenic
933075107 2:77914635-77914657 GAGTGTGTCTTCAGAGATGCAGG + Intergenic
933100983 2:78257106-78257128 AAGAGGGAATGAAGAGAAGCTGG - Intergenic
934981768 2:98849088-98849110 CAGTGGGGCTCAAGAGAAGCTGG + Intronic
935185860 2:100732282-100732304 AAGTGATTCTGAAGAAAAGCAGG - Intergenic
935504799 2:103887246-103887268 AATTTTCTCTGAAGACAAGCCGG + Intergenic
936272979 2:111065883-111065905 AAGTGAGGATGAAGAGAAACTGG + Intronic
936342881 2:111653091-111653113 AAGTGTCTCTGAAGATGACCAGG + Intergenic
936942264 2:117897303-117897325 TATTGTTTCTGAAGAGAAGCTGG + Intergenic
937403460 2:121606050-121606072 ATGTGTGTCTGAAGAGCAGCTGG + Exonic
937644958 2:124256305-124256327 AAGTATGTGTGACAAGAAGCTGG + Intronic
940208112 2:151226414-151226436 AAGTGTGTTTAAAGAGAACCTGG + Intergenic
940939210 2:159538462-159538484 AAGTGTGTTTGCCAAGAAGCAGG - Intronic
942563125 2:177241439-177241461 AAGTATTTCTGAAGAAAACCAGG + Intronic
945265571 2:207888340-207888362 GTGTGTGTATGAAGAAAAGCAGG - Intronic
945363820 2:208926627-208926649 TGGTGAGTATGAAGAGAAGCTGG + Intergenic
945608026 2:211961226-211961248 AAATAAGTCTGAAGAAAAGCTGG - Intronic
946829097 2:223709452-223709474 CAGTGTTTCTGATGAGAAGTCGG - Intergenic
946889873 2:224264308-224264330 AAGTATTTCTGAAGAGAATTAGG + Intergenic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
1169509522 20:6248799-6248821 CATGGTTTCTGAAGAGAAGCTGG + Intergenic
1173466259 20:43284172-43284194 AAGTGTGACTGAACATAAGTTGG - Intergenic
1173914980 20:46700640-46700662 GAGTGTGTCTGAGGAAGAGCAGG - Intergenic
1174184661 20:48698101-48698123 ATGTGTCTCTTGAGAGAAGCTGG - Intronic
1174468706 20:50738992-50739014 ATGTGTGTCTGCAGATAGGCAGG + Intronic
1175138393 20:56842074-56842096 AGCTGTTTCTGCAGAGAAGCTGG + Intergenic
1175744934 20:61449546-61449568 AATAGTGTATGAAGAGAAGGAGG + Intronic
1177376521 21:20277271-20277293 AAGGGTTTCTGAAGAATAGCAGG - Intergenic
1178027143 21:28480847-28480869 AATTGTTTCTCAAGTGAAGCAGG - Intergenic
1179250349 21:39666722-39666744 TGGTGTGTTTGAAGAGGAGCAGG - Exonic
1179293591 21:40041461-40041483 ACTTGTGTTTTAAGAGAAGCCGG - Intronic
1181730554 22:24843313-24843335 ATGTGTTTCTGCAGAGAAGGTGG + Intronic
1183043866 22:35203949-35203971 AAGGTGCTCTGAAGAGAAGCCGG - Intergenic
1183219926 22:36506080-36506102 AGTAGTGTCTGAAGAGCAGCCGG + Exonic
1184010968 22:41748092-41748114 AAGTGTCTCTGCAAAGAACCAGG - Exonic
1184925470 22:47633369-47633391 GAGTGGGTCTGCAGAGAAACCGG + Intergenic
949473101 3:4417239-4417261 AAGTCTGTCAGAAGAGACACAGG + Exonic
950590790 3:13934736-13934758 AAGTGAGGAGGAAGAGAAGCTGG + Intergenic
950767083 3:15280848-15280870 GTGTGTGTCTTAAGAGATGCTGG - Intronic
951336623 3:21430678-21430700 CAGTGTGTGTCTAGAGAAGCGGG - Intronic
952252089 3:31665182-31665204 GAGTGTGTCTGAATACAGGCTGG - Intronic
952829687 3:37554344-37554366 TGGTGTGTCTGAGGAGGAGCAGG + Intronic
953035030 3:39203757-39203779 AGGGGTCTGTGAAGAGAAGCGGG + Intergenic
953140810 3:40227755-40227777 AAGTGTGCCTGCAGAGCAGGTGG + Intronic
953308037 3:41848528-41848550 AGGTGTTTCTGAAGAGAGCCTGG - Intronic
953788395 3:45928522-45928544 AAGTGGGTCTGGAGAGAGGGTGG + Intronic
953834320 3:46329925-46329947 AAGTGTAAGTGAAGAGAGGCTGG + Intergenic
956106427 3:65823541-65823563 ATGTGTGTGTCAGGAGAAGCAGG - Intronic
958106387 3:89079049-89079071 AAGTGTATCTGAGGATAAACAGG + Intergenic
959234418 3:103700580-103700602 AAGTGTCTTTAAAGAGAAACAGG - Intergenic
959430908 3:106253933-106253955 AAGTGTGTTTGGAGGGTAGCTGG - Intergenic
960291573 3:115891785-115891807 AAGTGTGATGGAAGAGAAGAGGG - Intronic
961557695 3:127707942-127707964 AATTCTGTCTGAAGGGAAGCGGG - Intronic
962492997 3:135911616-135911638 AAGTGGGTCTGTTGGGAAGCAGG + Intergenic
962615037 3:137117093-137117115 AAGTGCTTCACAAGAGAAGCAGG + Intergenic
963152856 3:142065008-142065030 AAATGTATCTGAAGATAAACAGG + Intronic
964248076 3:154677424-154677446 ATGTCTGTAGGAAGAGAAGCAGG + Intergenic
965849494 3:173006543-173006565 AAGTGGTTCTGAAGAGATGATGG - Intronic
966717771 3:183030696-183030718 AAGTGTGTATGTTGAGAAGCTGG - Intronic
966990944 3:185229465-185229487 CAGTGAGTCTGGGGAGAAGCTGG + Exonic
968476422 4:811664-811686 ATGTGTGCCTGAAAAGAAGAAGG + Intronic
968623967 4:1618293-1618315 AAGTGTGTCTGAGGGTAGGCGGG + Intronic
969145079 4:5115506-5115528 AAGTGTGTCTGGGGCAAAGCTGG + Intronic
969230734 4:5828464-5828486 GAGTGTGTCTGCAGGGGAGCGGG - Intronic
969285527 4:6200011-6200033 AAGGGGGTCTGAAGAGGAGTGGG + Intronic
971722204 4:30259765-30259787 TTGTGTGTCTGAAAAGATGCTGG - Intergenic
972204615 4:36757362-36757384 TGGTGTGTCTGGAGAGAAGGAGG - Intergenic
972985909 4:44765405-44765427 TCGTTTGTCTGAAGAGAAACTGG + Intergenic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
976621539 4:87133259-87133281 AAGTGTTTTTAAAGTGAAGCTGG + Intronic
976776389 4:88710973-88710995 CAGTGGGTCTCAAGTGAAGCTGG + Intergenic
977560175 4:98524633-98524655 AAGTGTGTGTCAAAGGAAGCAGG - Intronic
978264722 4:106810169-106810191 AAATGTGTCTGAAGATAACAGGG - Intergenic
978462468 4:108971567-108971589 CAGTGTGTCTGAAGAGGACATGG + Intronic
978883880 4:113743331-113743353 AAGTGAGACTGCAGAGAATCTGG - Intronic
980881610 4:138716197-138716219 AATTGAGTCTGAAAAGGAGCTGG + Intergenic
981194831 4:141906569-141906591 AGGTGAGTCTGAAGAAAAGGGGG + Intergenic
981904550 4:149906249-149906271 AAATGTGTCTGAAGGAAGGCTGG - Intergenic
982061669 4:151610562-151610584 AAGTGAGTCTACAGAGAAGGAGG - Intronic
983946041 4:173586348-173586370 AGGTGTGTCTGAGGAGGTGCTGG + Intergenic
984138308 4:175969805-175969827 AAGTGTGTGTGGAGGGATGCAGG + Intronic
984517776 4:180761798-180761820 CAGTTTGTCTGATGAGAAGCTGG - Intergenic
984636087 4:182111292-182111314 CAGAGTGTATGAAGAGAAGCTGG - Intergenic
985993466 5:3582999-3583021 AAAGGTGTCTGAAGAGGAGCAGG - Intergenic
986019019 5:3783692-3783714 CAGTGGGTCTGCTGAGAAGCAGG + Intergenic
986602116 5:9482768-9482790 AAGTGGAACTGAAAAGAAGCTGG + Intronic
986612462 5:9583035-9583057 AAGTGTCTCTGAATGGAAGAGGG - Intergenic
988501111 5:31784547-31784569 AAGTGGGTATGAATAGAAGGGGG + Intronic
990670469 5:58123699-58123721 AAGAGTGTCTGATGAGTGGCAGG + Intergenic
991624278 5:68583081-68583103 GAGGGTGTCTAAAGAGAAGGGGG + Intergenic
993133023 5:83923217-83923239 TAGAGTGTCTGGAGAGAAGGAGG - Intergenic
993462763 5:88204639-88204661 AAGTGTGTGTGCAGAGAGGAGGG + Intronic
994383031 5:99094327-99094349 AACTGTGTCAGAAGAGAAGAAGG + Intergenic
995750637 5:115450274-115450296 AATTGTTTTTCAAGAGAAGCTGG - Intergenic
996839764 5:127835697-127835719 AAGTGTGTGTGAAGTGAAGAGGG + Intergenic
997748469 5:136320712-136320734 AAGTGTGTTTGAAGAATAGCAGG - Intronic
998023599 5:138793756-138793778 GAGTGTTTCTGAATAGCAGCAGG + Intronic
999250896 5:150181708-150181730 AAGTGTTTCAGAAGAAAAGGAGG - Intronic
1000619316 5:163465153-163465175 AAGTGTTTTTGAAGAAAAGTGGG + Intronic
1000992180 5:167922659-167922681 GAGAGTGACTGAGGAGAAGCAGG - Intronic
1001202061 5:169727179-169727201 AAATGATACTGAAGAGAAGCAGG - Intronic
1001704856 5:173734376-173734398 AGGTGAATCAGAAGAGAAGCAGG + Intergenic
1001966846 5:175915818-175915840 TAGTGTGTCTGCACGGAAGCAGG + Intergenic
1002250101 5:177923388-177923410 GAGTGTGTCTGCACGGAAGCAGG - Intergenic
1004303535 6:14479619-14479641 AAATGTGACCGAACAGAAGCTGG - Intergenic
1005087421 6:22021435-22021457 AAGTGGGTCTGAATAGTAGTGGG - Intergenic
1005816772 6:29559490-29559512 GGGATTGTCTGAAGAGAAGCTGG - Intronic
1006583325 6:35089055-35089077 CAGTGGGTCGGAAGAGAAGGCGG + Exonic
1007262680 6:40574923-40574945 AAGTGTGTTTTGGGAGAAGCAGG - Intronic
1007319811 6:41019584-41019606 AAGTGGGTTAGAAGAGAAGGAGG + Intergenic
1007679381 6:43624022-43624044 CAGTGTGTCTGGAGAGAGTCTGG - Exonic
1007731223 6:43948419-43948441 AAGTGTATCTGAAAAGTGGCTGG - Intergenic
1010923508 6:81714341-81714363 AAGTGTGTAAGAGGTGAAGCTGG - Intronic
1011655977 6:89552404-89552426 AAGTGTCTCTGCAGATAAGGGGG - Intronic
1012880456 6:104781781-104781803 AAGTGTGTCTGTGTAGAAGAGGG - Intronic
1012964061 6:105654198-105654220 AACTGTGTCAGAAAAGCAGCTGG + Intergenic
1013629296 6:111970087-111970109 TAGTGTGTTTGAAGAGAAGGAGG + Intergenic
1014987551 6:128030187-128030209 AAGTGATTCTGAAGAGAAGTGGG + Intronic
1015162293 6:130166929-130166951 AAGTCTTTCTGAAGAGCAACTGG + Intronic
1016349880 6:143155593-143155615 AAGTATGTCTGACAAGAAACTGG + Intronic
1016391621 6:143580767-143580789 AAATGTCTCTGAAGACAAGAAGG + Intronic
1016556974 6:145349783-145349805 ATGCCTGTCTGAAGAGAAGCAGG + Intergenic
1017721269 6:157244927-157244949 AAGGGTGTTTGCAGAGAAGCAGG + Intergenic
1019067557 6:169315036-169315058 AAGTGTGTGTGGACAGAGGCAGG - Intergenic
1020972363 7:14961305-14961327 GGGTGTGTCTGAAGAGAAAATGG - Intronic
1022537931 7:31109528-31109550 AAGTGGGGCTGGGGAGAAGCAGG + Exonic
1025478133 7:60953264-60953286 AAGGTTGGCTGATGAGAAGCTGG + Intergenic
1026937717 7:74268483-74268505 GAGCGTGTCTGCACAGAAGCAGG - Intergenic
1029359191 7:100075882-100075904 AAGAGTGACTGGAGAGAAGAGGG - Intronic
1030685632 7:112484523-112484545 AAGAGTGTTTGCAGATAAGCAGG + Intronic
1032107765 7:129049038-129049060 ACTTTTGGCTGAAGAGAAGCAGG + Intronic
1032422483 7:131793778-131793800 AGGGGTCTCTAAAGAGAAGCAGG - Intergenic
1032598450 7:133267050-133267072 AAGTGGGACTAAAGAGATGCAGG - Intronic
1032663091 7:134007321-134007343 AATTGTGTATAAAGAAAAGCGGG + Intronic
1033609849 7:142954536-142954558 AAGAGAGACTGGAGAGAAGCAGG + Intronic
1034102023 7:148458218-148458240 AGGTGTGTCTGGAAAGTAGCTGG - Intergenic
1034499228 7:151439509-151439531 AAGTGTCCCTGAAGAGACCCTGG + Intronic
1035355062 7:158271549-158271571 AGCAGTGTCTGCAGAGAAGCTGG - Intronic
1035721693 8:1797617-1797639 AAGTGGGTTTGAAGAGAAAGAGG - Intergenic
1036409845 8:8489260-8489282 AAGTGTGTTGGAAAAGGAGCTGG - Intergenic
1037404459 8:18526582-18526604 AAATGTGTCTGAAGACCACCAGG - Intergenic
1037538670 8:19851466-19851488 AAGTCTTTCTGAAGAGAAATGGG + Intronic
1037916620 8:22777062-22777084 AGGTGAGTGTGCAGAGAAGCAGG + Intronic
1038650420 8:29397985-29398007 AGGTTTGTATGCAGAGAAGCAGG - Intergenic
1038704077 8:29877830-29877852 AACTGTCTCTGAAGTGAAACTGG + Intergenic
1040658946 8:49546263-49546285 AATTCTGTCTGAAGAGAAGTTGG - Intronic
1047099876 8:121665232-121665254 AAGTGGCTTTGAAGACAAGCAGG + Intergenic
1047511138 8:125516633-125516655 AAGTTTGATTGAAGAGAAGAGGG + Intergenic
1048483975 8:134831185-134831207 ATGTGTGTCTGAAGAGTTTCAGG - Intergenic
1048999976 8:139818868-139818890 AATTGTGTCTGAAGAGGACAAGG - Intronic
1049022747 8:139968949-139968971 GAGTTTGTCTGAAGTGCAGCTGG - Intronic
1049509574 8:143020734-143020756 GAGTGGGTCAGGAGAGAAGCAGG + Intronic
1049800452 8:144515234-144515256 ATCTGTGTCTGCAGAGACGCCGG - Exonic
1050000458 9:1071999-1072021 AGGTGTGGCTGTAGAGATGCAGG + Intergenic
1050197816 9:3106926-3106948 CAGTCTGTCTGGAGTGAAGCAGG - Intergenic
1051139936 9:13967542-13967564 CACTGTGACTGAAGACAAGCAGG + Intergenic
1052131287 9:24850705-24850727 AAGTGTCAGTGAAGAGCAGCTGG - Intergenic
1052544781 9:29862916-29862938 TAGTTGGTCTAAAGAGAAGCAGG + Intergenic
1056310758 9:85338682-85338704 TTGTGTGTCTCAAGAGAACCGGG + Intergenic
1056418948 9:86404808-86404830 AAGTGTTTGTGAAGGGAAGATGG - Intergenic
1056460403 9:86804464-86804486 AAATGTGACTGAAGGGAAGTTGG - Intergenic
1058340964 9:103895942-103895964 AACTGTGCCTGGACAGAAGCAGG + Intergenic
1060422487 9:123479369-123479391 AAGACAGTCTGATGAGAAGCAGG - Intronic
1061567202 9:131448979-131449001 AAGTGAATCAGAAGAGCAGCAGG - Intronic
1062313374 9:135952169-135952191 AGGTGTGGCTGAAGATAAGGAGG + Intronic
1062710019 9:137970370-137970392 AGGTGTGTCTGTACAGGAGCTGG - Intronic
1186350942 X:8738969-8738991 CAGTGTGACTGTAGAGATGCAGG - Intergenic
1187454550 X:19429706-19429728 AAGTGTGGATGGAGAGAAGGTGG + Intronic
1189862047 X:45282726-45282748 AAGTGGGTTAGAAGAGAAACAGG - Intergenic
1191786650 X:64923522-64923544 AAGAGAGACTGAAGACAAGCAGG - Intronic
1192996902 X:76521331-76521353 AAGAGTGTCTGAGATGAAGCGGG - Intergenic
1193674226 X:84428679-84428701 AACAGTGTCTTCAGAGAAGCAGG + Intronic
1198283906 X:135171280-135171302 CACAGTGTCTGAGGAGAAGCAGG - Exonic
1198737758 X:139806470-139806492 AAGTGTTTCTGAGGAGAGACAGG + Intronic
1199526783 X:148801665-148801687 AAGTGTGGCAAAAGAGAAACTGG - Intronic
1201414894 Y:13738610-13738632 CAGTGTGACTGTAGAGATGCAGG + Intergenic
1201438622 Y:13985557-13985579 AAGTGTGTCAGGAGGGAGGCAGG - Intergenic
1201445951 Y:14057151-14057173 AAGTGTGTCAGGAGGGAGGCAGG + Intergenic
1201473368 Y:14356973-14356995 AAGTGAAAGTGAAGAGAAGCTGG + Intergenic
1201666651 Y:16464917-16464939 AAATGAGTTTTAAGAGAAGCTGG + Intergenic
1202162292 Y:21948037-21948059 AAGTGTGGCCAAAGAGAAGCAGG + Intergenic
1202229064 Y:22638336-22638358 AAGTGTGGCCAAAGAGAAGCAGG - Intergenic
1202314090 Y:23557829-23557851 AAGTGTGGCCAAAGAGAAGCAGG + Intergenic
1202556712 Y:26112766-26112788 AAGTGTGGCCAAAGAGAAGCAGG - Intergenic