ID: 1105410644

View in Genome Browser
Species Human (GRCh38)
Location 13:20168534-20168556
Sequence GATTAGGAATCCAGCAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105410641_1105410644 12 Left 1105410641 13:20168499-20168521 CCCTCTTTGATGTTATATAAAAG 0: 1
1: 0
2: 1
3: 26
4: 345
Right 1105410644 13:20168534-20168556 GATTAGGAATCCAGCAGCCCAGG 0: 1
1: 0
2: 1
3: 19
4: 142
1105410642_1105410644 11 Left 1105410642 13:20168500-20168522 CCTCTTTGATGTTATATAAAAGC 0: 1
1: 0
2: 0
3: 14
4: 195
Right 1105410644 13:20168534-20168556 GATTAGGAATCCAGCAGCCCAGG 0: 1
1: 0
2: 1
3: 19
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105410644 Original CRISPR GATTAGGAATCCAGCAGCCC AGG Intergenic
900238670 1:1604523-1604545 GAGCAGGGATGCAGCAGCCCCGG + Intergenic
902363555 1:15956002-15956024 GTCCAGGATTCCAGCAGCCCAGG + Intronic
903182559 1:21612345-21612367 GCTTTGGAATCCAACAGACCTGG - Intronic
905174851 1:36128744-36128766 GCTGAGGAGTCCAGCAGACCTGG + Intergenic
905244164 1:36601172-36601194 GAAGAGGAATCCAGCAGGGCAGG - Intergenic
908085084 1:60623253-60623275 GATTAGGAACAAAGCATCCCAGG + Intergenic
910117446 1:83748007-83748029 AAACAGGAATCTAGCAGCCCTGG + Intergenic
910257583 1:85263315-85263337 GCTTAAGAATCAAACAGCCCTGG + Intergenic
911280741 1:95924846-95924868 AATTTGGAATTCAGTAGCCCAGG - Intergenic
912363955 1:109117485-109117507 GGTTAGGAATCTAGCAGACATGG + Intronic
912746420 1:112249116-112249138 GATCAGGAATGCAAGAGCCCTGG - Intergenic
914889146 1:151607395-151607417 GATTTGGGAGCCATCAGCCCTGG - Intergenic
915638689 1:157204447-157204469 GATGAGCAATCCAGCCTCCCAGG + Intergenic
917487071 1:175465110-175465132 GAGCAGGAGTCCACCAGCCCTGG + Intronic
917535329 1:175870481-175870503 GAGTAGGCCTCCAGCAGCCCTGG + Intergenic
922823855 1:228503541-228503563 GATGAGGGAACCTGCAGCCCTGG + Intergenic
923138364 1:231139114-231139136 GATAAGGAATGTAGCACCCCTGG + Intergenic
923933941 1:238739028-238739050 AATTTGAAATCCAGCAGGCCAGG + Intergenic
1063378632 10:5570310-5570332 GACTTGGCATCCACCAGCCCAGG + Intergenic
1063653965 10:7968450-7968472 GCTTTGGAATCCAGCAGACCTGG + Intronic
1064232189 10:13538756-13538778 AAATAGGCAACCAGCAGCCCTGG + Intergenic
1072899152 10:99392130-99392152 GATAAGGGTTCCAGCAGCCTGGG + Exonic
1076164246 10:128268962-128268984 GATTAGGAACCCAGGAACCCAGG + Intergenic
1078350808 11:10591666-10591688 CATCAGAAATCCAGCAGCTCTGG - Intronic
1080950238 11:37023952-37023974 GATTAGGAATCCACCCTGCCTGG - Intergenic
1081188159 11:40070642-40070664 GATTAGGAGTCAAGGAGACCTGG - Intergenic
1082990855 11:59206172-59206194 GATGAGGGACCCAGCAGCTCTGG - Exonic
1084752158 11:71211045-71211067 AATTAGGGCTGCAGCAGCCCTGG - Intronic
1090621306 11:128563412-128563434 GACTAGAAATCAAGCAGCCTGGG + Intronic
1091123442 11:133075813-133075835 ACTTAGGAATCCAAGAGCCCAGG - Intronic
1091628369 12:2139875-2139897 GCTTAGGGATCCAGAAGCCAGGG - Intronic
1093113515 12:15181481-15181503 GATTTGAAACCTAGCAGCCCAGG - Intronic
1095933477 12:47652562-47652584 GATCAAGAAGCCAGCAGACCTGG + Intergenic
1096676903 12:53231042-53231064 GATTGGGATTCCAGCTGCCCAGG + Intronic
1098046412 12:66405506-66405528 TATTAGGAATCCAGAATCTCAGG + Intronic
1102909930 12:116705566-116705588 GCTATGGAACCCAGCAGCCCTGG - Intergenic
1105410644 13:20168534-20168556 GATTAGGAATCCAGCAGCCCAGG + Intergenic
1106365608 13:29076671-29076693 GATGAGCAATCCAAGAGCCCAGG + Intronic
1106838418 13:33660882-33660904 CATTAGGAATCTAACAGCACAGG - Intergenic
1107779095 13:43879477-43879499 GAGTCGGCATCCCGCAGCCCCGG - Exonic
1108029354 13:46212404-46212426 GAGTTGGGATCCAGCAGCCCTGG + Intronic
1110038138 13:70715264-70715286 CATTATGTACCCAGCAGCCCTGG + Intergenic
1112576357 13:100640060-100640082 GGTTAGGAATTCAGGATCCCAGG - Intronic
1114605626 14:23993830-23993852 CATTAGTAAACCAGCTGCCCAGG - Intronic
1114611131 14:24041475-24041497 CATTAGGAAACCGGCTGCCCAGG - Intergenic
1119652259 14:76392242-76392264 TATGAGTAAGCCAGCAGCCCTGG + Intronic
1120228081 14:81812852-81812874 GAATATGAATCTAGCAGCCATGG - Intergenic
1121717836 14:96088855-96088877 GAAGAGGACTCCAGCATCCCAGG + Exonic
1122264890 14:100541920-100541942 GACTCCGACTCCAGCAGCCCCGG - Intronic
1125568509 15:40695727-40695749 GATCAGGAATCCGGAAGCCCTGG - Intronic
1129162634 15:73755105-73755127 GGGTGGGAATCCAGCTGCCCTGG + Intergenic
1129389392 15:75213092-75213114 GGCTAGAAATCCAGCAACCCAGG + Intergenic
1133284955 16:4686427-4686449 GATTCGGAATCCAGGGCCCCTGG - Intronic
1136624189 16:31451798-31451820 GATTAGGAAGGCATCAGCCACGG - Intergenic
1138138604 16:54546636-54546658 GATTAAGTCTCCAGCAGACCGGG - Intergenic
1142741685 17:1935235-1935257 GATCTGGAAACCAGCAGGCCAGG - Exonic
1142900649 17:3009499-3009521 GATTTGGAATCCGGCGGACCTGG - Intronic
1145167236 17:20623840-20623862 GCTTAGAAATCCAGAAGACCTGG + Intergenic
1145964802 17:28909141-28909163 GATTAGCCAGCCAGGAGCCCAGG - Intronic
1146894517 17:36531976-36531998 GATTTGGAATCCTACAGGCCTGG + Intronic
1149446290 17:56715776-56715798 GATTTGGAATCAAGCAGACCTGG + Intergenic
1150314172 17:64154911-64154933 GATGAGGAATCCTCCAGCGCTGG - Exonic
1151896201 17:76982532-76982554 GAAAAAGAAACCAGCAGCCCCGG + Intergenic
1153884352 18:9450049-9450071 GATTAGGAATCCTAAAGCTCAGG + Intergenic
1155422402 18:25669294-25669316 GAGTAGGAATCCCCAAGCCCAGG + Intergenic
1157146633 18:45169845-45169867 CATTAGGAAAACAGCACCCCAGG + Intergenic
1157916556 18:51669254-51669276 GATTAGGAATCAGGCAGGGCAGG + Intergenic
1160576079 18:79854426-79854448 GATGAGGAATCGTGCACCCCTGG - Intergenic
1166865597 19:45834887-45834909 GCTTTGGAATCCAACAGACCTGG - Intronic
1166879672 19:45920192-45920214 GACTAGAAATTCATCAGCCCCGG + Intergenic
1167009858 19:46800315-46800337 GATTAGGAGTCCAGGGGCCTGGG - Intergenic
1168204536 19:54839893-54839915 GATTAGGGCTCCAGAAACCCAGG + Intronic
926693539 2:15754363-15754385 GATGAGGCATCCAGCATCCTAGG - Intergenic
926744412 2:16139096-16139118 GAGTAGGAAGCCAGGAGCCTTGG - Intergenic
933010430 2:77055205-77055227 CATCAGGTATCCAGCAGCCCAGG - Intronic
935805443 2:106742335-106742357 GATTAGGATTCCTGAAGGCCTGG + Intergenic
938100430 2:128494368-128494390 GATTTGGAATCAAACAGCCGGGG - Intergenic
944429024 2:199613544-199613566 AATTAGAACTCCACCAGCCCAGG + Intergenic
944641294 2:201728493-201728515 GGTTAGGAATCCAGCCTACCTGG + Exonic
1175727038 20:61325612-61325634 GATTATGAAGCCAGGAGCACTGG + Intronic
1179334351 21:40436435-40436457 GAACAGGAATTCAGCAGCTCTGG + Intronic
1179525404 21:41972920-41972942 GAGTAGGAATGCAGTAGGCCGGG - Intergenic
1181675590 22:24449521-24449543 GAGAAGGCATCCTGCAGCCCAGG + Intergenic
1183162454 22:36123949-36123971 GTTCAGGAATCCAGCAGCGCCGG - Intergenic
1185277138 22:49954676-49954698 GAGTGGGGATCCAGGAGCCCCGG + Intergenic
949975294 3:9451764-9451786 GTTTTGGAGTCCAGAAGCCCTGG - Intronic
950113105 3:10433067-10433089 GTTCAGGAATCCAAAAGCCCAGG + Intronic
950354048 3:12388548-12388570 AATTAGGAATTCAGTAGCCAGGG - Intronic
952739893 3:36724902-36724924 GATTAAGAATCAAACAGGCCAGG + Intronic
956698868 3:71941389-71941411 GACTAGGAAGCCAGAAGCTCTGG - Intergenic
956708832 3:72022852-72022874 AAATGGGAAACCAGCAGCCCTGG - Intergenic
958544298 3:95522053-95522075 GATTGGGAATGTAGCAGCCAGGG - Intergenic
959405037 3:105951256-105951278 GATTGGGAATGCTGCAGCCAGGG - Intergenic
961155087 3:124672742-124672764 GATTAGGAATCAGGCAAACCTGG + Intronic
965768084 3:172152761-172152783 GCTTAGGAATCCAGGTGCCTAGG + Intronic
966197712 3:177330018-177330040 GATTTGGAATCCTTCAGCCCTGG + Intergenic
967270047 3:187725689-187725711 GCTTAGAAATCCAGGAGCCACGG - Intronic
970086701 4:12355830-12355852 GATTATGGAGCCAGCAGCCACGG - Intergenic
971130159 4:23799496-23799518 GCTTTGGAATCCCGCAGACCTGG - Intronic
971282770 4:25255169-25255191 GATTAGGAATCAGGCAGCCTCGG - Exonic
971644338 4:29178573-29178595 GATAAGGCATCCAGGGGCCCAGG + Intergenic
972852150 4:43063518-43063540 GATTTAGAATCCAGCACCTCTGG - Intergenic
974847953 4:67373971-67373993 GACAAGCAATCCAGAAGCCCTGG - Intergenic
975249310 4:72159829-72159851 GATTAGGGATCCCCCACCCCTGG + Intergenic
976800018 4:88979451-88979473 GATTCTGAATCCAGAAGGCCTGG - Intronic
977059973 4:92245607-92245629 GTTTAGGATCCCAGCATCCCTGG - Intergenic
979218335 4:118193018-118193040 GATGAGGAAAACAGCTGCCCAGG + Intronic
979765497 4:124460822-124460844 GCTTAGGAATCAAACAGACCAGG - Intergenic
982458307 4:155636591-155636613 TATTAGGAATACAGCAGTACTGG - Intergenic
988100710 5:26673681-26673703 TATTCGGAATCCAGTGGCCCTGG + Intergenic
988410765 5:30882981-30883003 GATAAGGATTCCAGATGCCCTGG + Intergenic
990446865 5:55901379-55901401 GCTTTGGAGTCCAGCAGCCCCGG + Intronic
992883870 5:81138296-81138318 AATTGGGAATGCAGCAGCCAGGG - Intronic
993327876 5:86565127-86565149 CATTAGGAACCCAGGTGCCCAGG + Intergenic
996401067 5:123063256-123063278 GACTAGGAATCTAGAAGACCAGG - Intergenic
997508317 5:134435676-134435698 GCTCTGTAATCCAGCAGCCCTGG + Intergenic
1001251789 5:170152491-170152513 GATTTGGAATCCTGCAGACCTGG + Intergenic
1001271094 5:170312200-170312222 TATCTGGAATCCAGGAGCCCAGG - Intergenic
1001564153 5:172688777-172688799 GTTTGAGAATCCAGCAGCCCTGG + Exonic
1002900793 6:1408135-1408157 GATTGGGATTCCAACAGCTCTGG - Intergenic
1012816812 6:104032993-104033015 GAATTGCAATCCAGCAGCCCAGG + Intergenic
1014435152 6:121412517-121412539 GCTTAGGAATCAAACAGGCCAGG + Intergenic
1015132090 6:129823757-129823779 GATTAGAAATCCATCTGCTCAGG - Intergenic
1015159556 6:130137246-130137268 GATTTGGAATTCAGGAGCTCTGG - Intronic
1015912420 6:138182187-138182209 TTTTTGGAGTCCAGCAGCCCTGG - Intronic
1017732552 6:157330312-157330334 GTGCTGGAATCCAGCAGCCCTGG + Intergenic
1017763968 6:157592457-157592479 GATTTGGAGTCCAGCATTCCAGG + Intronic
1021759343 7:23888121-23888143 GTTTAGGAATCCACCAGAACTGG + Intergenic
1021958699 7:25852249-25852271 AATAAGGAAACCAGCAGCCTGGG + Intergenic
1022035594 7:26531238-26531260 GCTTGGGAGTCCAGCAGCCATGG - Intergenic
1026454602 7:70559749-70559771 GGTTAGGAATCCAGAGGCCTGGG - Intronic
1027714572 7:81653735-81653757 GATTAGGCATCCAGCAGCCTTGG + Intergenic
1034245064 7:149637740-149637762 GGATGGGAATCCAGCAGACCAGG - Intergenic
1034275474 7:149822020-149822042 GAGCAGGCCTCCAGCAGCCCTGG - Intergenic
1036446983 8:8830010-8830032 TATTAGGAATGCAGAATCCCAGG - Intronic
1038704683 8:29882604-29882626 GCCTGGGAATCCAGCAGCCCTGG + Intergenic
1038713351 8:29969907-29969929 GATTAGGAATCATTCTGCCCAGG + Intergenic
1041362511 8:57067678-57067700 GGTGAGGAATCCAGCAGATCTGG + Intergenic
1041848398 8:62358331-62358353 GATTAGGAATGCTGAAGCACTGG + Intronic
1042762869 8:72289890-72289912 GATTTGGAAGTCAGCAGCTCAGG - Intergenic
1044748156 8:95391078-95391100 GATTATGAATCCAGCCTGCCTGG - Intergenic
1045656878 8:104396184-104396206 GTGTAGGAATGCAGCAGCCCAGG - Intronic
1048207362 8:132426110-132426132 GCTTTGGAGTCCAACAGCCCTGG + Intronic
1050009703 9:1173052-1173074 TCTTTGGAATCCAGCTGCCCTGG + Intergenic
1055483047 9:76728715-76728737 GCTTTGGAATACAGCAGCCCAGG + Intronic
1056069029 9:82966890-82966912 GCTTAGGAATCTAACAGACCTGG - Intergenic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1057819184 9:98318225-98318247 GCTTAGAAATGCAGCATCCCAGG - Intronic
1058602277 9:106683061-106683083 AAATAGGCAACCAGCAGCCCAGG + Intergenic
1058894556 9:109388166-109388188 GATTAGGAGTCCATCACTCCAGG - Intronic
1059354534 9:113688359-113688381 GCTTTGGAATCCAGCTGCCGGGG + Intergenic
1059377697 9:113898753-113898775 GATCAGCGATGCAGCAGCCCGGG + Intronic
1060010839 9:120041637-120041659 GATTATGGATCCAGCAGGGCTGG + Intergenic
1060302994 9:122386768-122386790 GCTGAGGGATCCAGCAGACCTGG + Intronic
1060415090 9:123424464-123424486 GATTAGGCTCCCACCAGCCCTGG + Intronic
1060667770 9:125443249-125443271 GATTTGTACTCTAGCAGCCCTGG + Intronic
1186154937 X:6715749-6715771 GATTAGGTACGTAGCAGCCCTGG + Intergenic
1186448375 X:9651888-9651910 GATAATGAATGCAGCTGCCCTGG - Intronic
1186570943 X:10714279-10714301 CATTAGCATGCCAGCAGCCCAGG + Intronic
1190416310 X:50183729-50183751 GCTTAGGAATCCAGGAGACATGG - Intergenic
1198989468 X:142494877-142494899 GATTAGAAATGCAGCAGCCAGGG - Intergenic
1199989348 X:152976707-152976729 GATTGGGAAACCCCCAGCCCTGG - Intergenic
1201548767 Y:15196775-15196797 GATTAGGTATGTAGCAGCACTGG + Intergenic