ID: 1105410726

View in Genome Browser
Species Human (GRCh38)
Location 13:20169148-20169170
Sequence GGCTTTGTATGTCCACCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 81}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105410726 Original CRISPR GGCTTTGTATGTCCACCAAA AGG Intergenic
909065997 1:70936607-70936629 GGCTTTGTATGTTCTTCAATTGG + Intronic
916531962 1:165665020-165665042 GACTTCTTATATCCACCAAAGGG + Exonic
922418157 1:225440842-225440864 GGATTTTTATGTCTATCAAATGG + Intergenic
924149098 1:241109599-241109621 GTGTTTGTATGTTCACCAACAGG + Intronic
924932625 1:248744282-248744304 GGCTTGAGATGTCCACCCAAGGG + Intronic
1070502038 10:77081281-77081303 GGCTTGGTATGAGCAGCAAATGG + Intronic
1071022559 10:81075399-81075421 GGCTTTGTATTTCCAGGAATTGG + Intergenic
1074478360 10:113794116-113794138 GGATTTGTTTTTCCATCAAAGGG - Intergenic
1075586844 10:123664854-123664876 GGCTTTCTATGTCCAGGACAGGG + Intergenic
1083405399 11:62453626-62453648 GGCTGTCTCAGTCCACCAAAAGG + Intronic
1084074367 11:66761703-66761725 GGCCTTATATGACCACCTAATGG - Intronic
1087321436 11:96664559-96664581 AGCTTTGTAATTTCACCAAAAGG - Intergenic
1089743684 11:120602310-120602332 GGCTCTGTTTGTCCACTAAATGG - Intronic
1105410726 13:20169148-20169170 GGCTTTGTATGTCCACCAAAAGG + Intergenic
1107423818 13:40273952-40273974 GGCAGTGTGTGTGCACCAAAAGG + Intergenic
1113310845 13:109130992-109131014 TGCTTTGTGTGTCTACCAAGCGG + Intronic
1116270410 14:42757699-42757721 GTCTTTGGATGTCCTCCAAGAGG - Intergenic
1119928537 14:78521012-78521034 AGCTTTGTTTATCCTCCAAATGG - Intronic
1125734531 15:41914744-41914766 GGCATTTTTTGTGCACCAAATGG - Intronic
1131313912 15:91315799-91315821 GGCTTTGTTTGTCCTCCCACGGG - Intergenic
1138035437 16:53600743-53600765 GGCTTTGAATGTTCACAAATAGG + Intronic
1143239633 17:5433143-5433165 GGCCTTATATGACCACCTAATGG - Exonic
1146833652 17:36092043-36092065 GGCCTTGTATTCCCCCCAAAGGG + Intergenic
1147233820 17:39041448-39041470 GGCTTTGAATGTCAAGCTAAGGG + Intergenic
1147246213 17:39122733-39122755 CGCTTGGCAAGTCCACCAAATGG + Intronic
1151344492 17:73493269-73493291 GGCTATTTATTTCCACCACAAGG - Intronic
1152223111 17:79080080-79080102 GGATTTGAATGTCTACCAAGTGG + Intronic
1161477995 19:4496832-4496854 GGCTCTGTCTGCCCACCACAGGG - Intronic
1166530801 19:43542350-43542372 GGCTTGGAATGTCCAATAAAAGG + Intergenic
925006581 2:447721-447743 GGCTTTGTGTCTCCTGCAAATGG - Intergenic
925426273 2:3751299-3751321 GGCTGTCCAAGTCCACCAAAGGG + Intronic
927672021 2:25076561-25076583 GGCTTTCTATTTCCCCAAAATGG + Intronic
936768528 2:115883936-115883958 GGCTTTCTATGACAAACAAAAGG - Intergenic
939090513 2:137775256-137775278 GGTTTTGTATGTACATAAAATGG + Intergenic
939343264 2:140928421-140928443 GTCTTTGAATGACCACCACAGGG - Intronic
942615112 2:177783725-177783747 GGCTTTGTATTTCAGACAAAAGG + Intronic
947764203 2:232625570-232625592 GACCTTGAATGTCCACCAACAGG + Intronic
948067414 2:235091527-235091549 GGTTTGGTTTCTCCACCAAAGGG + Intergenic
1170548978 20:17459393-17459415 GTATCTGTATGTTCACCAAAAGG - Intronic
1177218139 21:18155622-18155644 GGCCTTGTATTTCTACCACAAGG - Intronic
1177693959 21:24547573-24547595 AGCTTTGTATGTCTACCATTTGG - Intergenic
1179135747 21:38678739-38678761 GGCTTGGAATGTCAACCCAAGGG - Intergenic
1183248551 22:36712074-36712096 GGCGTTGTCTGTCCACTACAGGG - Intergenic
1185399711 22:50609538-50609560 GGCTTTGCGATTCCACCAAATGG - Intronic
951323808 3:21278652-21278674 GGCTTTGGATGAACACCCAAAGG - Intergenic
960039446 3:113134715-113134737 GCCTTTGTGAATCCACCAAATGG + Intergenic
961389515 3:126543933-126543955 GGCTTTGTATGTCCCTCCAGTGG - Intronic
962049770 3:131800695-131800717 GGCTTTGAATGTCATCCTAAGGG + Intronic
966210797 3:177451289-177451311 GGCTTTGTATGTATAAGAAAAGG + Intergenic
973745231 4:53957574-53957596 TACTTTGTATGTCCTCTAAAAGG - Intronic
978542541 4:109834245-109834267 GGCTTTCTACGTTCACAAAATGG - Intronic
984840836 4:184065774-184065796 GGTTTTGTCACTCCACCAAAAGG - Intergenic
988902997 5:35754082-35754104 GGCTTTCTTTGTCCACTTAAGGG - Intronic
990987869 5:61657603-61657625 GGCATTGTTTGTGTACCAAATGG + Intronic
991064662 5:62412647-62412669 GGCTTTGTCTTTGAACCAAAAGG - Intronic
991429059 5:66524778-66524800 AGCATTCTATGTCCACCAGATGG + Intergenic
992004432 5:72463494-72463516 GCTCTTGTATGTCCAGCAAATGG + Intronic
994724401 5:103417127-103417149 GGCTTTAAATGTCCCCCTAAAGG - Intergenic
1000516575 5:162242573-162242595 GGCTTTGTTTGTCTACTTAAGGG - Intergenic
1004034448 6:11909480-11909502 GGCTTTAAAAGTCCACCATATGG + Intergenic
1006396574 6:33791185-33791207 GCCTTTGGATGTGCACCAAGGGG + Intergenic
1008738817 6:54579983-54580005 GCTTTTGTATGTCATCCAAATGG + Intergenic
1018694371 6:166380295-166380317 GACTTTATTTGTCCATCAAATGG - Intronic
1021631141 7:22648771-22648793 GGGGTTGTATGTCCACCACTTGG + Intergenic
1021725465 7:23544041-23544063 GGCTATGTATACCCAGCAAAGGG - Intergenic
1027364004 7:77438310-77438332 GGTTGTGTATCTCCACCAGAAGG - Intergenic
1042643067 8:70956353-70956375 GGGTTTTTATGTCCTCAAAATGG + Intergenic
1046616380 8:116482073-116482095 GTCTTTGTTTCTCTACCAAAAGG - Intergenic
1048148899 8:131873870-131873892 GGCTATGTGAGTCCACCAATAGG + Intergenic
1050839659 9:10132585-10132607 GACTTAGCATGTCCACCATAAGG + Intronic
1052739913 9:32383443-32383465 TTCTTTGAATGTCCACCATATGG - Intergenic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1055437141 9:76303157-76303179 GTCTTCATATGTCCACCAGAGGG - Intronic
1058038149 9:100275412-100275434 GACTTTGTATGTCCCCTAAAGGG + Intronic
1186183877 X:6999989-7000011 GACATTGTGTATCCACCAAAGGG + Intergenic
1186643104 X:11478208-11478230 GAGTATGTATGTCCACAAAAAGG + Intronic
1186668213 X:11741020-11741042 GGCGTTGTCTCACCACCAAATGG - Intergenic
1187496030 X:19796603-19796625 GGCTTTGTATTCCAACCAGAGGG + Intronic
1196185702 X:112742843-112742865 GCCTTGGTATGGACACCAAAGGG + Intergenic
1198773729 X:140157378-140157400 GGGTGTTCATGTCCACCAAATGG - Intergenic
1198774456 X:140164818-140164840 GTCTTTGTTTGTGCACAAAAGGG + Intergenic
1199242704 X:145566605-145566627 GGCTTTGTATGTGCAGATAAAGG - Intergenic
1199495765 X:148450603-148450625 AGTTTTCTATGTCCACAAAATGG - Intergenic
1199579951 X:149351125-149351147 GGCTCTGTATATTCACCCAAGGG - Intergenic