ID: 1105412631

View in Genome Browser
Species Human (GRCh38)
Location 13:20184188-20184210
Sequence GAGCCATGGAACCACTGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 107}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105412631_1105412642 10 Left 1105412631 13:20184188-20184210 CCAGAACAGTGGTTCCATGGCTC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1105412642 13:20184221-20184243 GGGGCTGCACTGAGGACAGGGGG 0: 1
1: 0
2: 3
3: 58
4: 485
1105412631_1105412634 -10 Left 1105412631 13:20184188-20184210 CCAGAACAGTGGTTCCATGGCTC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1105412634 13:20184201-20184223 TCCATGGCTCAGCCATGTCGGGG 0: 1
1: 0
2: 0
3: 5
4: 115
1105412631_1105412639 7 Left 1105412631 13:20184188-20184210 CCAGAACAGTGGTTCCATGGCTC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1105412639 13:20184218-20184240 TCGGGGGCTGCACTGAGGACAGG 0: 1
1: 0
2: 1
3: 12
4: 169
1105412631_1105412638 2 Left 1105412631 13:20184188-20184210 CCAGAACAGTGGTTCCATGGCTC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1105412638 13:20184213-20184235 CCATGTCGGGGGCTGCACTGAGG 0: 1
1: 0
2: 2
3: 20
4: 152
1105412631_1105412644 29 Left 1105412631 13:20184188-20184210 CCAGAACAGTGGTTCCATGGCTC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1105412644 13:20184240-20184262 GGGGCCATCTGCCTTCTAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 141
1105412631_1105412641 9 Left 1105412631 13:20184188-20184210 CCAGAACAGTGGTTCCATGGCTC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1105412641 13:20184220-20184242 GGGGGCTGCACTGAGGACAGGGG 0: 1
1: 0
2: 7
3: 49
4: 519
1105412631_1105412636 -9 Left 1105412631 13:20184188-20184210 CCAGAACAGTGGTTCCATGGCTC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1105412636 13:20184202-20184224 CCATGGCTCAGCCATGTCGGGGG 0: 1
1: 0
2: 0
3: 10
4: 100
1105412631_1105412643 26 Left 1105412631 13:20184188-20184210 CCAGAACAGTGGTTCCATGGCTC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1105412643 13:20184237-20184259 CAGGGGGCCATCTGCCTTCTAGG 0: 1
1: 0
2: 3
3: 14
4: 218
1105412631_1105412640 8 Left 1105412631 13:20184188-20184210 CCAGAACAGTGGTTCCATGGCTC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1105412640 13:20184219-20184241 CGGGGGCTGCACTGAGGACAGGG 0: 1
1: 0
2: 1
3: 23
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105412631 Original CRISPR GAGCCATGGAACCACTGTTC TGG (reversed) Intergenic
905690063 1:39936525-39936547 GAGCCCTGGAGAGACTGTTCTGG + Intergenic
909659592 1:78067354-78067376 GAACCATTGTACCATTGTTCTGG - Intronic
913116554 1:115702729-115702751 GAGCCATGGAACCACAGATTGGG + Intronic
913243970 1:116855391-116855413 GAGCCAGTGAACCATTATTCAGG - Intergenic
913351757 1:117869072-117869094 GACCCTTGGAAGCACTGATCTGG + Exonic
916583827 1:166132265-166132287 GAGATTTGGAACCACTCTTCTGG - Intronic
919182937 1:194108948-194108970 TAGCCATGGAACCACAATTTTGG + Intergenic
921304938 1:213786710-213786732 CAGACATGGATCCACTTTTCTGG + Intergenic
922311677 1:224398950-224398972 GAGTGATGGAAAGACTGTTCTGG - Exonic
1062937566 10:1399738-1399760 GTGCCAGGGAACCACTGACCAGG + Intronic
1067226477 10:44379520-44379542 GTGCCCCTGAACCACTGTTCTGG - Intronic
1071536590 10:86437994-86438016 GATCAATGTAACCACTGTGCGGG - Exonic
1073495031 10:103883040-103883062 GCGACATGGAGCCACTGCTCAGG + Intronic
1079094562 11:17502147-17502169 CAGCCAGGGCACCCCTGTTCAGG + Intronic
1081574678 11:44311521-44311543 GCGCCCTGGAACCTCTGCTCAGG + Intergenic
1083158803 11:60842120-60842142 GAGCCATGGATACACCGTTAAGG + Exonic
1088792692 11:113240120-113240142 GAGCCATGCAAATAATGTTCAGG - Intronic
1090491377 11:127164010-127164032 GAGCCCTGTATCCACTGTTTAGG - Intergenic
1090903573 11:131053785-131053807 AAGCTATGGAACCACGTTTCAGG - Intergenic
1096541356 12:52308995-52309017 GAGTCATAGAACCACTATCCAGG - Exonic
1096626243 12:52897738-52897760 GAACCATGCAATCACTGATCAGG - Intronic
1097803414 12:63939793-63939815 GAGCCATGGAGCCACCTTCCAGG - Intronic
1101818475 12:108164250-108164272 GAGCCATGGAACCATTGCCAAGG + Intronic
1102530140 12:113540241-113540263 GAGCCTTGGAACCCTGGTTCTGG - Intergenic
1105412631 13:20184188-20184210 GAGCCATGGAACCACTGTTCTGG - Intergenic
1105755623 13:23461201-23461223 CAGTCATGGAAACACTGTTCAGG - Intergenic
1109100835 13:58181705-58181727 GTGCCATGGAGCCACTGCTAGGG + Intergenic
1113465781 13:110512090-110512112 GAGCCCTGGAAGCTCTGCTCGGG - Exonic
1113590501 13:111495958-111495980 GAGGAAGGTAACCACTGTTCAGG + Intergenic
1113825373 13:113248431-113248453 GAGCAAAGGAACCAGTGTTAAGG - Intronic
1121961627 14:98265533-98265555 GGGCAATGGATCCACTGTTGAGG + Intergenic
1122084676 14:99291258-99291280 GATACATGGAAGCATTGTTCGGG - Intergenic
1124108433 15:26763203-26763225 TAGCTTTGGAACCACTGGTCTGG + Intronic
1124438474 15:29670353-29670375 CACCGCTGGAACCACTGTTCTGG - Intergenic
1126229837 15:46311625-46311647 GAGCCATGGATCCTCTGTGGGGG + Intergenic
1126389251 15:48128141-48128163 GAGGTATTGAACCACTGTTCTGG + Intronic
1128213184 15:65916481-65916503 GGGCCTTGGAACCACAGGTCAGG + Intronic
1131908806 15:97173313-97173335 GTGCTCTGGAACCAGTGTTCTGG + Intergenic
1141712418 16:85707810-85707832 GGGCCTGGGAAACACTGTTCTGG + Exonic
1143529972 17:7497042-7497064 GAGCCCTGGAGCCACTGACCTGG - Exonic
1145002530 17:19315228-19315250 GTGCCCTGGACCCAGTGTTCTGG + Intronic
1146268405 17:31468301-31468323 GACACATGCCACCACTGTTCTGG + Intronic
1147035056 17:37673700-37673722 GTGACCTGGAAACACTGTTCTGG + Intergenic
1147835099 17:43324409-43324431 GAGTCATGCATCCACTGTACAGG + Intergenic
1149655667 17:58308541-58308563 GAGCCAAGGAGCCACTCTCCCGG - Exonic
1151358981 17:73577119-73577141 GAGCCTTGGAATGACTGTCCTGG + Intronic
1155388036 18:25302331-25302353 GAGCCATGGAACCACGGAGGTGG - Intronic
1161160772 19:2760876-2760898 GTGCCCTGGGACCACTCTTCAGG - Intronic
1167524477 19:49975143-49975165 GAGACATGGGGCCACTGTCCAGG + Intergenic
1168155448 19:54471598-54471620 GAGCCAGGGAACCAGGGGTCCGG - Exonic
926300952 2:11601873-11601895 GAGCCATGGAGCCAGTGGCCTGG - Intronic
926773241 2:16396943-16396965 GAGCCTTGGACTCAGTGTTCAGG - Intergenic
928404146 2:31001510-31001532 GAGCCAGGGTACAACTGATCTGG - Intronic
936682573 2:114791048-114791070 GAGACATAAAACCACTATTCTGG + Intronic
941662407 2:168208781-168208803 GAGTCATGGGAGCACTGCTCAGG - Intronic
942511893 2:176711100-176711122 GAGGCTTGGAAACACTGCTCTGG - Intergenic
944070069 2:195657835-195657857 GAGCCTCGGCACCGCTGTTCCGG + Intronic
946538268 2:220656053-220656075 GAGTCATTTAACCACTGTCCTGG - Intergenic
946739580 2:222788445-222788467 GCGCCTTGAAACAACTGTTCTGG - Intergenic
947932272 2:233973881-233973903 GAGCCCTGGAGCCACGGTGCGGG + Intronic
1174736158 20:52968033-52968055 CAGCCAAGGAACCACCGTTGTGG - Intergenic
1174765997 20:53254763-53254785 GAGCCAGAGAATCACTGTTTGGG - Exonic
1175336612 20:58200264-58200286 AAGCCATGGTACCACTGCTCTGG + Intergenic
1177411719 21:20738545-20738567 GATCAATGGACCCACTTTTCAGG + Intergenic
1178776816 21:35559351-35559373 AAGCCTGGGAAACACTGTTCTGG - Intronic
1180149634 21:45940988-45941010 GGGCCCTGGAACCCCTGTCCCGG + Intronic
1180155978 21:45977611-45977633 GAGCCAGGAAACCACTGCCCTGG - Intergenic
1182796863 22:32997257-32997279 AAGCCATTGAACCCCTGGTCAGG + Intronic
1183336103 22:37247537-37247559 GAGCCCTGGAACCACTCTCTGGG + Intergenic
953821443 3:46210606-46210628 CAGCCTTGGCACCAATGTTCAGG + Intronic
954108450 3:48421394-48421416 GAGCCAGGGACACACTGTTGGGG + Intronic
960093040 3:113661183-113661205 CAGCCAGGGAACAGCTGTTCAGG - Exonic
962249390 3:133826141-133826163 GCGCCATGGAACCACTGAGATGG + Exonic
964021668 3:152021029-152021051 GTGCCATGCAACCACTGCTGGGG - Intergenic
965104572 3:164340716-164340738 TAGCCATGGAACCCCAGTTGAGG + Intergenic
967142255 3:186570882-186570904 GAGCCATGGTTCCTCTGTCCCGG - Exonic
968346956 3:198016566-198016588 GAGTTTGGGAACCACTGTTCCGG + Intronic
975822914 4:78289916-78289938 ACTCAATGGAACCACTGTTCTGG - Intronic
976337103 4:83901859-83901881 GATCATTGTAACCACTGTTCAGG + Intergenic
987191342 5:15481566-15481588 GTGCCATGGATCCCCTGCTCTGG + Intergenic
988698261 5:33646032-33646054 GTTCCAAGGAACCACTGTGCAGG + Intronic
988989550 5:36656358-36656380 GAGCCATGTAACCCCTGATGTGG + Intronic
991943988 5:71882316-71882338 GAGCCCTGGCACCAGTGATCAGG - Intergenic
995204943 5:109469044-109469066 GGGCCATGGAACCAATGTAGTGG + Intergenic
996283237 5:121758050-121758072 GAGACATGAAAGCACTATTCAGG + Intergenic
997692683 5:135837311-135837333 GACCCAGGGAATCATTGTTCTGG + Intronic
1006169152 6:32083130-32083152 TAGCCCTTGAATCACTGTTCCGG + Intronic
1010322758 6:74531947-74531969 TAACCTTGGAAACACTGTTCTGG + Intergenic
1011402746 6:86981588-86981610 GAGCTATGGAGCCACTGCTGAGG + Intronic
1011643462 6:89435364-89435386 CACCCAAGGAACCACTATTCTGG + Intronic
1017026671 6:150186913-150186935 GAGCCATGGAAGCAGTGGTGTGG + Intronic
1018482643 6:164207246-164207268 GAGCCTGAGAACCACTGCTCTGG - Intergenic
1019572734 7:1720482-1720504 GAGCCAGGGAACCAGCGTGCAGG + Intronic
1026329105 7:69336690-69336712 GAGCCACTGAGCCACTGTGCAGG + Intergenic
1030491012 7:110234482-110234504 GAGCTAGGTAACCACTGTCCTGG + Intergenic
1030563364 7:111119861-111119883 GAGCCATGGGACCACTGTGAAGG + Intronic
1033158514 7:138976779-138976801 GAGCATTGGAACCACTGATCCGG - Intronic
1033395980 7:140974084-140974106 GAGCCATGTTACCAGTTTTCAGG + Intergenic
1037800666 8:22033510-22033532 GCACTAGGGAACCACTGTTCAGG + Intronic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1039966198 8:42285774-42285796 GAGCCTTGGAAACAGTGCTCAGG + Intronic
1057782645 9:98062228-98062250 GAGCAAGGAAACCACAGTTCTGG + Intronic
1059113838 9:111583033-111583055 AAGCCATGGCCCCACTGCTCTGG + Intronic
1059791828 9:117648671-117648693 GAGGCAGGGAAGCACTGTTGTGG - Intergenic
1061133431 9:128720734-128720756 CAGCCATGGGGCCACTGTTGTGG + Exonic
1061513371 9:131074246-131074268 GAGCCTTGAAAACACTGTGCTGG - Intronic
1061753813 9:132798949-132798971 GAGCCGTGGAACTGCTGTGCGGG - Intronic
1187375515 X:18749546-18749568 TAGCCATGGACCCACTGCTGTGG + Intronic
1188478539 X:30612803-30612825 GAGCTTTGGATCCATTGTTCTGG - Intergenic
1190898259 X:54641973-54641995 GAGGCATGGACCCTCTGCTCTGG - Intergenic
1191862048 X:65673744-65673766 GAACCATGGAACAACTGAGCTGG + Intronic
1192630936 X:72777401-72777423 GAGGCATGGAGCCCCTGCTCAGG + Intronic
1192650773 X:72943400-72943422 GAGGCATGGAGCCCCTGCTCAGG - Intronic
1200887051 Y:8280761-8280783 CAGCCATGGAACCACGCTCCCGG + Intergenic
1201384101 Y:13419446-13419468 AAGCCATGGAGCATCTGTTCTGG - Intronic