ID: 1105415021

View in Genome Browser
Species Human (GRCh38)
Location 13:20203830-20203852
Sequence AAAGCCTGGGGTATCTATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 123}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105415015_1105415021 5 Left 1105415015 13:20203802-20203824 CCAGCTATCCCTTTCAATGTCTG 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1105415021 13:20203830-20203852 AAAGCCTGGGGTATCTATTTAGG 0: 1
1: 0
2: 2
3: 11
4: 123
1105415012_1105415021 22 Left 1105415012 13:20203785-20203807 CCAGGTGAGTCCTTCTCCCAGCT 0: 1
1: 0
2: 0
3: 22
4: 232
Right 1105415021 13:20203830-20203852 AAAGCCTGGGGTATCTATTTAGG 0: 1
1: 0
2: 2
3: 11
4: 123
1105415013_1105415021 12 Left 1105415013 13:20203795-20203817 CCTTCTCCCAGCTATCCCTTTCA 0: 1
1: 0
2: 0
3: 30
4: 400
Right 1105415021 13:20203830-20203852 AAAGCCTGGGGTATCTATTTAGG 0: 1
1: 0
2: 2
3: 11
4: 123
1105415011_1105415021 29 Left 1105415011 13:20203778-20203800 CCAATTTCCAGGTGAGTCCTTCT 0: 1
1: 0
2: 2
3: 21
4: 193
Right 1105415021 13:20203830-20203852 AAAGCCTGGGGTATCTATTTAGG 0: 1
1: 0
2: 2
3: 11
4: 123
1105415016_1105415021 -3 Left 1105415016 13:20203810-20203832 CCCTTTCAATGTCTGAACTGAAA 0: 1
1: 0
2: 2
3: 25
4: 320
Right 1105415021 13:20203830-20203852 AAAGCCTGGGGTATCTATTTAGG 0: 1
1: 0
2: 2
3: 11
4: 123
1105415017_1105415021 -4 Left 1105415017 13:20203811-20203833 CCTTTCAATGTCTGAACTGAAAG 0: 1
1: 0
2: 0
3: 29
4: 165
Right 1105415021 13:20203830-20203852 AAAGCCTGGGGTATCTATTTAGG 0: 1
1: 0
2: 2
3: 11
4: 123
1105415014_1105415021 6 Left 1105415014 13:20203801-20203823 CCCAGCTATCCCTTTCAATGTCT 0: 1
1: 0
2: 0
3: 12
4: 195
Right 1105415021 13:20203830-20203852 AAAGCCTGGGGTATCTATTTAGG 0: 1
1: 0
2: 2
3: 11
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105415021 Original CRISPR AAAGCCTGGGGTATCTATTT AGG Intergenic
901395799 1:8980529-8980551 AGAACCTGGGATATCTTTTTAGG + Intergenic
905744343 1:40401351-40401373 AAATCCTGTGGAATCTATCTTGG - Intronic
906131475 1:43461166-43461188 AAAGCCTGTGGCTTCTATCTTGG + Intergenic
907713542 1:56906815-56906837 AAAGCCTGGCTTCTCTTTTTGGG - Intronic
911056286 1:93711106-93711128 AAAGCCTGCAGCTTCTATTTTGG - Intronic
912564371 1:110575484-110575506 AAAATCTGTGGTAACTATTTTGG + Intergenic
918948380 1:191100719-191100741 AAAGAATGGAGTATCTATTTAGG - Intergenic
919549347 1:198965464-198965486 AAAGCCTGGGAGACATATTTGGG - Intergenic
1063491162 10:6464901-6464923 GAAGCCTGGGGAATCTAGGTGGG + Intronic
1063553021 10:7051347-7051369 ACAGCCTGGAGTAGCCATTTGGG + Intergenic
1063600645 10:7477673-7477695 AAAGGGTGGGGAATCTCTTTGGG - Intergenic
1065106811 10:22396863-22396885 GAATCCTGGGCTATCTATTGAGG - Intronic
1065259112 10:23906306-23906328 AAAGCCTTGAGTATGTGTTTGGG - Intronic
1067428669 10:46227895-46227917 AAAGCCTGTGGGATCCATGTAGG - Intergenic
1069912875 10:71770593-71770615 AAAGCCTGGGGCCTCAAGTTTGG + Intronic
1071109432 10:82137682-82137704 AAAGCCTGGGTTATGTTTTTTGG - Intronic
1075240522 10:120774397-120774419 AGAGCATGGAGAATCTATTTGGG + Intergenic
1077571528 11:3342786-3342808 AAATCCTGAGGAATCTATGTAGG - Intronic
1077996598 11:7457859-7457881 CAAGCCTGGGGTCACTATTTTGG + Intronic
1078965590 11:16336927-16336949 AAAGACTGGGGAAGTTATTTTGG - Intronic
1083182813 11:60998769-60998791 AAAGCCCTGTGTATTTATTTGGG + Intronic
1086178476 11:83920568-83920590 TCAGCCTGAGGTATCTATTGGGG + Intronic
1088161470 11:106876851-106876873 AAAGACTGGGATATCTTTTGGGG - Intronic
1094211634 12:27899531-27899553 AAAGCCTGGGTTATGTTTTCAGG - Intergenic
1099472436 12:83068006-83068028 AAAGCCAGTGTTATCCATTTGGG + Intronic
1101539485 12:105652167-105652189 AAAGCCTAGTGAATCTCTTTGGG + Intergenic
1102044302 12:109820332-109820354 AAAGCCTGGGGTCTCTGTCTAGG - Intronic
1102481103 12:113224113-113224135 AAAGTCTGGGCCATGTATTTAGG - Intronic
1104214940 12:126726045-126726067 TAAGCCTGTGCTAACTATTTAGG - Intergenic
1104216765 12:126741497-126741519 AGAGCCTGGGAAATGTATTTCGG + Intergenic
1104482350 12:129118865-129118887 AAAGCACAGCGTATCTATTTCGG + Intronic
1105415021 13:20203830-20203852 AAAGCCTGGGGTATCTATTTAGG + Intergenic
1106548648 13:30752441-30752463 AGTGCCTGAGGGATCTATTTTGG + Intronic
1107040833 13:35945453-35945475 AAACTCTGGGGTCTCTATCTAGG - Intronic
1108777634 13:53785489-53785511 AGAGGCTGGGGTATCAATTAGGG - Intergenic
1112149292 13:96739476-96739498 AAAGACTGGAGTAGATATTTTGG - Intronic
1116263850 14:42662913-42662935 AAAGACTGAGGAAGCTATTTTGG + Intergenic
1117555845 14:56882878-56882900 AAAGCCTAAGGTATTTTTTTTGG + Intergenic
1118750760 14:68806602-68806624 AAAGCCTGGGCTCTGTATCTGGG + Intergenic
1121460851 14:94076798-94076820 AAAACCCAGGGTATCTTTTTGGG + Intronic
1125885810 15:43228714-43228736 AAAGCCTGGGGTGTTTATTGGGG - Intergenic
1126572859 15:50170087-50170109 AAAGCCTGGAAAATATATTTGGG + Intronic
1127679970 15:61284725-61284747 AAAGCCTGGGGTGTTTACTGGGG - Intergenic
1128238875 15:66086218-66086240 AAAGCCTGGAAAATATATTTGGG + Intronic
1128495555 15:68196556-68196578 AGAGCCTGGGGTTTCTAGGTAGG - Intronic
1130693605 15:86107862-86107884 AAAGCCTGGTGCATCCATATGGG + Intergenic
1130962624 15:88673271-88673293 AAATCATGAGGTAACTATTTTGG + Intergenic
1131776843 15:95811736-95811758 AAACTCTGGGGTATTTATATAGG + Intergenic
1131887166 15:96928445-96928467 AAAGGCTGGGGTAACTCATTAGG + Intergenic
1132268281 15:100498788-100498810 ATAGGCTAGTGTATCTATTTAGG - Intronic
1142052256 16:87966430-87966452 AATGCCTGTGGTTGCTATTTTGG - Intronic
1144724343 17:17494246-17494268 GATGCCTGGGGCATCTATGTAGG - Intergenic
1147241811 17:39095387-39095409 CAAGCCTGGGTTATTTGTTTTGG + Intronic
1148632447 17:49121729-49121751 AAAGCCTGGGGTCACCATTGGGG + Intergenic
1157084458 18:44564952-44564974 AAAGCCTGGGGTATTCATATGGG + Intergenic
1158591936 18:58785246-58785268 AAAGCCGGGGGTCTCTATTTTGG - Intergenic
1159072114 18:63636851-63636873 AGAGCCTGGGGGAATTATTTAGG - Intergenic
1159467214 18:68799628-68799650 AAAGCCTCTGGCATCTCTTTAGG - Intronic
1161943705 19:7421456-7421478 AAAGCTGGGGATATCTATTTGGG - Intronic
926175333 2:10586148-10586170 AAGGCGTGGGGTTTCTTTTTGGG + Intronic
927461966 2:23306992-23307014 AAAGCTTGGAGCATCTTTTTAGG + Intergenic
928622916 2:33109017-33109039 AAAGCCTGGAAAATCTATTTTGG - Intronic
929945968 2:46372131-46372153 AGAGCCTGTGATTTCTATTTGGG - Intronic
930349967 2:50238384-50238406 AAAGCTAGGGGTATCGATTATGG - Intronic
935328016 2:101955369-101955391 ATGGCCAGGGGCATCTATTTGGG + Intergenic
935599431 2:104907389-104907411 AAAGCCTTGTGTATCTACTTGGG + Intergenic
937667945 2:124507895-124507917 AAAGACTGCGGCTTCTATTTGGG - Intronic
941459593 2:165753302-165753324 AGAGCCTGGAGTATCTCTTCTGG - Intronic
941761254 2:169246611-169246633 AAAGCTTGGGCTATTTATATGGG - Intronic
942046974 2:172105270-172105292 AAAGCCTGGAGAACATATTTAGG - Intergenic
943891150 2:193289149-193289171 AAAGCCTGGAAAATATATTTGGG - Intergenic
1170020767 20:11834337-11834359 AAGGCCTGGTGTATCTCTTAGGG - Intergenic
1171466245 20:25329766-25329788 AAAGCCTGGGTTGGTTATTTGGG + Intronic
1172130809 20:32653476-32653498 AAAGCCTGGGGTTACTGTGTTGG + Intergenic
1175295257 20:57903924-57903946 AAAGCATGGGGTGTCTTTTCAGG - Intergenic
1177876647 21:26641189-26641211 AAAGCTTTGGGTATTTACTTGGG + Intergenic
1178911871 21:36681182-36681204 AAAGCCTGGGGTATTTACCAGGG - Intergenic
1179424249 21:41260679-41260701 AAAACCTGGGGTTTCTATCCTGG - Intronic
1181086205 22:20440588-20440610 AATCCTTGGGGTATCCATTTAGG + Intronic
1184048462 22:41987239-41987261 AAAGCCTGGGGTGTCGATGACGG - Exonic
1184209807 22:43028810-43028832 AAAGCCTGGGCTCTGTAATTAGG - Intergenic
950685357 3:14613767-14613789 AAAGCCTGGGCTATTTACTAGGG - Intergenic
951520360 3:23605464-23605486 AAATCCTGGGGTCTTGATTTTGG + Intergenic
954554182 3:51505440-51505462 ACAGCCTGGGGTACCCAGTTAGG + Intergenic
960292678 3:115905520-115905542 GGACTCTGGGGTATCTATTTTGG - Intronic
960406088 3:117261786-117261808 AGACCCTGGGGAATCTTTTTTGG - Intergenic
960897103 3:122516314-122516336 AAAGTCTGGGGTATTTACTAGGG + Intergenic
961691715 3:128674751-128674773 ATAGCCTGGGGTATCAAAATGGG + Intronic
965473036 3:169119064-169119086 AGAGCATGTGGTTTCTATTTGGG + Intronic
965772806 3:172198767-172198789 TAAGCCTGGGATATCTACCTTGG + Intronic
966099854 3:176254186-176254208 AAAACCTGGTATATCTCTTTTGG - Intergenic
971439200 4:26661525-26661547 AAAGTCTGGGGTTTCTAGGTTGG - Intronic
972834881 4:42858151-42858173 ACAGCCTGTGGTATGTGTTTTGG - Intergenic
973030669 4:45333527-45333549 ATAGCCTGGATTATCTATGTGGG + Intergenic
973177087 4:47220484-47220506 TAAGCCAGGGATATATATTTGGG - Intronic
977324499 4:95557559-95557581 AAATCATGGAGTATCCATTTAGG + Intergenic
977552009 4:98452204-98452226 AAATCCTGGGGTATCAATTCAGG - Intergenic
977746916 4:100559799-100559821 AAAGCCTGGAAGATATATTTGGG + Intronic
980427292 4:132642674-132642696 ATTGCCTGGGGTAGTTATTTAGG + Intergenic
982561613 4:156934948-156934970 AAAGCCTCAGGTATGTTTTTAGG - Intronic
986551111 5:8957027-8957049 AACACCTGGGGTATCTAATCAGG + Intergenic
996017298 5:118554033-118554055 TAAGCCAAGGATATCTATTTTGG + Intergenic
997496615 5:134332831-134332853 AAAGCCAGTGGTAGCTTTTTGGG + Intronic
997661409 5:135591882-135591904 AGAGCCTGAGTGATCTATTTGGG - Intergenic
1000847697 5:166301882-166301904 AAATCCTGGTATATCTCTTTCGG - Intergenic
1001450399 5:171820195-171820217 AAAGCCTGGTGTGCCTTTTTGGG + Intergenic
1001745505 5:174089524-174089546 GAAGCCTGGGGTATCTTTTTTGG - Intronic
1001876140 5:175202832-175202854 ATAGCCTTGGATATCTCTTTAGG - Intergenic
1004816464 6:19316423-19316445 ACAGCCTGTGGTATTTTTTTAGG + Intergenic
1005777714 6:29154887-29154909 AAAGTCTTGGGTATTTATATGGG + Intergenic
1006872009 6:37259719-37259741 AAAGACTTGGGTTACTATTTGGG + Intronic
1011544061 6:88465383-88465405 AAAGACTGTGGCTTCTATTTTGG - Intergenic
1015930356 6:138353423-138353445 AAACCCTGGGGTATCTGGTGCGG - Intergenic
1024212914 7:47221807-47221829 AAAGCCAGGGCTATTTCTTTGGG - Intergenic
1030095437 7:105894610-105894632 AGCACCTGGGGTAGCTATTTTGG + Intronic
1035270519 7:157717167-157717189 AAAGCCTCGTGGATCGATTTTGG - Intronic
1035653684 8:1289111-1289133 ACAGCCTGGGGTCTCAATTCAGG - Intergenic
1036937615 8:13019076-13019098 AAAGTCTGGAGTATTGATTTGGG + Intronic
1039100896 8:33940887-33940909 AAAGCCTGGGAACTCTAATTTGG - Intergenic
1041504018 8:58573975-58573997 AAAGCCTAAGGTATTTATTATGG - Intronic
1041854614 8:62437304-62437326 AAAGCCTTACGTTTCTATTTGGG - Intronic
1042088749 8:65135003-65135025 AAAGCCTGGAATATATATTTTGG + Intergenic
1042335027 8:67621056-67621078 AATGCCTGGGGTTTTTATTGGGG - Intronic
1042439353 8:68807928-68807950 AAAACCTAGGGAATTTATTTGGG + Intronic
1048794231 8:138133846-138133868 CACGCATGGGGTATGTATTTGGG + Intronic
1050874769 9:10620211-10620233 AAAGCCTGTGGTATATATAAAGG - Intergenic
1056322585 9:85450985-85451007 AAAGCCTGGAAAATATATTTAGG - Intergenic
1057028427 9:91755136-91755158 AAAGCCAGGCCTGTCTATTTGGG + Intronic
1057756544 9:97843074-97843096 AAAGACTGTGGTTTCCATTTGGG + Intergenic
1060402413 9:123356402-123356424 AAGGCTTGGGGTATCTGTCTTGG - Intronic
1186237973 X:7534125-7534147 ATACCCTGGAGTCTCTATTTTGG + Intergenic
1187357565 X:18591483-18591505 AAAGATCGGGGGATCTATTTGGG - Intronic
1188636949 X:32445152-32445174 AAAGCCTAGGAGATCTTTTTTGG + Intronic
1191136974 X:57075195-57075217 AAAGCCTTGGATATGTAATTTGG + Intergenic
1193441103 X:81539792-81539814 AAAGCCTGAGGAATCTACCTTGG - Intergenic
1194858662 X:98966651-98966673 CAAGCCTGGGATAGCAATTTTGG + Intergenic
1199808350 X:151324873-151324895 AAAGCTTGGTTTATATATTTGGG - Intergenic