ID: 1105417697

View in Genome Browser
Species Human (GRCh38)
Location 13:20227548-20227570
Sequence GGTGCTCAGTGACCCTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 282}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105417685_1105417697 11 Left 1105417685 13:20227514-20227536 CCGAACCTGCCCGGTCCTGAGTG 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1105417697 13:20227548-20227570 GGTGCTCAGTGACCCTGAGCTGG 0: 1
1: 0
2: 5
3: 28
4: 282
1105417689_1105417697 2 Left 1105417689 13:20227523-20227545 CCCGGTCCTGAGTGGGCTGCCCC 0: 2
1: 0
2: 1
3: 20
4: 236
Right 1105417697 13:20227548-20227570 GGTGCTCAGTGACCCTGAGCTGG 0: 1
1: 0
2: 5
3: 28
4: 282
1105417690_1105417697 1 Left 1105417690 13:20227524-20227546 CCGGTCCTGAGTGGGCTGCCCCT 0: 1
1: 0
2: 0
3: 15
4: 199
Right 1105417697 13:20227548-20227570 GGTGCTCAGTGACCCTGAGCTGG 0: 1
1: 0
2: 5
3: 28
4: 282
1105417688_1105417697 6 Left 1105417688 13:20227519-20227541 CCTGCCCGGTCCTGAGTGGGCTG 0: 1
1: 0
2: 0
3: 19
4: 200
Right 1105417697 13:20227548-20227570 GGTGCTCAGTGACCCTGAGCTGG 0: 1
1: 0
2: 5
3: 28
4: 282
1105417684_1105417697 18 Left 1105417684 13:20227507-20227529 CCTCTCTCCGAACCTGCCCGGTC 0: 1
1: 0
2: 2
3: 7
4: 114
Right 1105417697 13:20227548-20227570 GGTGCTCAGTGACCCTGAGCTGG 0: 1
1: 0
2: 5
3: 28
4: 282
1105417693_1105417697 -4 Left 1105417693 13:20227529-20227551 CCTGAGTGGGCTGCCCCTGGGTG 0: 1
1: 0
2: 2
3: 32
4: 227
Right 1105417697 13:20227548-20227570 GGTGCTCAGTGACCCTGAGCTGG 0: 1
1: 0
2: 5
3: 28
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105417697 Original CRISPR GGTGCTCAGTGACCCTGAGC TGG Intronic
900163065 1:1233470-1233492 GGACCTCAGCGAGCCTGAGCCGG + Exonic
900361030 1:2289222-2289244 GGAGCTCAGAGACCCGGAGGTGG + Intronic
900536843 1:3182869-3182891 GGAGCTGAGTGACCCCGAGTTGG - Intronic
900919264 1:5660483-5660505 AGTGCTCAGTCATCCTGGGCAGG - Intergenic
902259811 1:15216122-15216144 CCTGTTCAGTGACCCTGGGCGGG - Intronic
902500307 1:16906679-16906701 AGTGCTCTGTGCCCCTGTGCAGG + Intronic
903822013 1:26110791-26110813 GGTCCTAAGTGACCCCGGGCTGG + Intergenic
905011023 1:34747267-34747289 GCTGCTGTGTGACTCTGAGCAGG + Intronic
905472992 1:38207226-38207248 GGTGCTCAGGGTCCTGGAGCTGG + Intergenic
906523879 1:46483080-46483102 GTTGCTCAGTGACCCAGTGTTGG + Intergenic
906791254 1:48660359-48660381 CTGGCTCAGTGACCTTGAGCAGG - Intronic
906860792 1:49357028-49357050 TGTGCTCAGTTATCCTGATCAGG - Intronic
906950818 1:50333419-50333441 GGTGCTGTGTGACCTTGGGCAGG - Intergenic
907277433 1:53324696-53324718 GGTGCTGAGTGACGCTCAGGTGG - Intronic
907456992 1:54582282-54582304 AGTGCTGTGTGATCCTGAGCAGG - Intronic
908014330 1:59815270-59815292 GGTGCGCCGGGACCCTGTGCAGG - Intronic
908564241 1:65338110-65338132 GGTGCTCACTGCTCCTGAGCTGG + Intronic
912384169 1:109263103-109263125 GCAGCTCAGTGGACCTGAGCTGG - Intronic
912591496 1:110825037-110825059 GGTGGTCAGCAACCCTGTGCAGG + Intergenic
913230873 1:116740070-116740092 GGAGCTCAGTGAACCTAAGGCGG - Intergenic
916268816 1:162918905-162918927 GCTGATCTGTGATCCTGAGCTGG + Intergenic
916891484 1:169116222-169116244 GTTGCTAAGTGAGCCTGAGGTGG - Intronic
918004353 1:180527662-180527684 AGTGCTCAGTGACCCTGAGGAGG + Intergenic
920341740 1:205279449-205279471 TGTGCTGTGTGACACTGAGCAGG + Intergenic
920384924 1:205564317-205564339 TGTGCTTAATGACCTTGAGCTGG + Intergenic
922575156 1:226656238-226656260 GGCGCTCAGAGACCCCCAGCAGG + Intronic
923540735 1:234886278-234886300 GGTGCCCACCCACCCTGAGCTGG - Intergenic
1064089264 10:12369505-12369527 GGGGCTCAGGGACAGTGAGCTGG + Intronic
1064261670 10:13791252-13791274 GGGGAACAGAGACCCTGAGCAGG + Intronic
1067080968 10:43212006-43212028 GGTGCCCAGTGGCCCAGTGCTGG + Intronic
1067919538 10:50439463-50439485 GCTGCTGAGTGACCCTGGACAGG - Intronic
1069806311 10:71127181-71127203 CCTGCTCAGAGACCCTGAGCAGG - Intergenic
1070279350 10:75037591-75037613 GCTCCTCTGTGACCCAGAGCCGG + Intergenic
1070423644 10:76263773-76263795 GGTGATAGGTGACCCTGAGAGGG + Intronic
1073614291 10:104977340-104977362 GCTTCTCAGTGATCCTGAGATGG + Exonic
1075757954 10:124830586-124830608 GGTGCACAGTGGCCCTGATTTGG - Intronic
1076469006 10:130705630-130705652 TGTGGGCAGTGACCCTGTGCAGG - Intergenic
1076751654 10:132546426-132546448 GGGTCTCGGTGACCTTGAGCCGG + Intronic
1078405699 11:11068220-11068242 CCTTCCCAGTGACCCTGAGCTGG + Intergenic
1079130088 11:17742230-17742252 TGTGCTCCTTGACTCTGAGCAGG + Intronic
1081352826 11:42075300-42075322 TCTGCTCAGTGACTGTGAGCAGG + Intergenic
1083084145 11:60125111-60125133 GCTGCTCAAAGACCCTGAGGAGG - Intergenic
1083624934 11:64067541-64067563 GGGGCTCAGGGACCCAAAGCAGG + Intronic
1084119358 11:67059926-67059948 GGACCTCAGTGACCCTCATCTGG + Intronic
1084150359 11:67285279-67285301 TGTGCAGAGCGACCCTGAGCTGG + Exonic
1084589970 11:70084877-70084899 GGTACTCAGGGCCACTGAGCTGG + Intronic
1084898785 11:72294470-72294492 TGAGCTCAGTGACCCAGAGCGGG + Intronic
1085119552 11:73958407-73958429 CGTGCTGAGTGACCGTGAGTAGG + Exonic
1085318665 11:75561551-75561573 GGTGCTGTGTGACCCTAAGCAGG - Intergenic
1088594429 11:111429402-111429424 GTTGCTACGTGACCTTGAGCAGG - Intronic
1089077345 11:115748853-115748875 TGTGCTCAGTGGCTCTCAGCTGG + Intergenic
1089613636 11:119683315-119683337 GCTGTTCTGTGTCCCTGAGCAGG - Intronic
1089749004 11:120637003-120637025 GGTCCTCAGAGACCCGAAGCAGG - Intronic
1089927517 11:122274044-122274066 AGAGCACAGTGGCCCTGAGCTGG - Intergenic
1090131657 11:124148429-124148451 GATGCTCAGTGACCCTGAGTGGG - Intergenic
1091390830 12:125306-125328 CGAGCTGTGTGACCCTGAGCAGG - Intronic
1096111763 12:49033184-49033206 GGTGCTCAGTTCCCCCCAGCTGG - Exonic
1096764625 12:53874194-53874216 GAAGCTCAGTGACCCTAGGCTGG + Intergenic
1097438067 12:59575215-59575237 AGGGCTCAGTCAACCTGAGCTGG - Intergenic
1098160903 12:67648153-67648175 TGAGCTCGTTGACCCTGAGCAGG - Intergenic
1099032229 12:77540938-77540960 GGCACCCAGTGACACTGAGCAGG - Intergenic
1101260767 12:103027336-103027358 AGTGGTAAGTAACCCTGAGCCGG - Intergenic
1102720638 12:115013295-115013317 GGAGCCCAGAGACCCTGGGCTGG - Intergenic
1105257757 13:18755699-18755721 GATGCACAGTGACCCTGCCCTGG - Intergenic
1105260411 13:18775007-18775029 GATGCACAGTGACCCTGCCCTGG - Intergenic
1105417697 13:20227548-20227570 GGTGCTCAGTGACCCTGAGCTGG + Intronic
1106435576 13:29720653-29720675 GGAGGTCAGTGACTCTGACCTGG + Intergenic
1107415530 13:40196448-40196470 GGTGCTCTGTGGGACTGAGCAGG - Intergenic
1108579499 13:51816822-51816844 GGCGCTCAGTCACACTGTGCTGG - Intergenic
1111526527 13:89478056-89478078 TGTGCTCAGAGACCCAGGGCAGG + Intergenic
1112050751 13:95642212-95642234 GGTGCACGCTGACCCTGCGCGGG - Exonic
1112135144 13:96569796-96569818 CTTGCTGAGTGACCCTGAGCAGG - Intronic
1112912931 13:104510725-104510747 TTTGCTCATTGACTCTGAGCTGG - Intergenic
1116580749 14:46637887-46637909 GGTGCTCAGCATCCCTGTGCAGG + Intergenic
1117771197 14:59136117-59136139 GATGCTCAGTGACCTTAAGCAGG - Intergenic
1119265356 14:73260876-73260898 GGGTCACAGTGACACTGAGCAGG - Intronic
1119537091 14:75411344-75411366 CCAGCTCAGTGACCCTGGGCAGG - Intergenic
1120152179 14:81048579-81048601 GGCCACCAGTGACCCTGAGCTGG + Intronic
1120864326 14:89283083-89283105 GGAGCTGACTTACCCTGAGCTGG - Intronic
1120891441 14:89495264-89495286 GCAGCTCTGTGACCCTGAACTGG + Intronic
1121914371 14:97822780-97822802 GATGCTCAGTGATCCTCAACAGG + Intergenic
1124216123 15:27808302-27808324 GATGCTCGGGGAGCCTGAGCTGG + Intronic
1127382925 15:58445107-58445129 GGGGCTCAGGGAGCCTGGGCTGG + Intronic
1127661861 15:61107015-61107037 GCTGCTCAGTGACCATGTTCAGG - Intronic
1128625253 15:69195024-69195046 GTAGCTCTGTGACCTTGAGCAGG + Intronic
1129291108 15:74568442-74568464 GAAGCTCTGAGACCCTGAGCAGG + Intronic
1129844763 15:78763181-78763203 GCTGCTGAGTGACTCTGGGCAGG - Intronic
1130257058 15:82330672-82330694 GCTGCTGAGTGACTCTGGGCAGG + Intergenic
1130368585 15:83263519-83263541 GGTGGTCAGTGAAGATGAGCAGG - Exonic
1130597892 15:85259318-85259340 GCTGCTGAGTGACTCTGGGCAGG - Intergenic
1131295459 15:91144636-91144658 GGTGGTCAATGCCTCTGAGCTGG - Intronic
1132380437 15:101362430-101362452 GGTGCTCAGTGTCACGGGGCTGG + Intronic
1132515388 16:363579-363601 GCTGCTCTGTGCACCTGAGCAGG + Intergenic
1133946814 16:10355706-10355728 GCCGCTCAGTGCCCCTGAGATGG - Intronic
1137334782 16:47537428-47537450 GGGGCCCAGTTTCCCTGAGCTGG - Intronic
1137386002 16:48043130-48043152 AGAGGGCAGTGACCCTGAGCTGG + Intergenic
1138567397 16:57843678-57843700 GGTGCTCAGTGAGTCAGATCTGG + Intronic
1138583448 16:57956219-57956241 TTTGCTCTGTGACCCTGGGCAGG + Intronic
1139580901 16:67873100-67873122 GGGGCTCAGCGACGCTGCGCGGG + Exonic
1140242291 16:73214108-73214130 GGGGCACACTGACACTGAGCTGG - Intergenic
1141156139 16:81598400-81598422 GGTGCTCAGTGGCCCACAGGTGG + Intronic
1141775330 16:86119140-86119162 GCTGCTGTGTGACCCTGGGCAGG - Intergenic
1141918732 16:87120526-87120548 GGTGCCTAGTGACCCTGTTCTGG - Intronic
1142436942 16:90065903-90065925 GGCTCTCAGAGGCCCTGAGCTGG + Intronic
1142510388 17:389233-389255 CGGGCGCAGTAACCCTGAGCAGG + Intergenic
1142853382 17:2716232-2716254 GACGCTCACTGACCCTGAGGAGG - Intergenic
1143901251 17:10176377-10176399 GGTGCTAAGAGACGCTGTGCAGG - Intronic
1144658312 17:17052118-17052140 GCAGCTCAGTGACCTTGGGCAGG - Intronic
1145052929 17:19678194-19678216 GGTGCTGTGAGACCCTGACCAGG - Intergenic
1146367715 17:32242186-32242208 GGAGATCAGTGATCCTGAGGTGG - Intronic
1149693854 17:58600821-58600843 AGTTCTCTGTGATCCTGAGCAGG + Intronic
1150210581 17:63439082-63439104 GGGGGTCAGTGCCCCTGTGCTGG - Intronic
1150644817 17:66971425-66971447 GGTGTTCAGTGAGCCTGTGCTGG - Intronic
1151210316 17:72539367-72539389 GGTTCTCAAAGAGCCTGAGCAGG - Intergenic
1151481898 17:74374596-74374618 GGTCTACACTGACCCTGAGCAGG + Intergenic
1151666649 17:75549219-75549241 GGTCCTCAGTGGCCCTGTCCTGG - Intronic
1151936209 17:77263250-77263272 TGTGCTCAGTTGCCCTCAGCTGG - Intergenic
1152825039 17:82459192-82459214 GCTGCTCGGTGACCCTCAGAGGG - Intronic
1152923533 17:83077729-83077751 GGGGCTCTGAGACCCTGAGCAGG + Intergenic
1153787250 18:8545900-8545922 GGTGCTCAGTGGCCTGGAGCTGG + Intergenic
1154428343 18:14289373-14289395 GATGCACAGTGACCCTGCCCTGG + Intergenic
1154433300 18:14325029-14325051 GATGCACAGTGACCCTGCCCTGG + Intergenic
1155027944 18:21959262-21959284 GTTGCTCTGTGGCTCTGAGCGGG - Intergenic
1156403002 18:36757767-36757789 GTTGCTCAGTGATCCTGGCCTGG - Intronic
1156942050 18:42779848-42779870 ACTGCTCTGTGACCTTGAGCAGG + Intronic
1157558566 18:48630178-48630200 TCTGCTCAGTGACTCTGGGCTGG - Intronic
1160702303 19:513535-513557 GGTGCTCAGTAATGCTGGGCCGG - Intronic
1160702317 19:513632-513654 GGTGCTCAGTAATGCTGGGCTGG - Intronic
1160832455 19:1110140-1110162 GGTGCTGGGTGACCCCAAGCAGG + Intronic
1160843869 19:1158198-1158220 GGTGCTCAGGGACCCCCAGGGGG - Intronic
1160948266 19:1653264-1653286 GGGGCTCTCTGACCCAGAGCCGG - Intergenic
1161043826 19:2123934-2123956 GGTGCCCCGTGGCCCTGAGTTGG - Intronic
1161953888 19:7482409-7482431 GGTGCTCAGTGCCCCTTGGAGGG + Intronic
1162450698 19:10752663-10752685 GATGCTGTGTGACCCTGGGCAGG + Intronic
1162925311 19:13927994-13928016 GCTGGTCATTGACCCTGTGCCGG + Exonic
1163186082 19:15640718-15640740 TGTGCTGTGTCACCCTGAGCTGG + Intronic
1163222005 19:15928643-15928665 GATGCTGAGTGACTCTGGGCAGG - Intronic
1163265546 19:16218495-16218517 GGTGCACAGTAGCCCTGTGCAGG + Intronic
1164271054 19:23672040-23672062 GGTTCTCAGTGCCCCTGAGCTGG + Intronic
1164939483 19:32241466-32241488 GATGCCCAGTGACCATGAGAGGG + Intergenic
1165071731 19:33259722-33259744 TGTGCTCAGAGCCCCAGAGCAGG + Intergenic
1166640834 19:44493941-44493963 GGTGCTCAGGGTCCCTGATGAGG - Intronic
1167304337 19:48698332-48698354 GCTGCTGAGTGGCCCAGAGCAGG - Intronic
925058681 2:874435-874457 GCTGCTCAGTGACCCAGAGCTGG - Intergenic
925201137 2:1968578-1968600 GGAGCTCAGTTTCCCTCAGCAGG + Intronic
926055059 2:9769571-9769593 AGAGCACAGTGGCCCTGAGCGGG + Intergenic
926243795 2:11107249-11107271 GGTCCTCAGTGACCACGTGCTGG - Intergenic
927959709 2:27233518-27233540 GGAGCTCAGTGACCTCGAGGTGG + Exonic
928611181 2:32993813-32993835 TGTGCCATGTGACCCTGAGCTGG - Intronic
928680707 2:33699736-33699758 GGTGCTCAGTAGCTCTGTGCAGG - Intergenic
929933627 2:46277471-46277493 GTTGCTCAGGGCCCCTGAGAGGG + Intergenic
930929468 2:56862699-56862721 GGTGCTCAGCATCCCTGTGCAGG + Intergenic
932435467 2:71700543-71700565 TCTGCTCAGTGACCCTTATCCGG - Intergenic
932739889 2:74283317-74283339 GTTGCACAGTGACCCTGAGTGGG - Intronic
932823664 2:74921728-74921750 GGTGCTCAGGGATGCTGAGCTGG + Intergenic
933196297 2:79393907-79393929 GGAGCTAAATGACCCTGAGCAGG - Intronic
933644291 2:84798254-84798276 GGTGCCTGGTGACTCTGAGCAGG - Intronic
934492342 2:94770027-94770049 GCTGCACAGTGACCCTGCCCTGG - Intergenic
935342228 2:102068466-102068488 GGACCTGAGTGACCCTGAGATGG - Intronic
935668559 2:105535690-105535712 GGTTTGCAGTGAGCCTGAGCTGG - Intergenic
935738249 2:106123928-106123950 GGGACTCAGTGGGCCTGAGCAGG + Intronic
936530416 2:113272549-113272571 AGTGGTCAGTGACCCTGGGATGG - Intronic
938313995 2:130314159-130314181 GGTGCTCACTCACCCTGACGTGG + Intergenic
943145439 2:184038556-184038578 GGTGCTTAGTGACCCAGTGGTGG + Intergenic
945864176 2:215158506-215158528 GGTGGTCAGTGACACTAGGCAGG + Intergenic
946835456 2:223768024-223768046 AGTGGTCAATGGCCCTGAGCAGG - Intronic
947021582 2:225683295-225683317 GGTGCTGAGAGAGCCTGAGAGGG + Intergenic
947761469 2:232606542-232606564 GGGGCTGGGGGACCCTGAGCAGG + Intronic
948213541 2:236212268-236212290 GGTGCTCAGGGGCCCTGTTCTGG - Intronic
948934486 2:241153727-241153749 GGTCCTCAGTGGCCCAGGGCAGG + Intronic
1169211255 20:3767442-3767464 GGGGCGCAGTGACCGTTAGCTGG - Intronic
1169577675 20:6983743-6983765 GGTGATCAGTAGCCCTGTGCAGG - Intergenic
1170949922 20:20927075-20927097 CGGGTTCAGTGGCCCTGAGCAGG + Intergenic
1171289411 20:23972923-23972945 AGCGCTCAGTGAAACTGAGCAGG - Intergenic
1171883559 20:30635144-30635166 GCTGCACAGTGACCCTGCCCTGG - Intergenic
1172150578 20:32787470-32787492 GGTCCTCAGTCACCCTGGGCAGG - Intronic
1172804432 20:37601258-37601280 GGTTCTCAGTAATCCTGAGTGGG + Intergenic
1173982596 20:47236410-47236432 GGTGCTCATGGACCCCGAGCTGG + Exonic
1174802767 20:53578767-53578789 GGTTCTCAGTGTCTCTGAGCAGG + Intronic
1175101107 20:56579424-56579446 ATTGCTGAGTGACCCTGGGCCGG - Intergenic
1175523624 20:59618716-59618738 GGTGCTGTCTCACCCTGAGCAGG + Intronic
1175523631 20:59618754-59618776 GGTGCTGTCTCACCCTGAGCAGG + Intronic
1175523638 20:59618792-59618814 GGTGCTGTCTCACCCTGAGCAGG + Intronic
1175523645 20:59618830-59618852 GGTGCTGTCTCACCCTGAGCAGG + Intronic
1176270752 20:64234696-64234718 CGTGGTGGGTGACCCTGAGCTGG + Intronic
1179907762 21:44433094-44433116 GCTTCTCAGTCAGCCTGAGCGGG - Intronic
1181422627 22:22812182-22812204 GGTGGCCATTGTCCCTGAGCTGG - Intronic
1181720693 22:24772418-24772440 TGTGCTGTGTGACCCTGAGCAGG + Intronic
1182217893 22:28734536-28734558 GGAGCTCAGTGTCCCAGAGCTGG + Exonic
1182766432 22:32761187-32761209 GGTGCTGTGTGACCCAGTGCCGG + Intronic
1183216040 22:36480761-36480783 GGTGGCCACTGACCCTGAGAGGG + Exonic
1183222925 22:36528836-36528858 CCTGCTCAGTGCCCATGAGCTGG - Intronic
1183650575 22:39151433-39151455 CTTGCTCGGTGACCTTGAGCAGG + Intronic
1184258208 22:43299097-43299119 CTTGCTCTGTGACCTTGAGCAGG + Intronic
1184419666 22:44372364-44372386 GGTGCTGTGTGACCCTGGGCAGG - Intergenic
949376241 3:3393155-3393177 GCTGCACTGTAACCCTGAGCTGG - Intergenic
949661353 3:6283118-6283140 GGTGCTCAGCGACCCCGTGCAGG - Intergenic
949927864 3:9056462-9056484 TGAGCTCTGTGACCTTGAGCAGG - Intronic
950026867 3:9826079-9826101 TGTGCTTCGTGACCTTGAGCAGG + Intronic
950653685 3:14423557-14423579 GGTGCTGTGTGACCTTGAGCAGG - Intronic
950667427 3:14505861-14505883 TGTGCTGAGTGACCCTGGGGAGG + Intronic
952337387 3:32415622-32415644 TCTGCACAGTAACCCTGAGCAGG - Intronic
952669928 3:35953996-35954018 GGTGTTCAGTGACCCTATGCAGG + Intergenic
954314336 3:49793012-49793034 GGTGCACAGTGACCTTGTGTTGG - Exonic
954331272 3:49891660-49891682 CTTACTGAGTGACCCTGAGCAGG - Intronic
954678318 3:52327578-52327600 GGTGTCCAGGGACCCAGAGCAGG - Intronic
954791702 3:53137844-53137866 GGTTCTGAGTGACCCTGTGGTGG - Intergenic
957229827 3:77498744-77498766 GGTGCTCAGCTACCCTTAGGAGG + Intronic
961639075 3:128353567-128353589 GCTGCCCAGTGCCCCTGGGCCGG + Intronic
962993803 3:140605239-140605261 GGTGCTCAGCAACCCTGTGCAGG - Intergenic
965089419 3:164143905-164143927 GGAACTCAGTGCCCCTGTGCAGG + Intergenic
965755159 3:172018300-172018322 GGAACCCAGTGCCCCTGAGCAGG + Intergenic
968071872 3:195789186-195789208 GGTGGTTCGTGACCCTGAGGAGG + Exonic
968609138 4:1549243-1549265 GGTCTTCTGTGCCCCTGAGCTGG - Intergenic
968673517 4:1864750-1864772 GGACCAGAGTGACCCTGAGCAGG - Intergenic
968903726 4:3442514-3442536 CCTGGGCAGTGACCCTGAGCAGG + Intronic
968966557 4:3771836-3771858 GGTACACAGGAACCCTGAGCAGG - Intergenic
968981753 4:3853891-3853913 GGTGCTCAGTAAACATCAGCAGG - Intergenic
969319300 4:6402188-6402210 CCTGCTCTGTGACCCTGAGCAGG - Intronic
969453872 4:7290100-7290122 GTAGCTGAGTGACCCTGGGCTGG + Intronic
970664137 4:18318075-18318097 AGTGTTCAGTGACTCTGAGGAGG - Intergenic
970709076 4:18841078-18841100 TGTGCTCAGAGACCCTGAAGTGG - Intergenic
971543358 4:27851344-27851366 GTAGCTCTGTGACCCTGGGCAGG - Intergenic
972231404 4:37076470-37076492 GGTGCTGCGTGAACCTTAGCAGG - Intergenic
973367211 4:49217416-49217438 GCTGCACAGTGACCCTGCCCTGG - Intergenic
974603883 4:64123245-64123267 GGTGCTCAGTAACACTGTGTAGG + Intergenic
976815994 4:89148845-89148867 GGTCCTCACTGGGCCTGAGCTGG + Intergenic
978923579 4:114216663-114216685 GGTGCACAGTAGCCCTGGGCAGG - Intergenic
983971583 4:173882059-173882081 GGTGCACAGAGACACTGAGTAGG - Intergenic
985610463 5:885089-885111 GATGCTCAGTCACCATGAGGCGG + Intronic
985663223 5:1167834-1167856 GGTGCTCAGTCACCATGCACAGG - Intergenic
986855554 5:11864775-11864797 AGTGCTCAGTGTCCCTCAGGTGG + Intronic
988034474 5:25807993-25808015 GGTGCTCAGCAACCCTGTGCTGG + Intergenic
988701803 5:33682842-33682864 GGAGTTCAGTGATACTGAGCGGG - Intronic
988934278 5:36066841-36066863 GGTGCACAGGGTCCCTTAGCCGG - Exonic
989546457 5:42680303-42680325 CATGCTCAGTCACCCTGATCTGG - Intronic
996168346 5:120255405-120255427 GCTGCTCAGTGACTCAGAGGAGG + Intergenic
996801356 5:127406935-127406957 GGTGCTCAGTGAGTATTAGCTGG + Intronic
997773605 5:136577414-136577436 TGTGCTGTGTGACCCGGAGCGGG - Intergenic
997989202 5:138529988-138530010 GCTGCTCAGTGAGTCTGAGGTGG - Intronic
999234248 5:150080983-150081005 AGAGCCCAGTGTCCCTGAGCTGG - Exonic
999801361 5:155040713-155040735 GAGGCTCAGAGACCCTCAGCAGG + Intergenic
1001287345 5:170433606-170433628 GATGCTCAGTGATAATGAGCAGG + Intronic
1001313912 5:170629574-170629596 GGTGCTCAGTTAGATTGAGCTGG + Intronic
1001936345 5:175708570-175708592 GGTGCTGAGTGGCCTTGGGCAGG - Intergenic
1003305343 6:4922098-4922120 CCTGCTCAGTGACCTTGGGCAGG + Intronic
1003534461 6:6964045-6964067 TTTGCTCTGTGACCCAGAGCTGG - Intergenic
1003894954 6:10598700-10598722 TGTGCCCAGGGACGCTGAGCTGG + Intronic
1004375224 6:15085323-15085345 GGTGCTGAGTGATGATGAGCGGG - Intergenic
1006513719 6:34534758-34534780 GGTCCTCAGGGCCCCAGAGCGGG + Exonic
1007243232 6:40442070-40442092 GGTGCTCTGTGATTCAGAGCAGG - Intronic
1007357943 6:41334432-41334454 GGTCCTGTGTGACTCTGAGCAGG + Intergenic
1007470878 6:42089486-42089508 GTAGCTCAGTGACCTTGGGCAGG - Intergenic
1012692325 6:102328935-102328957 GGTGCTCAGCAACCCTGTTCAGG + Intergenic
1015218235 6:130774815-130774837 GGATCTCATTGATCCTGAGCAGG - Intergenic
1016354416 6:143202651-143202673 GGTGCTGAAGGACCCTGAGAAGG + Intronic
1017962901 6:159237320-159237342 AATCCTCAGTGATCCTGAGCTGG - Intronic
1018190245 6:161304174-161304196 GGTGGCCAGTGACGCTGTGCGGG + Intergenic
1019159759 6:170062221-170062243 GCTTCCCAGTGGCCCTGAGCGGG + Intergenic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1019538287 7:1539970-1539992 GGTGCTCAGCGATGATGAGCTGG + Exonic
1020012745 7:4815536-4815558 TGTCCTCAGTGGCCCAGAGCCGG - Intronic
1020715686 7:11673147-11673169 GGTGCTCAGTGACTCCAGGCAGG - Intronic
1023983633 7:45083080-45083102 GGCCCTCAGTCTCCCTGAGCCGG - Exonic
1024325709 7:48107712-48107734 GATTCTCAGTGACCTTGTGCAGG + Intronic
1024843616 7:53616753-53616775 GGTCCTCACTGATCCTGAGTGGG - Intergenic
1026890294 7:73977716-73977738 GCTGCTCAGACACCCTCAGCTGG - Intergenic
1027191188 7:75996260-75996282 GGTTCTTGGTGAACCTGAGCAGG + Intergenic
1030983149 7:116210351-116210373 CAAGCTCAGTGACCCTGACCTGG - Intergenic
1031329959 7:120452532-120452554 GGTGCTCAGTAGTCCTGTGCAGG - Intronic
1033757661 7:144408195-144408217 CTTGATCAGTGACCCTGAGAAGG - Intronic
1034536232 7:151727598-151727620 TGTGGCCAGTGACCCTGAGGAGG - Intronic
1035215460 7:157363285-157363307 GCTGCTGAAGGACCCTGAGCGGG + Intronic
1035796863 8:2365981-2366003 GATGCTCAGTGTCCCTGGGGTGG + Intergenic
1035892106 8:3356755-3356777 GGTGCTCTGTGGGCCTGAGAGGG + Intronic
1036701837 8:11018185-11018207 GGGGCTGAGTCACCCTGAGGGGG - Intronic
1039485116 8:37904045-37904067 GGAACTCAGTGACCCTGCGCGGG - Intergenic
1040053591 8:43038364-43038386 GTTGCTCTGTCACCCAGAGCTGG - Intronic
1041661313 8:60404251-60404273 GCTGCACAGTGACACTCAGCTGG + Intergenic
1043012673 8:74900525-74900547 GGAACTCAGTGCCCCTGTGCAGG + Intergenic
1043875117 8:85477187-85477209 GGTGGTCAGTGAGCCTGGGTAGG - Exonic
1049279636 8:141737709-141737731 GTTGCTGAGTGTCCCTGGGCAGG + Intergenic
1050022937 9:1303913-1303935 GGCACTCAGTGTCCCTGACCTGG - Intergenic
1050099324 9:2101300-2101322 GGTGCTCAGTGACTGTGTGATGG + Intronic
1051102404 9:13535956-13535978 GGTGCTCAGCAACCCTATGCAGG + Intergenic
1051247335 9:15125150-15125172 GGGGCCCAATGAACCTGAGCTGG + Intergenic
1051525008 9:18032873-18032895 GGTGCTCAGTGACTCTGTGTGGG + Intergenic
1051947062 9:22581642-22581664 GGTGCTTAGCAACCCTGTGCAGG + Intergenic
1055777604 9:79782824-79782846 GAGGCTAATTGACCCTGAGCAGG + Intergenic
1057216225 9:93230336-93230358 GGGCCTCAGTGCCCCTCAGCCGG + Intronic
1057260393 9:93579895-93579917 GATGCTCAGAGTCCCTGAGTAGG - Intronic
1058025408 9:100137554-100137576 GGTACTCTGTGACCTTGAGCAGG + Intronic
1059408814 9:114119144-114119166 CTTGCTGAGTGACCTTGAGCTGG - Intergenic
1061097181 9:128465152-128465174 GGTGCTGAGAGAACCTGGGCAGG - Intronic
1061260006 9:129474996-129475018 GGTGCTCAGGGAACAGGAGCTGG - Intergenic
1061396673 9:130347360-130347382 GGTGAGCAGGGACCCAGAGCTGG + Intronic
1061718694 9:132537950-132537972 GGCCCTGTGTGACCCTGAGCGGG + Intronic
1062171152 9:135135561-135135583 AGTGCTGGGTGACCTTGAGCAGG + Intergenic
1062400832 9:136371916-136371938 GGTGCTCAGCGACCCCAACCTGG - Exonic
1062560108 9:137137858-137137880 GGTGCTCAGGGGGACTGAGCTGG - Intergenic
1187059996 X:15776781-15776803 GGTAGTCAGAGACCCTGAGTAGG - Exonic
1188707714 X:33356681-33356703 AGTGCTCAGTAGCCCTGTGCAGG - Intergenic
1190912621 X:54786879-54786901 GGTGCCCAGTGAGCCCCAGCGGG + Intronic
1190918342 X:54826525-54826547 GGTGCTCAGTGAGCCCCAGCGGG - Intergenic
1192784389 X:74322737-74322759 GCAGCTCTGTGACCCTGGGCAGG - Intergenic
1192804244 X:74495571-74495593 GCAGCTCTGTGACCCTGGGCAGG + Intronic
1194078346 X:89426030-89426052 GGTGCTCACCAACCCTGTGCAGG - Intergenic
1194261426 X:91700214-91700236 AGTGCTCAGTAGCCCTGTGCAGG + Intergenic
1195643814 X:107206470-107206492 GGCGACCAGTGACCCTGACCTGG + Intergenic
1196063164 X:111433112-111433134 GGAGCCCAGTCAACCTGAGCAGG + Intergenic
1199677656 X:150201304-150201326 GGTGCTCGGTGCCCTGGAGCAGG + Intergenic
1199685273 X:150259876-150259898 GCTGCTCAGAAACCCTGACCTGG + Intergenic
1199912954 X:152307712-152307734 GGTGCTCAGTAACCCTGTGCAGG - Intronic
1200430987 Y:3081562-3081584 GGTGCTCACCAACCCTGTGCAGG - Intergenic
1200580076 Y:4939015-4939037 AGTGCTCAGTAGCCCTGTGCAGG + Intergenic
1200835023 Y:7724883-7724905 GCTGCTCTGTGACTCTCAGCTGG + Intergenic