ID: 1105418101

View in Genome Browser
Species Human (GRCh38)
Location 13:20230925-20230947
Sequence GCCACTGCAGTGACTAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105418101_1105418104 14 Left 1105418101 13:20230925-20230947 CCAGCTTTAGTCACTGCAGTGGC 0: 1
1: 0
2: 3
3: 18
4: 225
Right 1105418104 13:20230962-20230984 CACACCCCCAGTTATGTGACAGG 0: 1
1: 0
2: 0
3: 10
4: 101
1105418101_1105418109 26 Left 1105418101 13:20230925-20230947 CCAGCTTTAGTCACTGCAGTGGC 0: 1
1: 0
2: 3
3: 18
4: 225
Right 1105418109 13:20230974-20230996 TATGTGACAGGCTAGAGCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105418101 Original CRISPR GCCACTGCAGTGACTAAAGC TGG (reversed) Intronic
902152255 1:14452878-14452900 GCCACAGTAATGAGTAAAGCAGG + Intergenic
904802396 1:33103074-33103096 GCTACTGCAGTAGCTCAAGCAGG - Intronic
905414196 1:37793686-37793708 GCCAGTGAAGTGAGTAAAGGTGG + Intergenic
905435369 1:37951874-37951896 GCCACTGCAGAGGCTGAGGCAGG + Intergenic
905470127 1:38185549-38185571 GCTACTTCAGTGACTGAGGCAGG - Intergenic
905527667 1:38651303-38651325 GCCACTGCAGAGGCTAAGGCAGG + Intergenic
905715165 1:40143111-40143133 GCTACTCAAGTGACTAACGCAGG + Intergenic
909505446 1:76383548-76383570 CCAATTGCAGTGACTAATGCCGG - Intronic
912602822 1:110955445-110955467 GCCACTGCAATGTTTTAAGCAGG - Intronic
914906697 1:151752023-151752045 GCCACTGGGGAGACTAAGGCAGG + Intergenic
918615192 1:186536393-186536415 GCCACTGAAGAGACTAAAACAGG - Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
922807125 1:228396129-228396151 GCCACTGCAGTGGCTGAGGTGGG + Intronic
924807249 1:247371422-247371444 GTCACTGCAGTGGCTAACCCTGG + Intergenic
1063232515 10:4079379-4079401 GCAACTGTAGTGAATACAGCAGG - Intergenic
1063878992 10:10511297-10511319 GCCACTGGAGAGACTGAGGCAGG + Intergenic
1064911236 10:20404257-20404279 ACCACAGCAGTGACCAAACCTGG - Intergenic
1065929380 10:30465623-30465645 GCCACTGCAGTCACTGAACCTGG + Intergenic
1067674669 10:48362096-48362118 TCCACTGCAGGAAATAAAGCTGG - Intronic
1068445509 10:57117223-57117245 AGCACTGCTGTGACTAAAGGAGG - Intergenic
1068705984 10:60075989-60076011 ACCTCTCCAGTGACTACAGCAGG - Exonic
1069540444 10:69290202-69290224 GCCACTGCAGTGATTTAAATGGG - Intronic
1072565572 10:96614071-96614093 GCCACTGGAGATACTGAAGCAGG - Intronic
1072576873 10:96708703-96708725 GCCACTGAAGTCACTAACCCCGG + Intronic
1074218000 10:111406850-111406872 GTCACTGCAGTGGCTAAAGGTGG + Intergenic
1075151809 10:119939734-119939756 GCCACTGCACTCACACAAGCTGG - Intronic
1077313505 11:1904415-1904437 GCTACTCCAGAGACTGAAGCAGG + Intergenic
1077894713 11:6445288-6445310 GATATAGCAGTGACTAAAGCAGG - Intergenic
1078634599 11:13037514-13037536 GCCACTCCAGAGACTGAGGCAGG - Intergenic
1080510971 11:32971045-32971067 GCCACTCCAGAGACTGAGGCAGG - Intronic
1080692542 11:34570502-34570524 GCCACTGCACAGACTCCAGCTGG + Intergenic
1081299226 11:41429680-41429702 GCCACTGCAGTGAATAAGCAGGG + Intronic
1082693405 11:56331890-56331912 GCCACTCCAGTGACGAAGGTAGG - Intergenic
1083259905 11:61517263-61517285 GCCACTGATGAGACTAAAACTGG - Intronic
1083982760 11:66186915-66186937 GCCAGTACAGTGACCAAGGCAGG - Intronic
1084717329 11:70882311-70882333 GCCACTGCAGTGTGGAAGGCAGG + Intronic
1085480660 11:76820338-76820360 GCCAATGCTGTGTCTCAAGCTGG - Intergenic
1087662623 11:101004853-101004875 GCTACTCCAGTGGCTAAGGCAGG + Intergenic
1090797210 11:130145524-130145546 GCAACTTCAGTGACCAATGCAGG - Intergenic
1090881817 11:130839811-130839833 GCCACTGCAGTTACACAAGTTGG + Intergenic
1093391007 12:18621375-18621397 GACACTTCAGTGACAAAATCTGG + Intronic
1095948564 12:47767917-47767939 GCTACTGGAGTGATTGAAGCAGG + Intronic
1096615347 12:52829787-52829809 GCTACTCCAGTGGCTAAAGCAGG + Intronic
1097467608 12:59947380-59947402 GCTACTGAAGTGGCTGAAGCAGG + Intergenic
1099171944 12:79375468-79375490 GCCACTGCAGGGATTTAAGCAGG + Intronic
1099484997 12:83218369-83218391 GCTGCTGAAGTGACTAAATCTGG - Intergenic
1100284801 12:93154999-93155021 GCTACTCCAGTGAAGAAAGCGGG + Intergenic
1101286321 12:103317006-103317028 GCCACTGTGGTGACTAGAGCTGG - Intronic
1102276530 12:111586424-111586446 GCCACTGCACTGACGACAGAGGG - Intronic
1103058098 12:117837232-117837254 GCTACAGCAGGGACTAATGCTGG - Intronic
1105068432 12:133219177-133219199 GCCACTGGAGTGAATACACCAGG - Intronic
1105418101 13:20230925-20230947 GCCACTGCAGTGACTAAAGCTGG - Intronic
1105547891 13:21365084-21365106 GGCCCTGGGGTGACTAAAGCAGG + Intergenic
1107861673 13:44666755-44666777 GCTACTGGAGAGACTAAGGCAGG - Intergenic
1108794420 13:54014138-54014160 GCTACTGCAGAGACTCCAGCAGG - Intergenic
1110661872 13:78066467-78066489 CCCACGGCAGTGTCTAAAGTGGG - Intergenic
1112680038 13:101753689-101753711 GCTACTGCAGAGGCTGAAGCAGG + Intronic
1112753050 13:102601000-102601022 GCTACTGCAGTGGCTGAGGCAGG - Intronic
1114080157 14:19196756-19196778 GCTACTGCAGAGACTGAGGCAGG + Intergenic
1114333224 14:21659145-21659167 GCTACTCCAGAGACTGAAGCAGG - Intergenic
1114574136 14:23696994-23697016 GCCTCTGGAGTGACCAGAGCAGG - Intergenic
1114952068 14:27767413-27767435 GCTACTGCAGAGGCTGAAGCAGG - Intergenic
1117211569 14:53506335-53506357 GCCACTGCTGTGTCCTAAGCAGG + Intergenic
1119308694 14:73628772-73628794 GCCACAGCAGTGGCTCATGCCGG + Intergenic
1120207388 14:81601069-81601091 GCCCCTGCAGTGATTAGGGCAGG - Intergenic
1122849661 14:104520896-104520918 GCCACTGCGGTGACTCAGGTCGG - Intronic
1127915856 15:63454294-63454316 GCTACTCCAGAGACTAAGGCAGG - Intergenic
1129114230 15:73356297-73356319 GCCACTCCAGAGACTCAAGCAGG - Intronic
1130813003 15:87402069-87402091 GCCACTGGAGCATCTAAAGCAGG + Intergenic
1131455337 15:92578969-92578991 GCCACTGCAATGAATGAGGCAGG - Intergenic
1131458164 15:92599232-92599254 GACTCTGCAGTGACTTGAGCCGG - Intergenic
1133336457 16:5009719-5009741 CCCACTGCATTAACTCAAGCAGG + Intronic
1134471452 16:14530011-14530033 GCCACTGCATTGAAGAAGGCAGG - Intronic
1134842698 16:17414440-17414462 GCCACTCCAGAGGCTAAAGCTGG - Intronic
1135872355 16:26162546-26162568 GCCACTGAAGAGGCTGAAGCAGG + Intergenic
1137370823 16:47904257-47904279 CCCAGTGCAGTGATTAAGGCAGG - Intergenic
1138360974 16:56426591-56426613 GCTACTGGAGAGACTGAAGCAGG - Intergenic
1138990833 16:62388931-62388953 GCTACTCAAGTGACTGAAGCAGG + Intergenic
1140468689 16:75202515-75202537 GCTACTGAAGAGGCTAAAGCAGG + Intergenic
1141072988 16:80975046-80975068 GCCCCTGCTGTGACTGCAGCTGG + Exonic
1141301995 16:82825584-82825606 GCCACTGCAGTCACTCCAGCCGG - Intronic
1141768128 16:86072094-86072116 GCCACTGCTATGATTAAAGCTGG + Intergenic
1141812923 16:86388170-86388192 CCCACTGCAGTGACCACAGCCGG + Intergenic
1141977386 16:87526323-87526345 GCCACTCCAGAGGCTAAGGCAGG - Intergenic
1142344417 16:89544949-89544971 GCCACAGCAGTGAGTGCAGCCGG - Intronic
1143812459 17:9483306-9483328 AGCAGTGCAGTGACTGAAGCAGG - Intronic
1144796837 17:17897238-17897260 GCCACAGCATTCACTAAACCAGG - Intronic
1146052508 17:29565145-29565167 GCCACTTCAGAGGCTAAGGCAGG + Intronic
1146191396 17:30770735-30770757 GCTACTCCAGAGGCTAAAGCAGG - Intronic
1146375760 17:32293283-32293305 GCCACTGAACTGATTAAGGCCGG + Intronic
1146575289 17:33985758-33985780 GCCACTCCTCTGTCTAAAGCTGG + Intronic
1147588341 17:41665818-41665840 GCCACTGCTGGGAGTAAAGAGGG - Intergenic
1149279702 17:55089217-55089239 GCCACTGCCATGACTACTGCTGG + Intronic
1149594262 17:57854807-57854829 GCCAGTGCAGTGGCACAAGCTGG + Intergenic
1149799843 17:59557171-59557193 GCCACTGAAGTGGCTGAGGCAGG + Intergenic
1151110449 17:71670219-71670241 GACACTGGAGTGATTAAAGGAGG - Intergenic
1151245578 17:72792064-72792086 ACCACTGCAGTGACTAAAGGGGG - Intronic
1151812425 17:76452605-76452627 GCCACTGCAGTGGCCGACGCGGG - Intronic
1151847781 17:76669725-76669747 GCCACTGCAGAGACTGAAGCAGG - Intergenic
1153020330 18:623142-623164 GCCACTTCAGAGGCTGAAGCAGG - Intronic
1154930650 18:20991744-20991766 GCCACTCCAGAGGCTAAGGCTGG - Intronic
1155497756 18:26459333-26459355 GCCACTCCAGAGGCTAAGGCAGG - Intronic
1155862401 18:30919939-30919961 GCTACTCCAGAGGCTAAAGCAGG - Intergenic
1158296379 18:56001670-56001692 GCCACTGCAGGGCCGAATGCTGG - Intergenic
1158682951 18:59585091-59585113 GCTGCTGCAGAAACTAAAGCAGG - Intronic
1159680584 18:71346413-71346435 GCTACTCCAGAGACTGAAGCAGG - Intergenic
1162342784 19:10102002-10102024 GCCACTCCAGAGACTGAGGCAGG + Intronic
1163085627 19:14977667-14977689 GCCACTCAAGAGGCTAAAGCAGG + Intronic
1163161440 19:15466882-15466904 GCCACTACAGAGGCTGAAGCAGG - Intergenic
1163953795 19:20615196-20615218 GCCTCTGGAGTGACCAGAGCAGG - Intronic
1165642136 19:37398668-37398690 GCCTCTGCTGTGGCTCAAGCTGG - Intergenic
1166865876 19:45836748-45836770 GCCACTGGAGAGGCTGAAGCAGG - Intronic
1168290984 19:55357455-55357477 GCCACTGCAGTCCCTGAGGCAGG - Intronic
925683957 2:6452922-6452944 GCTACTCAAGTGACTAAGGCAGG + Intergenic
926043634 2:9693843-9693865 GCCACTGCAGGGACAAAGGCTGG + Intergenic
927577072 2:24208822-24208844 GCCCCTGCAGGGACTGTAGCAGG + Intronic
932611749 2:73204814-73204836 GCCACTCCAGAGGCTAAGGCAGG - Intronic
934784854 2:96997643-96997665 GCCACTCCAGGGACTATTGCTGG + Intronic
936492624 2:112985698-112985720 GCCATTGCAGTGGGTAAACCTGG + Intergenic
937334110 2:121050404-121050426 GCCACTGCTGCGACTGGAGCAGG - Intergenic
939309399 2:140454908-140454930 GCCACTGTAGTGACTCAGGCAGG + Intronic
939961062 2:148566513-148566535 CCTACTGCAGTGGCTCAAGCAGG - Intergenic
940036928 2:149320846-149320868 GCCACTCCAGTGACAAAGGTAGG + Intergenic
941331576 2:164184014-164184036 GACAATGCAGTGGCTTAAGCTGG - Intergenic
942528399 2:176881197-176881219 GCTACTCAAGTGGCTAAAGCAGG + Intergenic
943193992 2:184719191-184719213 GCCCCAGCCGTGACTAAAACGGG - Intronic
943404456 2:187462122-187462144 CCCACGGCAGTGACTAGAGGTGG - Intergenic
943479541 2:188400568-188400590 GCCACTGGAGGGAATTAAGCAGG + Intronic
946223049 2:218245676-218245698 GCCATTGCAGTGACTAAAGGAGG + Intronic
946856005 2:223950364-223950386 GCTACTGCAGTGGCTGAGGCAGG - Intergenic
1169422857 20:5473693-5473715 GCCATTGCAGTGGCTAACACTGG + Intergenic
1169426568 20:5501782-5501804 GCCATTGCAGTGGCTAACACTGG - Intergenic
1173846012 20:46189228-46189250 GCCACTCCAGTGATTAGAGGGGG + Intronic
1174335738 20:49859147-49859169 GCCACTGCTGAGACCCAAGCTGG + Intronic
1175208019 20:57326884-57326906 CCCACTGCGCTGACAAAAGCAGG - Intergenic
1176415387 21:6471715-6471737 GCCACTGCCGTGACTTGGGCAGG - Intergenic
1177924543 21:27197826-27197848 GCTACTCCGGTGACTGAAGCTGG - Intergenic
1179690887 21:43080048-43080070 GCCACTGCCGTGACTTGGGCAGG - Intergenic
1180032248 21:45220439-45220461 GCCACTTCTGAGACTAATGCAGG - Intronic
1180500617 22:15925944-15925966 GCTACTGCAGAGACTGAGGCAGG - Intergenic
1181935199 22:26433468-26433490 CCCACTGCAGTGACTTTTGCCGG + Exonic
1183241043 22:36658665-36658687 TACACTGCAGGGACCAAAGCAGG + Intronic
1183657149 22:39193340-39193362 GTCACTGCAGTCACAAAAGGAGG + Intergenic
1185313456 22:50169278-50169300 GCCACTGCTGTGAGCAAACCAGG - Intergenic
949405880 3:3713822-3713844 ACCACTACAGTGAAGAAAGCAGG - Intronic
950476833 3:13220098-13220120 AGCACTGAAGTGCCTAAAGCTGG - Intergenic
951723616 3:25729741-25729763 GTCACTGAAGTGAGTTAAGCAGG - Intronic
951727481 3:25776178-25776200 GGCACTGCAGTGACCAACACTGG + Intronic
952391618 3:32885452-32885474 GCCAGTGCCTTGACAAAAGCAGG + Intronic
952967563 3:38630713-38630735 GCCTCTGCTGTGACAACAGCTGG - Intronic
953394881 3:42560748-42560770 GCTACTGCAGAGACTGAAGTAGG - Intronic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
954818902 3:53307464-53307486 GCCATGGTAGTGAGTAAAGCAGG - Intronic
956621378 3:71224371-71224393 GCCACTGCAGTGGCAGAAGAAGG + Intronic
958521094 3:95186527-95186549 GCTACTGCAGAGGCTAAGGCAGG - Intergenic
959849675 3:111071808-111071830 GCCACTGCCGAGGCTGAAGCGGG - Exonic
960392982 3:117102273-117102295 GCTACTGCAGAGACTGAAGTTGG - Intronic
961150469 3:124633391-124633413 GCCACATCAGTGATTAGAGCAGG - Intronic
961722105 3:128903639-128903661 CCCCGTGCAGTGACCAAAGCAGG - Intronic
962580165 3:136790936-136790958 GCCTCTGCTTTGATTAAAGCAGG + Intergenic
964542438 3:157794321-157794343 GACTCTGCATTGAGTAAAGCAGG + Intergenic
965797070 3:172450019-172450041 GTCAAGGCAGTGACTAACGCCGG - Intergenic
972480185 4:39489304-39489326 GCTTCTGGAGTGACTAGAGCAGG - Intergenic
972835197 4:42862153-42862175 GGCACTGTAGAGACTAAAGTAGG + Intergenic
973343184 4:49027030-49027052 GCCACTCTAGTGCCTCAAGCAGG + Intronic
973687290 4:53384295-53384317 GCTACTCCAGAGACTAAGGCAGG + Intronic
973854480 4:54996967-54996989 GATACAGCAGTGACTAAGGCAGG - Intergenic
973988068 4:56375198-56375220 GCTACTCCAGTGGCCAAAGCAGG - Intronic
978335869 4:107668309-107668331 GCCACTGCAGTACCTAACACAGG + Intronic
978793021 4:112682121-112682143 GCTACTCCAGAGGCTAAAGCAGG - Intergenic
982265683 4:153536442-153536464 GGCACTGCAGCAACTGAAGCAGG - Intronic
983899733 4:173121135-173121157 GTCACTGGACTGACTGAAGCAGG - Intergenic
984169111 4:176340095-176340117 GACAGAGCAGTGACCAAAGCAGG + Intergenic
986842254 5:11711165-11711187 GCTACTCCAGAGACTTAAGCAGG - Intronic
987359128 5:17090931-17090953 GCTACTGGGGTGACTAAGGCAGG + Intronic
991211752 5:64113480-64113502 GCCAGTGAAGTAACTAAAACCGG + Intergenic
994076229 5:95652942-95652964 GCCACTGAAGAGTATAAAGCAGG - Intronic
997934871 5:138101609-138101631 GCCACTCAAGTTACTAAAGTTGG - Intergenic
998310609 5:141126190-141126212 GCTACAGGAGTGGCTAAAGCAGG + Intronic
999550222 5:152678331-152678353 GCCACTGCAGTGTTTTAAACAGG - Intergenic
1002549168 5:179974241-179974263 GCCACTTCAGGAGCTAAAGCGGG - Intronic
1004544885 6:16588273-16588295 GCCACTGCAATGCCTTAGGCAGG - Intronic
1005527789 6:26668444-26668466 GCCAATGCAGTGAGAACAGCAGG + Intergenic
1005543005 6:26833228-26833250 GCCAATGCAGTGAGAACAGCAGG - Intergenic
1005970003 6:30753283-30753305 GCCACTGAACTTACTGAAGCAGG - Intergenic
1006037773 6:31227315-31227337 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1006269386 6:32952145-32952167 GCCACTGTATTGACTAGAGAAGG + Intronic
1009013822 6:57875409-57875431 GCCAATGCAGTGAGAACAGCAGG - Intergenic
1010377765 6:75192887-75192909 ACCTCTGCATTGACTTAAGCAGG + Intronic
1012069813 6:94600184-94600206 GCCACAACAGTGACTATAACTGG - Intergenic
1012268333 6:97174701-97174723 CCCACTTCCGTGACTAAACCCGG - Intronic
1016297484 6:142589033-142589055 GCTACTGCAGAGACTGAGGCAGG + Intergenic
1016400399 6:143673808-143673830 GCCTCTGCAGAGACTCACGCAGG + Intronic
1019468166 7:1201913-1201935 CCCACGGCAGTGTCTAAGGCTGG - Intergenic
1020376967 7:7498755-7498777 GCCACTGCAGTGTCTTCAGAGGG - Intronic
1021088388 7:16451301-16451323 GCTACTGGAGAGGCTAAAGCAGG + Intergenic
1021215161 7:17907189-17907211 GCCAGTACAGTCACTAAAGATGG + Intronic
1021361274 7:19715683-19715705 GCTGCCTCAGTGACTAAAGCTGG + Intergenic
1024667247 7:51559273-51559295 GCCACTGCTGGGACTGAAGCAGG - Intergenic
1026345257 7:69468029-69468051 GCTACTGCAGTGACTCATGGTGG - Intergenic
1029327066 7:99818901-99818923 GCTACTCCAGAGACTAAGGCAGG + Intergenic
1029695589 7:102211137-102211159 TCCACAGCACTGTCTAAAGCAGG + Intronic
1030929999 7:115510957-115510979 GCCATTTCAGTGGCAAAAGCTGG + Intergenic
1035464325 7:159064813-159064835 GCCTCTGCAGGGACTGAAGGAGG - Intronic
1035488970 7:159255421-159255443 GCCACTGCAGTAACTTGGGCTGG + Intergenic
1038481316 8:27903761-27903783 GCCACTGCAGAGTCACAAGCTGG - Intronic
1038491468 8:27975036-27975058 GCCACTGGAATGACCAAGGCAGG + Intronic
1038551097 8:28469441-28469463 GCTAATCCAGAGACTAAAGCAGG - Intronic
1043198405 8:77330303-77330325 GCCACTGAAGTGAGTAGGGCTGG + Intergenic
1043271580 8:78340390-78340412 GCCAATGCAGTTACTAAAGTTGG - Intergenic
1043756702 8:84012352-84012374 GCCACAGCATTGACTTAATCTGG + Intergenic
1044425578 8:92046204-92046226 TCCCCTGCAGTGAGTTAAGCTGG - Intronic
1045494535 8:102697381-102697403 GCCACTGCAGGGACCAAATGAGG + Intergenic
1048295914 8:133213087-133213109 GCCTCTACTGTGACTACAGCGGG + Exonic
1048324828 8:133430741-133430763 GCCACTGCAGGATTTAAAGCAGG - Intergenic
1048933243 8:139333695-139333717 ACCACTGCAAGGAGTAAAGCAGG + Intergenic
1051249086 9:15141052-15141074 GCCAATGGAGTGACTTGAGCAGG - Intergenic
1055428198 9:76217367-76217389 GCTACTCCAGTGAGTAAAACTGG - Intronic
1055503086 9:76921112-76921134 GGCAATGCAGAGACTAAAGCTGG + Intergenic
1056263366 9:84871846-84871868 GTCACTGCAGGAACTAAAGGAGG + Intronic
1057818624 9:98314565-98314587 GCCACTGCAGTGTGTAAGCCAGG - Intronic
1058857069 9:109072757-109072779 GCTACTCCAGAGGCTAAAGCAGG + Intronic
1059288514 9:113199674-113199696 GCAATTGCAGTGTCTAAAGTGGG + Intronic
1059436453 9:114279559-114279581 GCCAGTGCAGTGACTCATGCTGG + Intronic
1059598994 9:115755606-115755628 GCCACTCCAGAGACTGAGGCAGG + Intergenic
1059860224 9:118452160-118452182 GCTACTCCAGGGACTAAAGTGGG + Intergenic
1059996849 9:119919065-119919087 GCCACTGCAATGATTTAGGCAGG - Intergenic
1060948870 9:127587977-127587999 GCCATTGGAGGGACTTAAGCAGG - Intergenic
1061176689 9:129001887-129001909 GCCACAGCAGTGGCTGGAGCTGG + Exonic
1061375187 9:130219900-130219922 CCCACTGCAGTGACCACAGATGG + Intronic
1061660854 9:132129464-132129486 TCCACTGCTGTGGCTAGAGCTGG + Intergenic
1061791238 9:133060318-133060340 GCTACTTCAGAGGCTAAAGCAGG + Intergenic
1062177482 9:135171942-135171964 GCCTCAGCAGTGGCTCAAGCAGG - Intergenic
1188249046 X:27869228-27869250 GCCACTGAAGTAATTCAAGCTGG - Intergenic
1190301410 X:49059518-49059540 TCCACTGCAGTGAACAAATCAGG - Intronic
1190710310 X:53063294-53063316 GCCCCTGCTGTGGCTCAAGCAGG - Intronic
1191078854 X:56487506-56487528 GCCCCTGCAGTGACTAGAAATGG + Intergenic
1194382963 X:93218181-93218203 GTCACTGCTTTGACTGAAGCAGG - Intergenic
1195051568 X:101101788-101101810 GCAACTTCAGTGAGGAAAGCTGG - Intronic
1195094147 X:101489859-101489881 CCCAATGCCATGACTAAAGCAGG + Exonic
1195094508 X:101491623-101491645 ACCATTGCTGTGCCTAAAGCAGG + Exonic
1196859617 X:120015078-120015100 GAGACTTCAGTGACTGAAGCTGG - Intergenic
1197474251 X:126901079-126901101 GCCACTGCTGTGAAGGAAGCTGG + Intergenic
1198088780 X:133306885-133306907 GCTACTCCAGAGTCTAAAGCAGG - Intronic
1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1199574584 X:149301137-149301159 GCCACTGCAGAGTCTAGAACAGG + Intergenic
1201868208 Y:18677537-18677559 GCTACTGCAGAGGCTGAAGCAGG - Intergenic