ID: 1105418177

View in Genome Browser
Species Human (GRCh38)
Location 13:20231382-20231404
Sequence CCTGGGGAGCAGGAAGGGTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1057
Summary {0: 1, 1: 0, 2: 8, 3: 93, 4: 955}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105418177_1105418192 25 Left 1105418177 13:20231382-20231404 CCTGACCCTTCCTGCTCCCCAGG 0: 1
1: 0
2: 8
3: 93
4: 955
Right 1105418192 13:20231430-20231452 ACACAGGATGCCCGTGACACCGG 0: 1
1: 0
2: 0
3: 11
4: 95
1105418177_1105418188 9 Left 1105418177 13:20231382-20231404 CCTGACCCTTCCTGCTCCCCAGG 0: 1
1: 0
2: 8
3: 93
4: 955
Right 1105418188 13:20231414-20231436 CAGCCCCGTTTGCAAAACACAGG 0: 1
1: 0
2: 0
3: 14
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105418177 Original CRISPR CCTGGGGAGCAGGAAGGGTC AGG (reversed) Exonic
900158406 1:1212549-1212571 GCTGGGGAGCTGGGAGGGGCTGG - Intronic
900226293 1:1535032-1535054 CCTGGGGGGCAGGTGGGGGCAGG - Intergenic
900241178 1:1618324-1618346 CCTGGAGAGCAGGAGGCCTCTGG - Intronic
900478797 1:2888416-2888438 GCTGGGGAGTGGGAAGGGCCTGG + Intergenic
900623206 1:3596675-3596697 CCTGGGGTGGAGACAGGGTCTGG - Intronic
900739622 1:4322780-4322802 CCTGGGGAGCAGGGAGCTTGTGG + Intergenic
900758061 1:4451241-4451263 ACTGGGAAGGAGGAAGGGGCTGG - Intergenic
900908454 1:5577206-5577228 CTTGGGGAGAGGGAAGGGTCAGG + Intergenic
900917423 1:5648615-5648637 CCTGGGGAGGAAATAGGGTCAGG - Intergenic
900948247 1:5843365-5843387 CCTATGGAGCAGGAGGGGTCAGG + Intergenic
900991018 1:6098410-6098432 CCTGGGGAGGAGGTGGGGCCAGG - Intronic
901157243 1:7149062-7149084 CCTGGGCAGCTGGAAGGGAGTGG - Intronic
901224557 1:7605613-7605635 CCTGGGAAGCACAAAGGGTCAGG - Intronic
901819332 1:11816677-11816699 CCTGGTGAGGAGGCAGGGCCTGG + Exonic
901944549 1:12691199-12691221 CCTGGGGAACAGGAAGGATCTGG - Intergenic
901970672 1:12905320-12905342 CCTGGGAAGCACAAGGGGTCAGG + Intronic
902014493 1:13296450-13296472 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
902598048 1:17522352-17522374 CCTGGGGAGCTGGGAAGGGCAGG + Intergenic
903043788 1:20551667-20551689 CCCGGGGAGCATGGAGGGTTGGG + Intergenic
903137872 1:21321196-21321218 CCTGGGGAGCAGCAAGATTGTGG - Intronic
903216662 1:21847285-21847307 CCTGGGGAGAAGGAACTTTCAGG - Intronic
903307791 1:22425498-22425520 CCTGGGGAGCAGGTGGAGTGGGG + Intergenic
903333446 1:22609251-22609273 GGTGGGGAGCAGGAGGGGCCGGG + Intergenic
903369873 1:22828367-22828389 GCTGGGGAGCTGGAGGGGCCCGG - Intronic
903422081 1:23225244-23225266 CCCGGGGAGCAGCAAGGGATGGG + Intergenic
903545924 1:24123377-24123399 CATGGAGAACAGGAAGGCTCCGG + Exonic
903755433 1:25657326-25657348 GCTGGGGAGAAGGAAGGGCAAGG + Intronic
903885713 1:26539955-26539977 CCAGGGGAGCATGAGGGATCCGG - Intronic
904424835 1:30416554-30416576 GATGGGGAGCAGGAGGGGACAGG + Intergenic
904455736 1:30647005-30647027 CTTGGGGAGCAGGTAGGGGTGGG + Intergenic
904500936 1:30912539-30912561 CCTGGGGGACAGGTAGAGTCAGG - Intergenic
904584416 1:31572008-31572030 ACAGAGGAGCAGGAAGGGGCTGG - Intergenic
904774715 1:32899775-32899797 CCCAGGGAGCAGGAAGGGATGGG + Intronic
904878139 1:33672181-33672203 CCTGGGAAGCACAAGGGGTCAGG + Intronic
905355508 1:37381002-37381024 CCTGGGAAGCGCTAAGGGTCAGG - Intergenic
905452104 1:38063564-38063586 CCTGGGAACCAGGAAGGATTGGG + Intergenic
905876557 1:41435448-41435470 CCGGGTGAGCAGGAATGGTGGGG + Intergenic
905880461 1:41460004-41460026 CCAGGGGAGCTGGAAGAGGCAGG - Intergenic
906001808 1:42432868-42432890 CCTGCAGGGCAGGAAGGCTCTGG - Intronic
906668671 1:47639240-47639262 CCTGAGGATCAGGATGGGCCTGG - Intergenic
906790584 1:48655448-48655470 CCAGGGGAGCAGAAAGTCTCAGG + Intronic
906905102 1:49880968-49880990 CCTGGGAAGCACAAGGGGTCAGG - Intronic
907051834 1:51334899-51334921 CCTGGGGGCCAGGAACGGCCTGG - Intronic
907265600 1:53258400-53258422 TCTGAGGAGCAGGAAGGCACAGG + Exonic
907317508 1:53581858-53581880 CCTAGGGAGGAGGAAGGGGGTGG - Intronic
907320722 1:53600356-53600378 CCTGGGGTACAGCAAGGGACAGG + Intronic
907717540 1:56941137-56941159 CCTGTGGACAAGGAAGTGTCTGG - Intronic
907853060 1:58274814-58274836 CCTGGGAAGCGCGAGGGGTCAGG - Intronic
907915995 1:58870577-58870599 CCAGGGGAGCAGACAGGGCCTGG - Intergenic
908295064 1:62705325-62705347 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
908595644 1:65686102-65686124 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
908913771 1:69102459-69102481 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
908976333 1:69903357-69903379 CCTGGGAAGCACAAGGGGTCAGG + Intronic
909326125 1:74352897-74352919 CCTGGGAAGCGCAAAGGGTCAGG - Intronic
909558340 1:76981196-76981218 CCAGGGAAGCATGAGGGGTCGGG + Intronic
910398383 1:86813982-86814004 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
910535657 1:88294690-88294712 CCTGGGGAACAGGAAGGCCTAGG - Intergenic
911054997 1:93701673-93701695 CCTGGGAAGCAGGCAGAGTGGGG - Intronic
911213211 1:95164429-95164451 CCTGGGAAGCACAAGGGGTCAGG - Intronic
911949538 1:104154772-104154794 CCTCCAGAGCAGGAAAGGTCTGG + Intergenic
912475790 1:109933968-109933990 GCCGGTGAGCAGGCAGGGTCAGG + Intergenic
912817115 1:112838170-112838192 CCTGGGGAGGGGAAAGGGGCTGG - Intergenic
913130500 1:115834312-115834334 TCTGGGGAGCAGCAATGGCCTGG + Intergenic
913408051 1:118517723-118517745 CCTGGGAAGCACAAGGGGTCGGG - Intergenic
913985722 1:143563908-143563930 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
914900144 1:151707294-151707316 CCTGGGGAGGAGAAAGCGACAGG + Exonic
915267795 1:154731434-154731456 CCTGCTGAGCAGGAGGGGCCAGG - Intronic
915290223 1:154878527-154878549 CCTGGGGTCCAGGGAGGGGCTGG - Intergenic
915341154 1:155177463-155177485 CCTGGGCTGCAGGAGGGGGCAGG + Intronic
915367283 1:155323402-155323424 CCGAGGGAGCAGGAGGGGACCGG - Intronic
915515323 1:156409368-156409390 CATGGGGAGAAGGCAGGGGCAGG + Intronic
915760194 1:158304152-158304174 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
915909916 1:159908572-159908594 CTCTGGGAGTAGGAAGGGTCAGG - Intergenic
915937624 1:160098517-160098539 TCTGGGGGGCCGGAAGGGTGGGG + Exonic
915944897 1:160142415-160142437 CCTGGGAGACAGGAAGGTTCAGG - Exonic
916101133 1:161394224-161394246 TCTGGGGAGGAGAAAGGGGCTGG - Intergenic
916534453 1:165690569-165690591 CCTGGGAAGCACAAGGGGTCAGG + Intronic
916802913 1:168231181-168231203 CCTGGGTTGTAGGAAGGCTCTGG + Intronic
917041562 1:170810928-170810950 CCTGGGAAGCACAAGGGGTCGGG + Intergenic
917275033 1:173322598-173322620 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
917457771 1:175200295-175200317 TCTTGTGAGCAGGAAGTGTCTGG + Intergenic
917537623 1:175885895-175885917 GCTGTGGGGCAGGAAAGGTCAGG + Intergenic
917712947 1:177705794-177705816 TCTGTGGAGGATGAAGGGTCTGG - Intergenic
917981878 1:180274591-180274613 CCAGGGGGGCAGGTAGGGTGGGG - Exonic
918537154 1:185586584-185586606 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
919935461 1:202247923-202247945 GCTGGGGAGGAGGAGGGGGCAGG - Intronic
920188915 1:204179821-204179843 TCTGGGTAGCATGAAGAGTCTGG + Intergenic
920315579 1:205073820-205073842 CCTTGGCAGCAGGAAGGGGCTGG - Exonic
920746235 1:208631665-208631687 CCTGGGGAGCTGGATGGGAAGGG - Intergenic
920854367 1:209651293-209651315 CGTGGGGAGCAGGAAAAGGCTGG + Exonic
921149770 1:212390653-212390675 CCCGGGAAGCAGAAAGGGTCAGG + Intronic
921254325 1:213325593-213325615 CCTGGGGGGCCTGAGGGGTCTGG + Intergenic
921331103 1:214037295-214037317 CCTAAGGGGAAGGAAGGGTCTGG - Exonic
921469565 1:215532374-215532396 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
922245743 1:223795873-223795895 TCTGGGGAGCCTGAAGGGCCCGG - Exonic
922498931 1:226083075-226083097 CCCGGGCCGCAGGAAGGGCCTGG - Intergenic
922704220 1:227780529-227780551 CCTGAGGAGGATGAAGGGGCTGG + Exonic
922720330 1:227896955-227896977 GCTGGGGACCACTAAGGGTCAGG + Intergenic
922724862 1:227918106-227918128 CCTGGGGAGGAGGAGGGCCCTGG - Intergenic
923180091 1:231509179-231509201 CCCAGGGATCAGGAAGGGGCTGG - Intergenic
923369350 1:233295307-233295329 CCTGGTGAGTGGGGAGGGTCCGG - Exonic
924130407 1:240901223-240901245 CCTGGGAAGCACAAGGGGTCGGG - Intronic
924481512 1:244439542-244439564 CTTGAGGAGAAGGAAGAGTCAGG - Intronic
1063129026 10:3161635-3161657 CCTCTGGAGCAGGGAGGGCCCGG + Intronic
1064000674 10:11661536-11661558 CCTGGTGGACAGGAAGGGTCAGG - Intergenic
1064431951 10:15278917-15278939 CCTGGCGAGGAGGAATGGGCAGG + Intronic
1064518675 10:16177531-16177553 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1065473104 10:26103317-26103339 CCTGGGAAGCACAAGGGGTCGGG - Intronic
1065588170 10:27240600-27240622 CCGGGGGAGGAGGAAGGAGCCGG - Intronic
1067478735 10:46582198-46582220 CCTCTGGAGCAGGCAGGGTCTGG + Intronic
1067616004 10:47759603-47759625 CTTCTGGAGCAGGCAGGGTCTGG - Intergenic
1068149225 10:53111451-53111473 CCTGGGAAGCACAAGGGGTCGGG + Intergenic
1068779272 10:60902059-60902081 CCTGGGGACAAGGCTGGGTCAGG + Intronic
1070003052 10:72395488-72395510 CCTGGGAAGCACAAGGGGTCAGG + Intronic
1070728226 10:78807046-78807068 CATGGGGAGAGGAAAGGGTCTGG - Intergenic
1070788800 10:79177578-79177600 CCGGGGCAGGAGGCAGGGTCCGG - Intronic
1070841093 10:79488373-79488395 ACTGGGGAGCAGGGTGGGTTAGG + Intergenic
1071770843 10:88727660-88727682 CCTGGGCACCAGCATGGGTCTGG + Intronic
1071797435 10:89021553-89021575 CCAGGGAAGGAGCAAGGGTCAGG - Intergenic
1072361430 10:94663494-94663516 CCTGGGAAGCACAACGGGTCAGG - Intergenic
1072933190 10:99685880-99685902 TCTGGGAAGCAGGAAGGTACTGG + Exonic
1073088587 10:100912916-100912938 CCTGGGGACCAGTAAGGGGCGGG - Intronic
1073186052 10:101615618-101615640 CCTGGGCAGCAGGATGGTTTGGG - Intronic
1074123134 10:110508139-110508161 CCTGGGGAGCAGAAATTGTGTGG - Intronic
1074475968 10:113774877-113774899 CCTGGGTCTCTGGAAGGGTCTGG - Exonic
1074983022 10:118634798-118634820 CTTGGGAAGGATGAAGGGTCTGG - Intergenic
1075007104 10:118839106-118839128 CCTGGGGAGGAGGAAGGGATGGG + Intergenic
1075205612 10:120445266-120445288 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1075563729 10:123487980-123488002 TCTGGTGAGAAGGAAGGATCTGG + Intergenic
1075704932 10:124494841-124494863 CCTGTGGAGCAGGCTGGGGCTGG + Intronic
1075709345 10:124522355-124522377 CCTGGGCAGCAGGAACGCTGTGG - Intronic
1075806143 10:125190350-125190372 CCTGGTCAGCAGGATGGGACAGG - Intergenic
1075858904 10:125656854-125656876 GCTGGGGAGCAGGGAAGGTCGGG - Intronic
1076172092 10:128327631-128327653 GCTGGGGAGGAAGCAGGGTCAGG - Intergenic
1076206603 10:128609291-128609313 CCTGGTGAGCAGGAAGTGCCTGG - Intergenic
1076384379 10:130046124-130046146 CGTGGGGCACAGGAAGGGGCAGG + Intergenic
1076504460 10:130962732-130962754 ACTGAGGAGCAGTAAGGCTCAGG + Intergenic
1076581228 10:131513351-131513373 CAGGGGGAGCTGGAAGGCTCGGG - Intergenic
1076676820 10:132151405-132151427 CCTGGGGAGCAGTGAGGCACAGG + Intronic
1076819153 10:132930234-132930256 TGTGGGGAGGAGGAAGGTTCGGG - Intronic
1076819169 10:132930292-132930314 TGTGGGGAGGAGGAAGGTTCGGG - Intronic
1076819669 10:132932046-132932068 TGTGGGGAGCAGGAAGGCCCAGG - Intronic
1076827919 10:132979307-132979329 CCTGGGTACCAGGAAGGCACAGG + Intergenic
1076889616 10:133277191-133277213 CCTGGGGAACAGAAAGCCTCAGG + Intergenic
1076905085 10:133357532-133357554 CCTGGGGAGGCGGCCGGGTCCGG - Intronic
1077081340 11:725968-725990 CCTGGGCAGAAGGAAAGGGCTGG + Intronic
1077160324 11:1109704-1109726 CCTGGGGGGTAGGCAGGGTGGGG + Intergenic
1077226823 11:1442217-1442239 GCTAGGGAGCAGGAGGGGGCAGG + Intronic
1077289574 11:1782656-1782678 ATTGGGTAGCAGGAAGGGGCAGG - Intergenic
1077296168 11:1827210-1827232 CCTGGAGAGCAGGGGGTGTCGGG - Intergenic
1077450493 11:2640136-2640158 CCTGGGAAGCACAAGGGGTCAGG - Intronic
1077474246 11:2778913-2778935 CCTGGGGGCCAGGACGGGTGGGG - Intronic
1077602116 11:3581159-3581181 CCTGGGGAAGAGGAAGGACCCGG + Intergenic
1077860920 11:6179325-6179347 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1078674822 11:13400476-13400498 CCTGGGAAGCACAAGGGGTCAGG - Intronic
1078796831 11:14600679-14600701 CCTGGGAAGCACAAGGGGTCAGG - Intronic
1078981144 11:16536509-16536531 CCTGGGAAGCACAAGGGGTCGGG + Intronic
1079029254 11:16973647-16973669 CCTGGGGATCAGTGAGGGACAGG + Intronic
1079034044 11:17007106-17007128 CCTGGGCAGCAGGGAGGAGCAGG - Intronic
1079037596 11:17034436-17034458 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1079106877 11:17577453-17577475 CCTGGGGTGGAGGAAGGGATTGG + Intronic
1079284567 11:19117241-19117263 CCTGGGGAGATGGAGGGGCCGGG + Exonic
1079353842 11:19714215-19714237 CCTGGGGAGGAGGAAAGGTCGGG + Intronic
1079391669 11:20027214-20027236 CCTGGGGAAGAGAAAGGGTTTGG - Intronic
1080291227 11:30673803-30673825 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1080749531 11:35139388-35139410 CCTGGGCAGCAAGATGGGTGCGG + Intronic
1080808856 11:35682363-35682385 CTTGGGGTGCAGGAAGGGACTGG + Intronic
1081143855 11:39536743-39536765 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1081500240 11:43659322-43659344 CCTGGGAAGCACAAGGGGTCAGG - Intronic
1081670365 11:44939017-44939039 CCTGGGGTGCCGGGAGGGGCTGG - Intronic
1081969284 11:47186705-47186727 CCGAGGGAGCAAGAAGGGACCGG + Intergenic
1081976719 11:47240037-47240059 GCTGGGGAGCAGCAACAGTCAGG + Exonic
1082232208 11:49780932-49780954 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1082575420 11:54797811-54797833 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1082577990 11:54833158-54833180 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1082586422 11:54947161-54947183 CCTGGGAAGCACAAAGGGTCAGG + Intergenic
1082636306 11:55598385-55598407 CCTGGGAAGCACAAGGGGTCTGG - Intergenic
1083191022 11:61052589-61052611 CCTGGGAAGCAACATGGGTCGGG - Intergenic
1083555492 11:63622940-63622962 ACTGGGGAGAAGGAAGGACCAGG - Intergenic
1083619863 11:64043522-64043544 TCTGGAGAGCAGCAAGGGTTAGG + Intronic
1083630823 11:64094469-64094491 GCTGGGGACAAGGAAGGGTCAGG + Intronic
1083747084 11:64742675-64742697 GCTGCGGAGCAGGGTGGGTCCGG + Intronic
1083897092 11:65625383-65625405 CCTGGGGGTGAGGAAGAGTCAGG - Exonic
1083899461 11:65636608-65636630 CCTGGGGGGCCGGAAGGGGCTGG + Exonic
1084045673 11:66566489-66566511 CCCGGGGAGCAGGTAGGGGTGGG + Intronic
1084219499 11:67668386-67668408 TCTGGAGAGGAGGAAGGATCAGG + Intronic
1084258019 11:67955714-67955736 CCTGGGGAAGAGGAAGGACCCGG + Intergenic
1084494399 11:69495684-69495706 CCTGGAGGCCAGGAAGGGTGAGG - Intergenic
1084506419 11:69571132-69571154 ACTGAGGATCAGGAGGGGTCTGG - Intergenic
1084691869 11:70732304-70732326 AATGGGCAGCAAGAAGGGTCCGG - Intronic
1084728908 11:71060563-71060585 CCTGGGGAGCAGGAAGGCAGAGG + Intronic
1084946008 11:72638913-72638935 CCTGGGGCTGAGGAAGGTTCTGG - Intronic
1084950549 11:72662919-72662941 CCTGGGCTGGAGGAAGGGCCTGG - Intronic
1085003300 11:73061192-73061214 CCTGGGAAGCACAAAGGGTCAGG + Intronic
1085297287 11:75438344-75438366 CCTGGGGATCAGGAGAGGCCTGG - Intronic
1085349851 11:75791385-75791407 CCTGAGGAGCAGGAAGGTCCCGG - Intronic
1085463785 11:76710685-76710707 CCTGGGGAGCCAGAAGTGTGAGG + Intergenic
1085529797 11:77184497-77184519 TCTGGGGAGCAGGCAGCCTCGGG + Intronic
1086520011 11:87658498-87658520 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1086548504 11:88027429-88027451 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1087072963 11:94099941-94099963 CCTGGGAAGCACAAGGGGTCAGG - Intronic
1087364230 11:97198658-97198680 CCTGGGAAGCACAAGGGGTCGGG - Intergenic
1088680881 11:112240549-112240571 GCTGGGAAGCAGGCAGGGACTGG - Intronic
1088790747 11:113224144-113224166 CCTGGGAAGCACAAGGGGTCAGG + Intronic
1089147419 11:116339899-116339921 CCTGGGCAGGAGGAAGGCTGTGG - Intergenic
1089623660 11:119737622-119737644 CTAGGGGGTCAGGAAGGGTCAGG + Intergenic
1089630014 11:119778649-119778671 CCGGGGGAGTAGAAAGGTTCTGG + Intergenic
1090722953 11:129493660-129493682 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1091045233 11:132319330-132319352 CCTGGGAAGCACAAGGGGTCAGG + Intronic
1091217222 11:133909606-133909628 ACTGGGGATCAGGAAGGAACAGG + Intronic
1091279654 11:134374729-134374751 CATGGGGAACAGGAAGGGGCTGG - Intronic
1091383790 12:79082-79104 CATGAGGAGCAGGAAGTGCCAGG - Intronic
1091628597 12:2141259-2141281 CCAGAGGAGCAGGAAGGATCTGG + Intronic
1091700432 12:2655329-2655351 CCCGGGGAGTAGGAAGGGAGAGG + Intronic
1091773990 12:3172344-3172366 CCCGGGGAGCCGGCATGGTCAGG + Intronic
1092013731 12:5139145-5139167 CCTGGAGAGCAGGAGGGAGCAGG + Intergenic
1092126720 12:6079887-6079909 GGTGGGGAGCAGGGAGGGTGAGG - Intronic
1092164736 12:6336001-6336023 CCAGGGCAACAGGAAGGGTTTGG + Intronic
1092181783 12:6451369-6451391 CAGGGGGAGCAGGCAGGCTCCGG - Exonic
1092428262 12:8390511-8390533 CCTGGGGAAGAGGAAGGACCCGG + Intergenic
1093785290 12:23185452-23185474 CCTGGGGAGAAAGAAGGGGAAGG - Intergenic
1093988490 12:25564081-25564103 CCTGGGAAGCGCGAGGGGTCAGG - Intronic
1094061159 12:26316566-26316588 CCTGGGAAGCACAGAGGGTCAGG - Intergenic
1094381529 12:29848658-29848680 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1094493529 12:30975911-30975933 CCTGTGCAGCAGGAGGGATCCGG + Intronic
1095110899 12:38294417-38294439 CCTGGGGAACAGGCAGAGACAGG + Intergenic
1095483459 12:42659297-42659319 CCTGGGAAGCATAAGGGGTCAGG - Intergenic
1095510884 12:42950455-42950477 CCTTAGGAGTGGGAAGGGTCTGG + Intergenic
1095547439 12:43388287-43388309 CCTGGGAAGCACAAGGGGTCAGG - Intronic
1095832411 12:46601842-46601864 CCTGGGAAGCACAAGGGGTCGGG - Intergenic
1095845229 12:46737167-46737189 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1095913974 12:47457728-47457750 CCTGGGAAGCATGAGGGGTAGGG - Intergenic
1096537677 12:52286002-52286024 CCTCAGGAGCAGGAAGGGCCAGG - Exonic
1096610842 12:52800458-52800480 CCTGGGGAGGAGGAATGGTAAGG + Intergenic
1096749223 12:53748114-53748136 CCAGGGGAGCAGGCAGGGAGGGG + Intergenic
1096940884 12:55344446-55344468 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1096976784 12:55703864-55703886 CATGGGGAGAAGGAAGGATGGGG - Intronic
1097635268 12:62114251-62114273 CCTGGGAAGCACAAGGGGTCAGG - Intronic
1097683944 12:62674862-62674884 CCTGGGGAGTGGGGAGGGTGAGG + Intronic
1098034312 12:66286776-66286798 TCTGGGGAGGAAGAATGGTCAGG + Intergenic
1098675919 12:73289450-73289472 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1099001110 12:77179206-77179228 CCTGGGAAGCGCGAGGGGTCAGG - Intergenic
1099087022 12:78258073-78258095 CCCGGGAAGCACAAAGGGTCAGG - Intergenic
1099267091 12:80462071-80462093 CTTGGGGAGCACAAGGGGTCAGG + Intronic
1100375174 12:94008267-94008289 CCTGGGAAGCACAAGGGGTCGGG - Intergenic
1101297019 12:103434584-103434606 CCTGGGAAGCACAAGGGGTCAGG + Intronic
1101629309 12:106477672-106477694 CCTGGGAAGCACAAGGGGTCAGG - Intronic
1102050409 12:109857752-109857774 CCTGGAGGGCAGGAAGGAGCAGG - Intronic
1102082472 12:110109619-110109641 GCTGGAGAGCAGGAAGGGGCAGG + Intergenic
1102183664 12:110931723-110931745 GCTGGGGAGGAGCAAGGGCCTGG - Intergenic
1102575026 12:113850759-113850781 CCTGAGGAGCAGAAGGGGCCAGG - Intronic
1102600483 12:114026017-114026039 CCTGGGGAGCAGCAGGGGCCAGG + Intergenic
1102619278 12:114181165-114181187 CCAGGGCTGCAGGGAGGGTCAGG - Intergenic
1102697265 12:114809535-114809557 CCTGGAGAGCAGTTTGGGTCTGG + Intergenic
1102953727 12:117046396-117046418 CCTGGGGGACAGGAAGGGCTGGG + Intronic
1103084141 12:118048944-118048966 CCCGGGTAGAAGGAAGGGCCTGG - Intronic
1103153611 12:118663830-118663852 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1103154708 12:118674538-118674560 CCTGGGAAGCATGAGGGGTTGGG - Intergenic
1103478141 12:121233381-121233403 CTTGCGGAACAGGAAGGGTTGGG + Intronic
1103841599 12:123869700-123869722 CCTGAGAAGGAGGAAGGGGCTGG - Intronic
1104204544 12:126625642-126625664 CATTGGGAGCTGGAAGGATCTGG - Intergenic
1104474705 12:129061834-129061856 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1104944286 12:132408787-132408809 CCAGGGGAGCAGGCAGGGCCTGG + Intergenic
1105296509 13:19091290-19091312 CCTGGGGAGGAGGAGGGATTTGG + Intergenic
1105311901 13:19219495-19219517 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1105405804 13:20131598-20131620 TGTGGGAAGCAGGAAGCGTCAGG + Intergenic
1105418177 13:20231382-20231404 CCTGGGGAGCAGGAAGGGTCAGG - Exonic
1106131290 13:26941694-26941716 CCTAGAGATCAGGAAGTGTCAGG + Intergenic
1106165617 13:27243324-27243346 CTCGGGGAGCAGCAAGGGTGAGG + Intergenic
1106578631 13:30999132-30999154 CATTGGGAGCAGGTAGGGACAGG + Intergenic
1106646337 13:31638355-31638377 CCTGGGAAGCACAAAGGGTCAGG - Intergenic
1106983936 13:35322358-35322380 CCTGGGAAGCACAAGGGGTCAGG - Intronic
1107047959 13:36014016-36014038 CCTGGGAAGCACAAGGGGTCAGG - Intronic
1107090531 13:36474215-36474237 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1107971285 13:45645227-45645249 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1108030158 13:46220869-46220891 CCTGGGAAGCATAAGGGGTCCGG - Intronic
1108149312 13:47515579-47515601 CCTGGGTAGAAGGTAGGGTGTGG - Intergenic
1108217655 13:48200936-48200958 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1108573098 13:51769292-51769314 ACCTGGGAGAAGGAAGGGTCAGG + Exonic
1109293672 13:60504819-60504841 CCTGGGAAGCACAAGGGGTCGGG + Intronic
1109563387 13:64078791-64078813 CCTGGGGGCCAGGAACAGTCAGG - Intergenic
1109653979 13:65366113-65366135 GATGGGGAGCTGGAAGGGTGGGG - Intergenic
1109754235 13:66737679-66737701 CCTGGGAAGCACAAGGGGTCAGG + Intronic
1110121699 13:71889731-71889753 ACTGGGGGACAGGAAGGTTCAGG + Intergenic
1110646976 13:77898382-77898404 CCTGGAGAGGAGGAAGAGTTGGG - Intronic
1111635005 13:90892575-90892597 TCTGGGAAGCATGAGGGGTCGGG + Intergenic
1111764970 13:92516890-92516912 CCTGGGAAGCACAAGGGGTCAGG + Intronic
1112756909 13:102645878-102645900 TCTGGTGAGCAGCAGGGGTCTGG + Intronic
1113240892 13:108335746-108335768 CCTGGAGGGCTGGAAGGGTGTGG + Intergenic
1113276961 13:108741063-108741085 CCTGGGAAGCACAAGGGGTCAGG - Intronic
1113575653 13:111393560-111393582 CCTGGGGAGAAGGAATGGCTGGG + Intergenic
1113586808 13:111471413-111471435 CCTGGGGTGCTGGAAGCCTCTGG + Intergenic
1113600722 13:111566450-111566472 CCTGGAGAGCAGAAAGGGCCTGG + Intergenic
1113733372 13:112657891-112657913 CATGGGGAGGAGGTAGGGACGGG + Intronic
1113754250 13:112798536-112798558 CCTGGGGGGCAAGAAGGAACTGG + Intronic
1113796369 13:113061078-113061100 CCTGGGGTGCAGGCAGGGCCTGG - Intronic
1113799784 13:113080410-113080432 ACTGGGGAGCAAGAGGGCTCTGG - Intronic
1113847265 13:113399477-113399499 CCTGGGCAGGAGGGAGGGTCTGG - Intergenic
1114240235 14:20860309-20860331 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1114341874 14:21753955-21753977 TCTGGGAAGCAGAAGGGGTCAGG + Intergenic
1114433714 14:22685903-22685925 CCTGGGAAGCACAACGGGTCAGG + Intergenic
1114553288 14:23546612-23546634 CCTGGGGAGGAGGGATGGGCAGG + Intronic
1115359884 14:32488772-32488794 CCTGGGAAGCACAAGGGGTCAGG - Intronic
1116482757 14:45411587-45411609 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1116921223 14:50577658-50577680 GCTGGGGAGTAGGAAGGGTATGG - Intronic
1117172751 14:53117350-53117372 CCCAGGAAGCAGAAAGGGTCAGG + Intronic
1117871456 14:60205208-60205230 TCTGGGGATCAGGAAGGGAGAGG + Intergenic
1118094473 14:62521288-62521310 CCTGGGAAGCCCAAAGGGTCAGG + Intergenic
1118837664 14:69488031-69488053 CCTGGGGAGGAGAAGGGGTGAGG - Intronic
1119396108 14:74327442-74327464 CCTGCGGATCAGGAAAGGGCAGG - Intronic
1119476859 14:74935324-74935346 CCTCAGGAAAAGGAAGGGTCCGG + Intergenic
1119841232 14:77794650-77794672 TCTGGGGAGCCAGGAGGGTCAGG + Intergenic
1120200443 14:81533328-81533350 CCTGGGGTAGAGGAAGGGTCTGG - Intronic
1120273819 14:82347746-82347768 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1120709802 14:87781379-87781401 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1120780191 14:88479712-88479734 CCTGGGGGGCGGGTAGGGTGGGG + Exonic
1121014308 14:90539100-90539122 ACTGGGGAGCTGGAGGGCTCTGG + Exonic
1121288147 14:92752545-92752567 CCTGGGTGGCAGGAAGGGGGAGG + Intergenic
1121517310 14:94561199-94561221 CTCGGGGAGCAGCAAGGGCCAGG + Exonic
1121643130 14:95499724-95499746 GCTGGGGAGAAGAAAGGGGCAGG - Intergenic
1122038288 14:98964274-98964296 CCTGGCCACCAGGAAGGATCTGG + Intergenic
1122267612 14:100554047-100554069 TCAGGGGAGCAGGAAGGGCATGG - Intronic
1122348231 14:101073460-101073482 GCGGTGGAGCAGGAAGGCTCTGG - Intergenic
1122957305 14:105076699-105076721 GCAGGGGAGCAGGAGGGCTCAGG + Intergenic
1123012606 14:105356598-105356620 CCTGTGGAGCAGGAGGGTCCAGG + Intronic
1202846700 14_GL000009v2_random:183767-183789 CCTGGGAAGCACTAGGGGTCAGG - Intergenic
1202916162 14_GL000194v1_random:174368-174390 CCTGGGAAGCACAATGGGTCAGG - Intergenic
1123689277 15:22823581-22823603 CCTGGGGAGCATGTGGGCTCTGG - Intronic
1123708153 15:22965764-22965786 CCAGGGCAGCGGGAAGGGGCTGG - Intronic
1123822328 15:24043392-24043414 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1124155805 15:27224419-27224441 CCTGGGTAGCTGTGAGGGTCAGG - Intronic
1124257915 15:28160662-28160684 CCTGGGAAGCACAAGGGGTCAGG - Intronic
1124340200 15:28885682-28885704 GCTGGGGAGCTGCAGGGGTCTGG - Intronic
1125055730 15:35357212-35357234 CCTGGGAAGCACAAGGGGTCAGG - Intronic
1125984688 15:44038734-44038756 CCCGGGAAGCACGAGGGGTCAGG + Intronic
1126239457 15:46425120-46425142 CCTGGGGAGCACAAGGGGTCAGG + Intergenic
1126567270 15:50113219-50113241 CCTGAGGAGCAGGTAGGATTGGG + Intronic
1126696538 15:51330563-51330585 CCTGGGCAACAGGCAGGGTTTGG + Intronic
1126965426 15:54047409-54047431 GGTGGGGAGAAGGAAGGGTAGGG - Intronic
1127027828 15:54827616-54827638 GCTGGAGAGCAGCAAGGGCCTGG - Intergenic
1127985848 15:64069837-64069859 CCTTTGGAGGAGGAAGGGGCAGG - Intronic
1128053260 15:64681865-64681887 CCTGAGGAAGAGGTAGGGTCAGG - Exonic
1128699475 15:69793871-69793893 TCTTGGGTGCAGGAGGGGTCAGG + Intergenic
1128705959 15:69837617-69837639 CCTGGGATGCTGGAGGGGTCAGG + Intergenic
1128782183 15:70367894-70367916 CCCGGGAAGCACAAAGGGTCAGG + Intergenic
1128944581 15:71811932-71811954 CTGGGGAGGCAGGAAGGGTCAGG - Intronic
1129193418 15:73951003-73951025 CCTGAGGAGCAGGAATGTGCTGG - Intronic
1129761442 15:78131341-78131363 GCTGCGGGGCGGGAAGGGTCCGG - Exonic
1129788889 15:78327534-78327556 CTTGGGAACCAGGAAGGGACTGG - Intergenic
1130089199 15:80805315-80805337 CCGGGCGGGCAGGAAGGGGCAGG - Intronic
1131025532 15:89138114-89138136 CCTGTGGAGCAGGGAGGCTCTGG + Intronic
1131977825 15:97963097-97963119 ACTGGGGCTCAGGAAGGGTGAGG - Intronic
1132497940 16:272695-272717 CCTGGGGAACAGGGAGTGACCGG + Intronic
1132498063 16:273179-273201 CCTCGGGAGCAGGCAGAGTGGGG - Intronic
1132687563 16:1168701-1168723 CCTGGGACTCTGGAAGGGTCTGG - Intronic
1132738072 16:1397295-1397317 CCTGGGGATGAGGAGGTGTCAGG + Intronic
1132738102 16:1397382-1397404 CCTGGGGATGAGGAGGTGTCAGG + Intronic
1132738129 16:1397469-1397491 CCTGGGGATGAGGAGGTGTCAGG + Intronic
1132738156 16:1397556-1397578 CCTGGGGATGAGGAGGTGTCAGG + Intronic
1132738185 16:1397643-1397665 CCTGGGGATGAGGAGGTGTCAGG + Intronic
1132738214 16:1397730-1397752 CCTGGGGATGAGGAGGTGTCAGG + Intronic
1132738243 16:1397817-1397839 CCTGGGGATGAGGAGGTGTCAGG + Intronic
1132785601 16:1655639-1655661 TGTGGGGAGCAGGCAGGGCCGGG - Intronic
1132997348 16:2830201-2830223 CCAGGGGAACAGGAAGGAGCTGG - Exonic
1133015139 16:2936370-2936392 CATGTGGAGCAGGGAGGCTCGGG - Intronic
1133374334 16:5271747-5271769 GCTGGGGCGCAGGAAAGGTAGGG - Intergenic
1133460609 16:5983572-5983594 CCTGGGCAGGAGGATGGCTCAGG + Intergenic
1133598314 16:7314103-7314125 CTTGGGGAGGAGGAAGGGAGAGG + Intronic
1134202074 16:12207519-12207541 GCGGTGGAACAGGAAGGGTCGGG - Intronic
1134663988 16:16005100-16005122 TCTGTGGAGCTGTAAGGGTCTGG + Intronic
1134828929 16:17307749-17307771 CCTGGGGTGCAGGAAGGCCCTGG - Intronic
1135807487 16:25556021-25556043 CCTGGGAAGCACAAGGGGTCGGG + Intergenic
1135932990 16:26755136-26755158 CCTGGGGAGCAGGAAAGTTCTGG - Intergenic
1136372695 16:29846136-29846158 GCTGGGGAGAAGGCAGAGTCAGG - Exonic
1136381343 16:29897273-29897295 CCTTGGGAGGAGGTAGGGGCTGG - Intronic
1136403409 16:30030468-30030490 CTTGGAGAGGAGGAAGAGTCCGG + Exonic
1136411866 16:30082462-30082484 CCTGGGGAACAGGAAGAGTGGGG - Exonic
1136539822 16:30923197-30923219 CCTGGGAAGGAGGTCGGGTCGGG + Intronic
1136541282 16:30928698-30928720 CAAGGTGAGCAGGAAGGGACAGG - Intronic
1136908935 16:34130058-34130080 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1136991867 16:35157587-35157609 CCTGGGAAGCATAAGGGGTCAGG + Intergenic
1136998311 16:35207082-35207104 CCTGGGAAGCAGCCTGGGTCGGG + Intergenic
1137249168 16:46730158-46730180 CCTGGGGTGCAGGATGGCCCAGG - Intronic
1137449251 16:48555393-48555415 CCTTGAGAGCAGGAAGAGGCTGG + Intronic
1137564510 16:49524792-49524814 TCTGGGCAGCAGGAGGGGGCCGG + Intronic
1137575978 16:49600648-49600670 CGTGGGGAGCAGGAAGGAGCCGG + Intronic
1137585305 16:49660699-49660721 CCAGGGAAGCAGCAAGGGTGTGG + Intronic
1137669785 16:50272318-50272340 CCTGGAGGGCAGGAAGAGCCTGG - Intronic
1138442302 16:57042390-57042412 CCTGGGGTGCCGGGAGGGGCTGG + Intronic
1138940308 16:61782272-61782294 CCTGGGAAGCACAAGGGGTCAGG + Intronic
1139470007 16:67173389-67173411 TCAGGGGACCAGGAAGGGCCAGG + Intronic
1139569885 16:67805310-67805332 GCTGGGGAGCCGCATGGGTCTGG - Intronic
1139902961 16:70342536-70342558 CCTTGGGAACAGGAAGGATTAGG - Intronic
1139956795 16:70697082-70697104 TCTGAGGGGCAGGAAGGGGCCGG - Intronic
1140343072 16:74184464-74184486 CCTGGGGAGGAGGCAGAGGCAGG + Intergenic
1140869928 16:79096897-79096919 TCTGGGGAGAAGAAAGGATCAGG + Intronic
1141694791 16:85614182-85614204 CAGGCGGAGCAGGAAGGGCCGGG - Intronic
1142080692 16:88147233-88147255 CCTGGGAAGCTGGAAAGGTGGGG + Intergenic
1142139098 16:88464673-88464695 CCTGTAGAGCTGGAAGGGTATGG - Intronic
1142200297 16:88757880-88757902 CCCAGGAGGCAGGAAGGGTCTGG + Intronic
1142271258 16:89090732-89090754 TCTGGTGAGCAGGAAGGGGAGGG - Intronic
1142324347 16:89404721-89404743 CCTGGAGAACAGGCAGGGACAGG + Intronic
1142521020 17:504531-504553 CTTTGAGAGAAGGAAGGGTCAGG + Intergenic
1142521027 17:504589-504611 CTTCGAGAGAAGGAAGGGTCAGG + Intergenic
1142560413 17:806129-806151 CCTGGGGAGCGGGGAGGGCTGGG - Intronic
1142965327 17:3577387-3577409 CCTGGTGTGCAGGGGGGGTCAGG + Intronic
1143646282 17:8232307-8232329 TCTGGGGGGAAGGAAGGGCCTGG - Intronic
1143784903 17:9248842-9248864 CGAGGGGACCAGGAAGTGTCTGG - Intergenic
1143818697 17:9541928-9541950 CCTGGGCAGCAGTAAGGCTGGGG - Intronic
1143904309 17:10197608-10197630 CCAGGGGAGCAGGCAGTGGCGGG + Intronic
1144777631 17:17792780-17792802 GCGGGGGAGCAGGCAGGGTGGGG + Intronic
1145001077 17:19304990-19305012 CCTGTGGAGAAGGCAGGGTGAGG - Intronic
1145028575 17:19487550-19487572 CCGGGAAAGCTGGAAGGGTCTGG + Intergenic
1146123057 17:30211609-30211631 CCTGGGAGGCAGGAAGGGTGGGG + Intronic
1146674963 17:34767138-34767160 GTTGGGGAGCCGGAAGGGACAGG - Intergenic
1147530783 17:41275344-41275366 CCTGGTGACCAGGGAGGCTCAGG - Intergenic
1147563241 17:41521617-41521639 CCTGGGGAACAGGAGAGGTGTGG - Exonic
1148052498 17:44776015-44776037 CCTGGGGAGCTGGAGGGCCCGGG + Intronic
1148123399 17:45224957-45224979 CCTGGGAGGCACGCAGGGTCAGG + Intronic
1148332384 17:46820236-46820258 CCTCGGGGGCACCAAGGGTCGGG + Intronic
1148701170 17:49587857-49587879 CCTGGGGCGCAGTGAGGGGCAGG + Intergenic
1148795570 17:50195151-50195173 TCTGGGGAGCAGGAAGACGCAGG - Intronic
1149194388 17:54102311-54102333 CTTGGGGAGCAGGAAGAGACAGG + Intergenic
1149304707 17:55336271-55336293 CCTGGGGAGCAGGGGGTGGCTGG - Intergenic
1149427709 17:56570682-56570704 CCCAGGGAGCTGGAAGGGTATGG - Intergenic
1149519778 17:57309981-57310003 GCTGGGGAGTATGAAGGGTTTGG + Intronic
1150568997 17:66369371-66369393 CCTGGGGAGGAGGAGGGACCTGG + Intronic
1151304133 17:73252087-73252109 CCTGGGGAGCAGAAAGGAGTGGG + Intronic
1151657957 17:75504405-75504427 CCTGGCAGGTAGGAAGGGTCAGG - Exonic
1151854348 17:76710660-76710682 CCGGGGGAGCCCGAAGGGCCAGG - Exonic
1152191695 17:78892066-78892088 GCTGGGGAGGAGGACGGGCCAGG - Exonic
1152209173 17:78994045-78994067 CCTGGAGAGCAGGGAGGGGCGGG - Intronic
1152228266 17:79102564-79102586 CCTGGGGAGCAGGGAAGGAGGGG + Intronic
1152253942 17:79226564-79226586 CCTGTGGAGCAGGAGGAGCCTGG + Intronic
1152364105 17:79845092-79845114 CGTGGGGAGGGGGAAGGGACGGG - Intergenic
1152526967 17:80893875-80893897 CCTCGGAAGCAGAAAGGGGCAGG - Intronic
1152676727 17:81645148-81645170 CCTGGGGAGAGGGAAGGGGCTGG - Exonic
1152699858 17:81813452-81813474 CCTGGGGAGGGGGACGGGGCAGG - Exonic
1152855531 17:82663163-82663185 GCTGTGCAGCAGGAAGGGTCGGG + Intronic
1152868040 17:82735823-82735845 CCTGGGAAGGCGGAGGGGTCGGG + Intronic
1152876693 17:82790436-82790458 CCTCGGAAGCAGGAGGGCTCAGG + Intronic
1152979240 18:258674-258696 ACTGGGGAGGCGGAAGGCTCTGG + Intronic
1153565503 18:6414414-6414436 CCGGGGGAGCGGGACGGGACGGG - Intronic
1153593479 18:6700006-6700028 CCTGGGAAGCATAAGGGGTCAGG + Intergenic
1153632609 18:7086473-7086495 CCTGGGGTTCAGGAAAGATCTGG - Intronic
1153822060 18:8840527-8840549 CCTGGGGAGCAGGTAGGTCGTGG - Intergenic
1153966817 18:10189968-10189990 GATGGGGAGCAGGAAGAGACTGG + Intergenic
1153983720 18:10334505-10334527 CCTGCCGAGTAGGAAGGGACTGG - Intergenic
1154156929 18:11951136-11951158 GCTGGGGAGCAGGCCAGGTCAGG + Intergenic
1155114151 18:22748490-22748512 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1155294324 18:24371508-24371530 CCTGAGAAGCAGGAAGGGATGGG - Intronic
1155852063 18:30786397-30786419 GCTGGGGGGCAGGAAGGGAGTGG - Intergenic
1156044514 18:32862466-32862488 CCTGGGAAGCGCAAAGGGTCAGG - Intergenic
1156434432 18:37111733-37111755 CCTGGGAAGCACAAGGGGTCGGG + Intronic
1156468469 18:37362600-37362622 CCTGGGGAGCAGGCTTGCTCTGG + Intronic
1156908382 18:42381687-42381709 CCTGGGAAGCATAAGGGGTCAGG - Intergenic
1156952340 18:42917717-42917739 GCTGGTGAGGAGGCAGGGTCAGG - Intronic
1157152944 18:45237581-45237603 CTTGGGCAGCAGAAAGGCTCAGG - Intronic
1157281871 18:46351567-46351589 CCTGCTTAGCAGGAAGGGGCTGG - Intronic
1157298215 18:46461133-46461155 ACTGGGGAGCCGGGAGGCTCAGG + Exonic
1157395784 18:47339772-47339794 TCAGGGGTTCAGGAAGGGTCAGG + Intergenic
1157607579 18:48935534-48935556 CCAGGGGCCCAGGAAGGGTCTGG + Intronic
1157630826 18:49093439-49093461 CCTGGGGAGGAAGAAGGATGTGG + Intronic
1157787968 18:50503019-50503041 CCTGGGAAGCACAAGGGGTCGGG - Intergenic
1158101435 18:53834294-53834316 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1158220544 18:55146262-55146284 CCTGGGGAGGAGGTGGGGGCTGG - Intergenic
1159810851 18:73016632-73016654 CCTGGGAAGCACAAGGGGTCGGG + Intergenic
1159961275 18:74557462-74557484 CCTGGGGAGCAGGAGGAGACAGG + Intronic
1160295965 18:77637296-77637318 CCTGGGAAGCACAAGGGGTCGGG + Intergenic
1160318662 18:77870254-77870276 TGTGTGGAGCAGGAAGGATCAGG - Intergenic
1160749154 19:725908-725930 CCTAGCGACCAGGAAGGGTTTGG - Intronic
1160907178 19:1456831-1456853 CCTGGGGGGAGGGCAGGGTCAGG - Exonic
1160938436 19:1608914-1608936 ACTTCGGAGCAGGAAGGGGCAGG + Intergenic
1160997246 19:1888483-1888505 TCTGGGGAGGAGGAAGGGATGGG - Intergenic
1161395510 19:4043078-4043100 CAGGAAGAGCAGGAAGGGTCGGG + Intergenic
1161550166 19:4908499-4908521 TCCAGGGAGCAGGAAGGGGCTGG - Intronic
1161582978 19:5090846-5090868 CCTGGTGGGCAGGGAGGGTGTGG - Intronic
1162034053 19:7929732-7929754 CCTGGGGTGCAGGCTGGGGCCGG - Intronic
1162127428 19:8506962-8506984 CCTGGGGAGGAGGGTGGGACAGG - Intergenic
1162393842 19:10404988-10405010 CCTGGGGGGCGGGAGGGGACGGG - Intronic
1162740878 19:12772912-12772934 CCTGGGGAGAAGGGGGTGTCAGG + Exonic
1162784004 19:13022970-13022992 CCGGGCGAGCAGGGAGGGTGGGG - Intronic
1163029849 19:14537085-14537107 CCTGAGGAGGAGGAGGGGGCAGG + Intronic
1163229202 19:15988505-15988527 CCTGGAGAAAAGGAAGGGTGTGG + Intergenic
1163430166 19:17262694-17262716 CTTGGGAAGCAGGAAGGGGCAGG - Exonic
1163640715 19:18460547-18460569 CCTTGGGAGCAGGATGGGGGTGG + Intronic
1163659306 19:18567305-18567327 CCTGGGGTGGGGGCAGGGTCAGG + Intronic
1163674700 19:18649744-18649766 GGTGGGGGGCAGGAAGGGACTGG - Intronic
1163719830 19:18893813-18893835 CGAGGGGAGCAGGAGGGCTCTGG + Intronic
1163845261 19:19634995-19635017 TCTGGGGATGATGAAGGGTCAGG + Intronic
1164248657 19:23457668-23457690 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1164377502 19:27701369-27701391 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1165094949 19:33405211-33405233 CATGGGGCCCAGGGAGGGTCTGG - Intronic
1165434592 19:35789074-35789096 CCTGGGGAGCAGTGAGGCACAGG + Intergenic
1165450364 19:35878867-35878889 CTGGGGGAGCAGGAGGTGTCAGG - Intronic
1165886664 19:39083991-39084013 CCTGGGGATCGGGCAGGGCCAGG + Intronic
1166007530 19:39917678-39917700 CCTGGGGAGCAGGGGTGGTCAGG - Intronic
1166046272 19:40232853-40232875 CCTGGGGAGAGGGAGGGGTGAGG + Exonic
1166057895 19:40304302-40304324 CCTGGGGAACAGCAAGGGCAGGG + Intergenic
1166136128 19:40778265-40778287 CCCGGGGAGTAGGAAGGAGCCGG + Exonic
1166193802 19:41193530-41193552 CCTAGGGAGGAGGCAGGGGCAGG + Intronic
1166310198 19:41958479-41958501 CCTGGAGACCAGGGAGGGCCAGG + Intronic
1166316652 19:41993218-41993240 CCAGGGCTGCAGCAAGGGTCAGG + Intronic
1166656094 19:44613225-44613247 CCTGGGGAGTGAGAAGGGTGAGG + Intergenic
1166782601 19:45350319-45350341 CCTGCGGAGAAGGGAGTGTCTGG - Exonic
1166895252 19:46018534-46018556 CCTGGGGAGAGGGCAGGGTCAGG - Exonic
1167270246 19:48502144-48502166 CCAGGGGAGGGGGAGGGGTCAGG - Intronic
1168056077 19:53866133-53866155 CCTACGGAGCAGGGAGGGGCCGG - Intergenic
1168107057 19:54172083-54172105 CCTGGGGAGGAGCAGGGGGCTGG + Exonic
1168243616 19:55099095-55099117 CCTGGGGGCCAGGGAGGCTCAGG + Exonic
1168369789 19:55822596-55822618 CCTGGGAAGCGCGAGGGGTCAGG + Intronic
1168438016 19:56337512-56337534 CCTGGGAAGCACAAGGGGTCAGG - Intronic
1168604891 19:57750703-57750725 CCTTGGGAGGAGGAAGGGCAAGG + Intronic
1202674051 1_KI270710v1_random:24140-24162 CCTGGGAAGCACAATGGGTCAGG - Intergenic
925150415 2:1611395-1611417 CCTGGGGAGGAGGAAGGATGAGG + Intergenic
925150532 2:1611865-1611887 CCTGGGGAGGAGGAAGGATGAGG + Intergenic
925350054 2:3194717-3194739 CCATGGAAGCAGGAAGGGGCCGG + Intronic
925719958 2:6817493-6817515 CCTGGCTGGCAGGGAGGGTCTGG + Intergenic
925977161 2:9149580-9149602 ACTGGGGGGCAGGAAGGAGCTGG - Intergenic
926507919 2:13739066-13739088 CTTGGGAAGCACAAAGGGTCAGG - Intergenic
926917765 2:17909387-17909409 CCTGGGAAGAACAAAGGGTCAGG - Intronic
926970670 2:18464129-18464151 CCTGGGAAGCGCAAAGGGTCGGG - Intergenic
927333743 2:21896342-21896364 CCTGGGGAGGGGGAAGGTTGGGG + Intergenic
927685038 2:25164667-25164689 CCTGGAGAGCAGCCAGTGTCAGG - Exonic
929038832 2:37723354-37723376 CCTGGGAAGCACAAGGGGTCAGG + Intronic
929174440 2:38961962-38961984 CCAGAGGAACAGGAAGGGGCGGG + Intronic
929574490 2:43043306-43043328 CCTGGGGGGCAGGAAGGGCCTGG - Intergenic
929831756 2:45352667-45352689 CCTGTGCAGCTGGGAGGGTCTGG + Intergenic
930143129 2:47973701-47973723 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
930911718 2:56637173-56637195 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
931044821 2:58340187-58340209 CCTGGAGAGCAGGATGGGGTGGG + Intergenic
931204695 2:60136143-60136165 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
931594473 2:63926692-63926714 CCTGGGAAGCACAAGGGGTCGGG + Intronic
932291249 2:70581876-70581898 ACTGGTGAGGAGGAAGGGTGGGG - Intergenic
932422034 2:71606839-71606861 CCTGGGGAGGACCCAGGGTCAGG + Intronic
932782338 2:74568399-74568421 CCTCTGGAGAAGGAAGAGTCCGG + Intronic
934556201 2:95288339-95288361 CCTGGAGAGCAGGAAGGCTCCGG - Intronic
934612827 2:95753506-95753528 CCCGGGAAGCAGGATAGGTCAGG + Intergenic
934648081 2:96070916-96070938 CCCGGGAAGCAGGATAGGTCAGG - Intergenic
934716824 2:96549467-96549489 CCTGGGGTGCAGGCAGGGAGGGG + Intronic
934841456 2:97626739-97626761 CCCGGGAAGCAGGATAGGTCAGG - Intergenic
934843320 2:97645494-97645516 CCTGGGGAGGAGGACAGGGCCGG - Intergenic
934857791 2:97739676-97739698 GCTGGGGAGCAGGGAGGTCCGGG + Exonic
935225272 2:101047251-101047273 CCCTGGGAGCAGGGAGGGTAGGG - Intronic
935359616 2:102236353-102236375 CATGGGGAGCAGGGTGGGTTAGG + Intronic
935551903 2:104466716-104466738 CCTGGTGAGCAGGGAGGATGTGG - Intergenic
935561385 2:104563575-104563597 CCTGGGGGAGAGGAGGGGTCAGG + Intergenic
935586102 2:104801520-104801542 CCTCGGGAGCAAGAAGGAGCTGG + Intergenic
935669905 2:105546303-105546325 TTTGGGGAGCAGGAAGGATTGGG - Intergenic
935763750 2:106344480-106344502 CCCGGGGACCAGGAGGGGGCTGG - Intergenic
935938170 2:108209062-108209084 CCTGGGCAGCACAAGGGGTCAGG - Intergenic
936155367 2:110043349-110043371 CCTGAGGATTAGGAAGGGTGGGG - Intergenic
936157914 2:110061202-110061224 CCTGGGGATCGGGAATGGTATGG - Intergenic
936186778 2:110310245-110310267 CCTGGGGATCGGGAATGGTATGG + Intergenic
936189313 2:110328064-110328086 CCTGAGGATTAGGAAGGGTGGGG + Intergenic
936389671 2:112059769-112059791 CCTGAGGATCAGGAGGGCTCTGG - Intronic
936457487 2:112686527-112686549 TGTGGGGAGCAGGAAGGCTTGGG - Intergenic
937145169 2:119638452-119638474 CCTGGGCTGCAGGGAGGGGCAGG + Intronic
937465094 2:122125407-122125429 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
937575708 2:123418947-123418969 CCTAGAGAGCAGGAAGGCACAGG + Intergenic
937981744 2:127619861-127619883 CCGTGGGAGTAGGAATGGTCAGG + Intronic
938219139 2:129550607-129550629 CTTGGGGAGCAGGGATGGGCAGG + Intergenic
938370205 2:130763701-130763723 GCTGGGGGGCAGGGAGGGCCTGG + Exonic
938408404 2:131045281-131045303 CCTGGGCACCAGGAAGGTGCAGG + Intronic
938626014 2:133110457-133110479 ACTGGGGAGGAGGGAGAGTCAGG + Intronic
938651570 2:133388965-133388987 CCTGGGAAGCGCAAAGGGTCAGG - Intronic
938718431 2:134042952-134042974 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
938788574 2:134656356-134656378 CCTGGGAAGCGCGAGGGGTCAGG - Intronic
939055523 2:137360420-137360442 CCTGGGAAGCAGGAGGGGTTGGG + Intronic
939074924 2:137588263-137588285 CCTGGGAAGCATAAGGGGTCAGG - Intronic
940009418 2:149038645-149038667 CCTGGGGCGCGGGAGGGGGCCGG - Exonic
940640006 2:156334689-156334711 GCTGGGGAGAAGGAAGGGGGTGG + Intronic
940745824 2:157566544-157566566 CCTGGGAAGCACAAGGGGTCAGG + Intronic
940809136 2:158223029-158223051 CCTGGGAAGCACAAGGGGTCAGG + Intronic
941104856 2:161341040-161341062 CCGGGGGAGCCCGAAGGGCCAGG - Intronic
941373988 2:164705079-164705101 CCTGTGAAGCAGGAAGAGTGAGG - Exonic
941659554 2:168181831-168181853 TCTGGGGAGCAGGAAGTGGTAGG + Intronic
941890843 2:170579767-170579789 CCTTGGGAGCTGGGAGGCTCTGG - Intronic
942107567 2:172648544-172648566 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
942790757 2:179757891-179757913 CCTGGGAAGCACAAGGGGTCAGG - Intronic
943125252 2:183788822-183788844 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
943350646 2:186792894-186792916 CCTGGGAAGTACAAAGGGTCAGG + Intergenic
943409719 2:187532460-187532482 CCTGGGAAGCACAAGGGGTCAGG + Intronic
943749945 2:191500823-191500845 CCTGAGGAGCCCTAAGGGTCTGG - Intergenic
944033910 2:195269644-195269666 CCTGGGAAGCACAAGGGGTCGGG - Intergenic
944353968 2:198763145-198763167 CTTGGGGACAAAGAAGGGTCTGG + Intergenic
944565067 2:200981557-200981579 CCTGGCCAGCAGGCAGGCTCAGG + Exonic
945602721 2:211888732-211888754 CCTGGGAAGCGCGAGGGGTCAGG + Intronic
945614910 2:212055012-212055034 CCCGGGAAGCATAAAGGGTCAGG + Intronic
945733842 2:213573046-213573068 CCTGGGAAGCGCGAGGGGTCAGG - Intronic
946313273 2:218894636-218894658 CCCGGGGAGCAGGTGGGGCCAGG + Intronic
946366992 2:219254402-219254424 GCCGGGGACCAGGAAGCGTCAGG - Intronic
946545856 2:220742381-220742403 CCTGGGAAGCGCGAGGGGTCAGG - Intergenic
946808028 2:223491761-223491783 ACGGGGCAGCAGGAAGAGTCTGG - Intergenic
946912914 2:224485013-224485035 CCTGGGAAGCACAAGGGGTCAGG + Intronic
947056211 2:226107451-226107473 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
947145407 2:227059536-227059558 CCTGGTGAGCCGGGAGGGCCTGG + Exonic
947278875 2:228425810-228425832 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
947310511 2:228796658-228796680 CTTGGGGAGCAGGAAAGGGTCGG - Intergenic
947472907 2:230414605-230414627 TCTGGGCAGCAGGCAGGCTCAGG - Intergenic
947571459 2:231238902-231238924 CCTGGGGAGCTGGAAAGGGCTGG - Intronic
947636309 2:231682343-231682365 CCTGGGGATTAGGAAGAGGCAGG - Intergenic
948092234 2:235303910-235303932 CCTGGGGAGAAGGTGGCGTCCGG - Intergenic
948559163 2:238839262-238839284 TCTGGGGAGCAGGAAGTTTCAGG + Intergenic
1168876160 20:1173698-1173720 CCTGGGCAGGGGGAAGGGTGTGG + Intronic
1169093962 20:2879458-2879480 CATGGTGAGCAGGAAGGGGCAGG + Intronic
1169277729 20:4244731-4244753 CATTTGGAGCAGGAGGGGTCTGG - Intronic
1171224090 20:23426304-23426326 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1171290936 20:23982454-23982476 CCTGGGCAGCAGGAACAGTGGGG + Intergenic
1171365160 20:24618044-24618066 CCCGGGAAGCAGGAAGAGCCGGG + Intronic
1171772094 20:29330682-29330704 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1171904405 20:30888811-30888833 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1172169000 20:32917562-32917584 CCTGTGGGGCAGGGAGGGTGGGG + Intronic
1172269530 20:33646332-33646354 GATGGAGAGCAGGAGGGGTCGGG - Exonic
1172272122 20:33660542-33660564 CCTGATGGGCAGGGAGGGTCTGG + Intronic
1172527666 20:35610080-35610102 CCCTGAGAGCAGAAAGGGTCAGG + Intergenic
1172781126 20:37437606-37437628 GCTGGGGAGCAGGCAGGGCAGGG - Intergenic
1173846924 20:46194087-46194109 CCTGAGGAGCAGGGAGAGACTGG - Intronic
1174538477 20:51271073-51271095 GCTGAGGAGCAAGAAGGGTGGGG - Intergenic
1174569690 20:51492686-51492708 CTTGGGGAGCAGGAGGCGGCCGG + Intronic
1175384597 20:58586257-58586279 CATGATGAGCAGGAAGTGTCTGG + Intergenic
1176085043 20:63292090-63292112 CCAGAGCAGCAGGCAGGGTCGGG + Intergenic
1176112659 20:63417658-63417680 CGTGCGGGCCAGGAAGGGTCAGG + Intronic
1176168586 20:63687086-63687108 CCTGGGGAGGAGGCTGAGTCTGG - Intronic
1176177757 20:63736724-63736746 CCTGGGGGGCAGCTGGGGTCTGG + Intronic
1176635513 21:9189014-9189036 CCTGGGAAGCACAATGGGTCAGG - Intergenic
1179484298 21:41699848-41699870 CCTGGGCTGCATGAAGAGTCAGG + Intergenic
1179608783 21:42535570-42535592 CCAGGTAACCAGGAAGGGTCTGG - Intronic
1179635001 21:42703232-42703254 CATGAGGAGCAGGCAGAGTCAGG + Intronic
1180317508 22:11288499-11288521 CCTGGGAAGCACAAGGGGTCTGG + Intergenic
1180337826 22:11594952-11594974 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1180371083 22:12037288-12037310 CCTGGGAAGCACAATGGGTCAGG - Intergenic
1180705723 22:17808637-17808659 GCTGTGGAGCAGGATGGGCCTGG + Intronic
1180871804 22:19150609-19150631 TCTGGGGAGCTGCCAGGGTCGGG - Intergenic
1181514947 22:23405011-23405033 CCTGGGGATCAGGAATGAGCTGG + Intergenic
1181518938 22:23434369-23434391 CGCGGCGAGCAGGCAGGGTCTGG + Intergenic
1182122637 22:27797596-27797618 CCAGGGCAGCAGCAAGCGTCAGG - Exonic
1182619971 22:31613551-31613573 TGTGGGGAGCAGGCAGGGTGTGG + Intronic
1182746046 22:32606193-32606215 CCTTGGAAGCAGGAAGGGAAGGG + Intronic
1183137155 22:35900042-35900064 TCTGGTGGGCAGAAAGGGTCTGG + Intronic
1183259619 22:36786024-36786046 CCTGGAGGGAAGGAAGGGTCAGG - Intergenic
1184106148 22:42368594-42368616 GCTGGCGGGGAGGAAGGGTCTGG - Intergenic
1184380165 22:44140390-44140412 CTAGGGGAGCAGGAGGGGCCTGG + Intronic
1184642267 22:45878980-45879002 CCTGGGGAGCTGAATGGGGCTGG + Intergenic
1184728386 22:46358976-46358998 ACTGGGGAGAAGGCAGGCTCAGG - Intergenic
1185087222 22:48747334-48747356 CTTGGGGTGCAGGAAGCGTTGGG + Intronic
1185182786 22:49372772-49372794 CCTGGTATGCAGGAAGGGCCTGG + Intergenic
1185280689 22:49968674-49968696 CCTGGCCAGGAGGATGGGTCTGG - Intergenic
1185385850 22:50531058-50531080 CCTGGGGAGGAGGCAGGGCTCGG + Exonic
949457356 3:4253445-4253467 CCTGGGAAGCACAAGGGGTCAGG + Intronic
950029116 3:9840360-9840382 TATTGGGAGCAGGGAGGGTCTGG - Intronic
950386163 3:12662601-12662623 CCTGGGGTGCAGGAAGGAAATGG - Intronic
950580864 3:13861281-13861303 CCTGGGCAGGAGGGAGGGGCAGG - Intronic
950674002 3:14543813-14543835 CCTGGGGACATGGAAGTGTCAGG - Intergenic
950790498 3:15467793-15467815 TCTGGGGAGCAGGCAGGCTTGGG + Intronic
950798491 3:15530650-15530672 GCTGGGGAGAAGGAGGTGTCAGG - Intergenic
952632246 3:35483051-35483073 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
952837756 3:37618891-37618913 CCTGGGAAGCACAAGGGGTCAGG - Intronic
952853594 3:37749467-37749489 GCTGGGGAGCAGGAAGAATAGGG - Intronic
953456830 3:43049018-43049040 CCTGGGAAGCCTGAAGAGTCAGG + Intronic
953493736 3:43369577-43369599 CCAGGGGAACAGGAGGGGACAGG + Intronic
953555857 3:43946318-43946340 CCTGGGAAGCACTAGGGGTCAGG - Intergenic
953595078 3:44303654-44303676 CCTGTGGAGCAGTAAGGGTAGGG + Intronic
953660096 3:44885597-44885619 ACTGGGGATCAGGGAGGGTAAGG - Intronic
953660831 3:44890466-44890488 CCTGGAGACAAGGAATGGTCAGG - Intronic
953770861 3:45777825-45777847 CCTGGGAAGCAGGCCCGGTCTGG - Intronic
953970203 3:47341506-47341528 CCAGGGTTGCAGGAAGGGACAGG + Intronic
954327810 3:49873099-49873121 CTTGGGGTGCAGTAAAGGTCAGG + Intergenic
954377176 3:50201373-50201395 CCTGAGGAGCTGGAAGTGTTAGG + Intergenic
954466887 3:50660538-50660560 CCTGGGGAGCATGAGGCGTGCGG - Intergenic
954616933 3:51973926-51973948 ACTGGAGAGAAGAAAGGGTCAGG + Intronic
954794590 3:53155071-53155093 CCTGGGCAGCAGTAATGGTGAGG - Intergenic
954836533 3:53473880-53473902 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
954879243 3:53822692-53822714 CCTGGGCAGGAGGAAGGAGCTGG + Intronic
954908785 3:54085974-54085996 CCTGGGGTGAAGGAAGTTTCCGG - Intergenic
955655615 3:61242006-61242028 CCTGGTGGGCAGAAAGGTTCAGG + Intronic
955772871 3:62403977-62403999 CCTGTGGTGCAGGAAGTCTCTGG + Intronic
956268758 3:67427675-67427697 CCTGAGAAGCACAAAGGGTCAGG + Intronic
956448041 3:69345048-69345070 CCTGGGAAGCACAAGGGGTCAGG + Intronic
956616909 3:71181570-71181592 CCTGGGGAGCTGGAAAGGGCAGG - Intronic
957102989 3:75850921-75850943 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
957256691 3:77845636-77845658 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
957381946 3:79442811-79442833 CCTGAGAAGCAGGATGGTTCAGG - Intronic
958252895 3:91291330-91291352 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
958826261 3:99034983-99035005 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
960747092 3:120902134-120902156 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
960792836 3:121452216-121452238 CCTGGGAAGCACAAGGGGTCAGG - Intronic
960967087 3:123112892-123112914 CCTGGGGAGGAGGCTGGGGCTGG - Intronic
960996993 3:123346784-123346806 CCTGGGGAGAAGGAACTCTCCGG + Intronic
961219267 3:125187141-125187163 CCTGGGGAGAAGCGAGGGTGGGG - Intronic
961237046 3:125375675-125375697 CCTGGGGAAATGGAAGGGTCGGG + Intergenic
961237389 3:125378885-125378907 CCTGGGGAAATGGAAGGGTTGGG + Intergenic
961281123 3:125766555-125766577 CCTGGGGAAGAGGAAGGACCCGG - Intergenic
961453501 3:127013254-127013276 CCTGGTGAGAAGGGAGGGTGGGG - Intronic
961464226 3:127071744-127071766 CCTGGGGTGCAGGAGGGGCGTGG + Intergenic
962134901 3:132722637-132722659 GCGGGGGAGCAGGACGGGGCGGG + Intergenic
962191195 3:133312665-133312687 CCTGGGAAGCACAAGGGGTCAGG - Intronic
962426105 3:135270701-135270723 AGTGGGGACCAGGCAGGGTCTGG - Intergenic
962665116 3:137646743-137646765 GCTGGGGAGCAGTAAGCCTCAGG - Intergenic
962761349 3:138517894-138517916 CCCGGGAAGCACAAAGGGTCAGG + Intronic
963097163 3:141556108-141556130 ATTTGGGAGCAGGAAGGGCCAGG + Intronic
963769624 3:149377018-149377040 TCTGGGGAGCCGGAAGGGGTTGG - Intronic
965221369 3:165931279-165931301 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
966592072 3:181695165-181695187 CCTGGAGAGCGGGGAGGGTTCGG - Intergenic
966732546 3:183162831-183162853 CCTACGGAGCAGGGAGGGGCGGG + Exonic
966888843 3:184391662-184391684 CCTGGGGCTCAGGCAGGGCCTGG - Intronic
967386481 3:188916593-188916615 CCTGGGGAGCAGGCAGTGGGGGG + Intergenic
968051573 3:195658279-195658301 CCCGGGGATCGGGAAGGGGCTGG + Intergenic
968104243 3:195990054-195990076 CCCGGGGATCGGGAAGGGGCTGG - Intergenic
968288473 3:197521765-197521787 GTTGGGAAACAGGAAGGGTCAGG - Intronic
968302544 3:197627644-197627666 CCCGGGGATCGGGAAGGGGCTGG - Intergenic
968470997 4:782203-782225 CCTGGGGAGGAGGCCGTGTCTGG + Intergenic
968551620 4:1226343-1226365 CCTGGGGAGGAGGAGGGGGCAGG + Intronic
968614117 4:1569665-1569687 CCTGTGGGGGAGGAAGGGTGGGG + Intergenic
968649287 4:1754049-1754071 CCTGGGGAGGAGCACGGGGCTGG - Intergenic
968755188 4:2412046-2412068 CCTGGGGCGCAGGCAGGGGCAGG + Intronic
968860681 4:3166876-3166898 CCTGGGAAGCACAAGGGGTCGGG - Intronic
969211051 4:5687521-5687543 GCAGGGAAGCAGGAAGGGGCAGG + Intronic
969293227 4:6253660-6253682 CCTGGGGTGCAGGAAGGAGCAGG - Intergenic
969308139 4:6336953-6336975 CCTGTGGAGGAGGATGGGTACGG + Intronic
969909253 4:10428333-10428355 CCTGGGAAGCACAAAGGGTTGGG - Intergenic
969945684 4:10781203-10781225 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
969980486 4:11149434-11149456 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
970003135 4:11384554-11384576 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
970685172 4:18559294-18559316 CCTGGGAAGCACAAGGGGTCTGG + Intergenic
971143064 4:23946003-23946025 CCTGGGGAGGAGGGAGGGTCCGG - Intergenic
971586042 4:28406995-28407017 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
971883170 4:32409263-32409285 CCTGGGAAGCACAAGGGGTCGGG + Intergenic
972119602 4:35683118-35683140 CTTGGGAAGCACAAAGGGTCAGG - Intergenic
972561489 4:40232713-40232735 AGTGGGGAGCAGGAAGTGGCCGG - Intronic
973237684 4:47922992-47923014 CCTGGGAAGCACAAGGGGTCGGG - Intronic
973863270 4:55086792-55086814 CCTGGGCTGCAGGGAGGGGCAGG - Intronic
974119826 4:57625068-57625090 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
974491705 4:62572176-62572198 CCTGGGGAGCACAAGGGGTTGGG - Intergenic
975157719 4:71090325-71090347 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
975764607 4:77654619-77654641 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
975818852 4:78248509-78248531 AATGGGGAGTAGGAAGGGACAGG + Intronic
975887445 4:78982371-78982393 CCTGGGAAGTACAAAGGGTCAGG - Intergenic
976317954 4:83679622-83679644 CCTGGGGAGCAGAAAGCAACAGG + Intergenic
976524964 4:86076202-86076224 CCTGGGAAGCACAAGGGGTCAGG - Intronic
976682143 4:87769279-87769301 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
977699611 4:100006338-100006360 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
978012721 4:103707713-103707735 CCTGGGAAGCACAAGGGGTCAGG + Intronic
978231756 4:106408375-106408397 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
978862879 4:113471697-113471719 ACCTGGGAGCAGGAAGGGTCAGG - Intronic
979187759 4:117819660-117819682 TCTTGGGAGCAGGAAGAGTGGGG + Intergenic
979317335 4:119279909-119279931 CCTGGGAAGCACGAGGGGTCAGG - Intronic
979739514 4:124131744-124131766 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
980090449 4:128437431-128437453 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
980453290 4:133005541-133005563 CCTGGGGAGGTGGAAGGATAAGG + Intergenic
981142961 4:141291733-141291755 CCTGGGCAGCAGGCATGGTGCGG + Intergenic
981659017 4:147144720-147144742 ACAGGGGAGGAGGTAGGGTCAGG + Intergenic
982715323 4:158801189-158801211 CCTGGGGAGGCGGTAGGGGCCGG + Intronic
982853034 4:160342737-160342759 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
983173642 4:164563333-164563355 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
983183514 4:164676087-164676109 CCTGGGAAGCACAAGGGGTCGGG + Intergenic
984944676 4:184961791-184961813 GCTGGGGAGCAGGCAGAGCCTGG - Intergenic
985258372 4:188091842-188091864 CATGGGCAGCAGGATGGGGCTGG - Exonic
1202752777 4_GL000008v2_random:24538-24560 CCTGGGAAGCACAATGGGTCAGG + Intergenic
985626563 5:991918-991940 TGTGGGGAGCAGGAAGTATCTGG - Intergenic
986101462 5:4615622-4615644 CCTGGGAAGCGCGAGGGGTCAGG + Intergenic
986551326 5:8959308-8959330 CCTGGGTTGCAGGAAGCTTCAGG - Intergenic
986653729 5:9990031-9990053 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
986653834 5:9990931-9990953 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
986675118 5:10177581-10177603 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
986680685 5:10230784-10230806 CCTGGGGAGGAGGAAGTGCCAGG - Intronic
986879520 5:12153391-12153413 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
987217563 5:15753118-15753140 CCTAGGGAGCAGGCGGGGGCTGG + Intronic
987279763 5:16400885-16400907 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
987678590 5:21107608-21107630 CCTGGGAAGCGCGAGGGGTCAGG + Intergenic
988457622 5:31400642-31400664 CATGGGGAGCAGGAAGGAGGAGG - Exonic
989072156 5:37522692-37522714 CCTGGGAAGCACAAGGGGTCAGG + Intronic
989649681 5:43673213-43673235 CCTGGGAAGCACAAGGGGTCAGG - Intronic
990244912 5:53854635-53854657 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
990269166 5:54116151-54116173 CCTGGGGAGCAGGAGGGGGTTGG + Intronic
990449597 5:55922272-55922294 GCTGGGGAGAAGCAAGGGGCAGG + Intronic
990710278 5:58572990-58573012 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
990887856 5:60615358-60615380 CCTGGGAAGCACAAGGGGTCAGG + Intronic
990913885 5:60881789-60881811 CCTGGGAAGCACAAGGGGTCAGG - Intronic
991097275 5:62752603-62752625 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
991223504 5:64242969-64242991 CCTGAGAAGCACAAAGGGTCAGG + Intronic
991236627 5:64406844-64406866 CCTGGGAAGCAGAAAGGGTCAGG + Intergenic
991280802 5:64910889-64910911 CCTGGGAAGCACAAAGGGTAGGG - Intronic
992287215 5:75248025-75248047 CCTGGAAAGCACGAAGGGTCAGG + Intergenic
992317048 5:75566629-75566651 CCTGGGAAGCACAAGGGGTCTGG - Intronic
992641856 5:78774529-78774551 CCTGGGTAGCAGGGATGGTCAGG + Intergenic
993619064 5:90146958-90146980 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
994331337 5:98509835-98509857 ACTGGGGAGAAGGAAGGGCTAGG + Intergenic
994401431 5:99285229-99285251 CCTGGGGCACAGGAATGGGCTGG - Intergenic
995136623 5:108686192-108686214 CCTGGGAAGCACAAGGGGTCGGG - Intergenic
995459735 5:112390252-112390274 CCTGGGAAGCACAAGGGGTCAGG + Intronic
996852288 5:127966510-127966532 GATGGGGAGCTGGAAGGGTGGGG + Intergenic
997268429 5:132514161-132514183 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
997641595 5:135452158-135452180 CATGGGGAGAAGGGAGGGCCTGG - Intronic
997870129 5:137499096-137499118 CCTAGGGGGCTGGCAGGGTCAGG - Intronic
998780457 5:145650969-145650991 CCTGGGAAGCACAAAGGGTCAGG + Intronic
998936682 5:147236404-147236426 CCTGGAGATCAGGAAGGGCTGGG + Intronic
999116807 5:149171549-149171571 CCTGGAGAGCAGATAGGGTATGG - Intronic
999310619 5:150549419-150549441 CCTGAGGGGCAGGCAGGGTTTGG + Intronic
999371753 5:151059975-151059997 CCGGGGGAGAAAGAAGGGTCAGG - Intronic
1000068938 5:157721122-157721144 CATGGGAAGCAGAAGGGGTCAGG + Intergenic
1000082091 5:157858541-157858563 CCTGGGGAGCAGGGAAGGTTTGG - Intronic
1000312836 5:160061888-160061910 CCTGTGGAGGAGGAAAGGCCGGG + Intronic
1000647891 5:163780822-163780844 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1000747053 5:165046369-165046391 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1000798455 5:165693673-165693695 CCTGGGAAGCAGAAGGTGTCAGG - Intergenic
1001591591 5:172869190-172869212 CCTGGGGAGGAGGAAGGAGGAGG + Intronic
1001782589 5:174382857-174382879 CCTGGGGAGCAGAAAAGAGCTGG + Intergenic
1001884819 5:175279921-175279943 CCTAGGAAGGAGGAAAGGTCAGG + Intergenic
1001974332 5:175984563-175984585 TCTGGGAAGCAGGGAGGGACTGG - Intronic
1001983318 5:176051954-176051976 CCTGGGAAGCGGGAGGGGTCAGG + Intronic
1002050082 5:176565603-176565625 CCAGGGGAGCAGGTAGGGATCGG + Intronic
1002216616 5:177639466-177639488 CCCGGGAAGCACAAAGGGTCAGG - Intergenic
1002234147 5:177792098-177792120 CCTGGGAAGCGGGAGGGGTCAGG - Intronic
1002243102 5:177859216-177859238 TCTGGGAAGCAGGGAGGGACTGG + Intergenic
1002558499 5:180063030-180063052 GGTGGGGAGGAGGAAGGGGCTGG + Intronic
1002614471 5:180442205-180442227 CCTGGGAGGGAGGAAGGGACAGG + Intergenic
1002645162 5:180649301-180649323 CCTCGGGATGAGGAAGGGGCGGG - Intronic
1002788304 6:420443-420465 CCTGGAAAGCAGGGAGGGTCAGG - Intergenic
1003232197 6:4264553-4264575 AATGGGAAGCAGGACGGGTCTGG - Intergenic
1003254179 6:4459899-4459921 TCTGGGAAACAGGAAGAGTCGGG + Intergenic
1003511943 6:6789014-6789036 TCTGGGGAGCAGGAAGAATTGGG + Intergenic
1004122697 6:12840054-12840076 CCTGGGTAGCAGCAAGGATGGGG - Intronic
1004172182 6:13303933-13303955 CTTAGGGAGCAGGAAGGCTTAGG - Intronic
1004350000 6:14882647-14882669 CCTGGGGAGCAGGAGCTGTCAGG + Intergenic
1004369917 6:15043546-15043568 CCTCAGGTGCAGGAAGGGACAGG + Intergenic
1005315317 6:24598161-24598183 CCTGGGCACCAGTATGGGTCTGG + Intronic
1005373461 6:25158385-25158407 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1006265021 6:32913756-32913778 CCTGGGCATCAGGAAGCCTCAGG + Intergenic
1006369285 6:33634094-33634116 ACAGGGGAGCAGGAGGGGACGGG - Intronic
1006574685 6:35036197-35036219 TCTGAGCAGCTGGAAGGGTCTGG + Intronic
1006621754 6:35370189-35370211 TCTGTGGGCCAGGAAGGGTCTGG + Intronic
1006735671 6:36270768-36270790 CCTGGGTGGCAGGAAGGGAAGGG + Intronic
1006826222 6:36938253-36938275 CCTGGTGAGCAGGAAGGCAGAGG - Intergenic
1006839788 6:37021490-37021512 CCTGGGGTGCAGGGAGGGGGAGG - Exonic
1006926381 6:37657734-37657756 CGTGGAGAGCAGGTAGGGACTGG + Intronic
1007096723 6:39217808-39217830 CCTGGGGAGCAGGGAGGCATCGG + Intronic
1007228548 6:40331835-40331857 CTTGGGGAGCAGGAGGGGGAGGG - Intergenic
1007388841 6:41538104-41538126 GGTGGGGAGCAGGGTGGGTCAGG - Intergenic
1007410000 6:41656018-41656040 CCTGCGGAGCAGGGAGGGCCAGG - Intergenic
1007513259 6:42391058-42391080 CCTCTGTAACAGGAAGGGTCTGG - Intronic
1007872957 6:45062644-45062666 CCTGGGAAGCGCGAGGGGTCAGG + Intronic
1007989773 6:46243134-46243156 CATGGGGAGGAGGAAGGGTGTGG + Intronic
1008510779 6:52273741-52273763 CCTGGGGAGCAGGATGGCGATGG - Exonic
1008576035 6:52861024-52861046 CCTGGGAAGCACAAGGGGTCAGG + Intronic
1009020846 6:57946893-57946915 CCTGGGGAGGAGGAGGCGCCGGG + Intergenic
1009384889 6:63076226-63076248 CCTGGGAAGCACAAAGGGTTGGG - Intergenic
1009655588 6:66541101-66541123 CCTGGGAAGCACAAGGGGTCGGG + Intergenic
1010484244 6:76390721-76390743 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1010718493 6:79257234-79257256 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1010809935 6:80289752-80289774 CCTGGGGAGCAGGCAGAGACAGG + Intronic
1011020773 6:82809752-82809774 CCTGGGAAGCACAAGGGGTCGGG - Intergenic
1011187932 6:84699532-84699554 CCTGGGAAGCACAAGGGGTCAGG + Intronic
1011943258 6:92869399-92869421 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1012401268 6:98844408-98844430 TCTGGGGCGCAGGATGGGGCGGG - Intergenic
1012494980 6:99823774-99823796 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1012589946 6:100968898-100968920 CCTGGGAAGCACAAGGGGTCGGG + Intergenic
1012719348 6:102722300-102722322 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG + Exonic
1013383825 6:109604001-109604023 CCTGGGAAGCAAAAGGGGTCAGG - Intronic
1014063790 6:117102328-117102350 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1014277187 6:119400179-119400201 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1014937372 6:127400172-127400194 GCTGGGAAGCAGGGAGAGTCAGG - Intergenic
1015601484 6:134915295-134915317 GCTGGGGAGGAGGAAGGGAAAGG - Intergenic
1015623474 6:135156596-135156618 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1015802005 6:137070014-137070036 CCTGGGAAGCACAAGGGGTCGGG + Intergenic
1015967738 6:138711857-138711879 CCCGGGAAGCACAAAGGGTCAGG - Intergenic
1016542092 6:145177827-145177849 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1016638785 6:146324684-146324706 CCTGGGAAGCGCAAAGGGTCAGG - Intronic
1016863905 6:148747511-148747533 CCTGGGCAGCTGGAAGCGTCGGG + Exonic
1017470672 6:154734133-154734155 CCTGGGGCGGAGGGAGGTTCTGG + Intronic
1018154608 6:160974173-160974195 CCAGGGGAGCAGGTGGGGACAGG - Intergenic
1018181606 6:161228073-161228095 CCAGGGGAGGAGGAAGAGTCAGG - Intronic
1018618113 6:165707237-165707259 CCTGGGGACCAGGGCGGGACTGG - Intronic
1018690335 6:166339301-166339323 TCTAGGGAGGAGGAAGGGGCAGG - Intronic
1018726133 6:166614746-166614768 ACAGGGGTGGAGGAAGGGTCAGG - Intronic
1018939615 6:168300393-168300415 CCTGGGTGACAGGAAGTGTCTGG - Intronic
1018982755 6:168613222-168613244 CCTGGGGGTCAGGAAGGTGCAGG + Intronic
1019124826 6:169831104-169831126 CCTCGGGAGGAGGAGGGGCCCGG + Intergenic
1019314421 7:377849-377871 CCTGGCGGGCAGGAAGGGGCAGG - Intergenic
1019409080 7:898808-898830 CCTGAGGAGCAGGTGGGGCCAGG + Exonic
1019409581 7:900719-900741 GCCGGGGAGGAGGAAGGGGCTGG - Intronic
1019592348 7:1841957-1841979 CGCGGCGAGCAGGCAGGGTCTGG - Intronic
1019917974 7:4145408-4145430 TCTGGGGAGCAGGGAGGGACTGG + Intronic
1019989868 7:4683285-4683307 GCTGGGGAGCAGCAGGGATCTGG - Intronic
1020333324 7:7042013-7042035 CCTGGGAAGCACAAGGGGTCGGG + Intergenic
1020590136 7:10124954-10124976 CCTGGGAAGCACAAAGGGTCAGG - Intergenic
1020622325 7:10533412-10533434 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1020693894 7:11391856-11391878 CCTGGGGAGCGCAAGGGGTCAGG - Intronic
1020774173 7:12432288-12432310 CCTGGGAAGCACAAAGGGTAGGG - Intergenic
1021375947 7:19906465-19906487 CCTGGGAAGCAAAAGGGGTCAGG - Intergenic
1022103008 7:27180313-27180335 CCTGGGGGGCAGGGAGGGGGCGG - Intergenic
1022441462 7:30436617-30436639 CCTGAGGACAAGGAAGGGGCAGG + Intronic
1022901394 7:34814115-34814137 CCTGGGGAGCACAAAGGGTTGGG + Intronic
1023051830 7:36259104-36259126 CCTGGGAAGCACAAGGGGTCCGG - Intronic
1023651235 7:42371379-42371401 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1024225852 7:47326475-47326497 CCTGGGGATTAGGAAGGCACAGG + Intronic
1024294901 7:47833968-47833990 ACTGTGGAGCAGCAAGGCTCGGG - Intronic
1024452458 7:49563600-49563622 CCTGGGGAGTAGGCAGAGACAGG + Intergenic
1024564731 7:50672151-50672173 GCTGGGGGGCAGGCAGGGTATGG - Intronic
1024704398 7:51941478-51941500 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1026015328 7:66667183-66667205 CCCGGGGATCAGGAAGGGCTTGG + Intronic
1026642881 7:72142184-72142206 CCTGGGAAGCACAAGGGGTCAGG + Intronic
1026892765 7:73992114-73992136 CCTGGGCAGCAGACAGGGTGAGG + Intergenic
1027965013 7:84993371-84993393 CCCGGGAAGCACGAGGGGTCAGG - Intergenic
1029216359 7:98953318-98953340 CTTGGAGAGCAGGCAGGGCCAGG - Exonic
1029611914 7:101630987-101631009 CCTGGGGGGCGGGAAGTGTGAGG + Intergenic
1029734096 7:102455998-102456020 CCAGGGGAACAGGAAAGGTTCGG - Exonic
1030500889 7:110357043-110357065 CCTGGGAAGCACAAAGGGTCAGG - Intergenic
1031103167 7:117507241-117507263 CCTGAGGAGAAGGCAAGGTCGGG - Intronic
1031314648 7:120240761-120240783 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1032066650 7:128776249-128776271 CCTGGGCTGCAGGAAAGGGCTGG + Intergenic
1032084888 7:128878742-128878764 ACTGGGGAGCAGGGAAGGACAGG + Intronic
1033355297 7:140594332-140594354 CCTGAGGGCCAGGAAGGGTCTGG - Intronic
1033658883 7:143390556-143390578 CCTGGGAAGAAGGAAGGGTGAGG - Exonic
1035470356 7:159105323-159105345 CCTGGGTGACTGGAAGGGTCTGG + Intronic
1036642967 8:10595539-10595561 CCTGGGGTGCAGGGAGGCACGGG - Intergenic
1036830244 8:12015072-12015094 CCTGGGGAAGAGGAAGGACCCGG + Intronic
1037876391 8:22551001-22551023 GATGGGGAGCCGGAAGGGCCGGG + Intronic
1037894359 8:22641912-22641934 CCTGGGGAGTGGGAGGGGACTGG + Intronic
1038873331 8:31520059-31520081 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1039112435 8:34054978-34055000 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1039566268 8:38554374-38554396 CCTTCGGAGCAGGAAGGGAGAGG + Intergenic
1039832346 8:41225184-41225206 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1040612331 8:48997807-48997829 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1041095307 8:54343663-54343685 CCAGGGGAGCAGGGAAGGCCTGG - Intergenic
1041313080 8:56536163-56536185 GGTGGGGAGCAGGAAGGGTCTGG + Intergenic
1042195485 8:66228402-66228424 CCCGGGAAGCACGAGGGGTCGGG + Intergenic
1042394471 8:68276500-68276522 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1043424526 8:80135417-80135439 CCTGGGGGGCAGGTAGGCTGGGG - Intronic
1043938900 8:86174323-86174345 CCTGGGAAGCAGAAGGGGTGGGG - Intergenic
1044202928 8:89457732-89457754 CCTGGGAAGCACAAAAGGTCAGG + Intergenic
1045488671 8:102654331-102654353 CGCGGGGAGCTGGAAGGGGCGGG - Intronic
1045585445 8:103529556-103529578 CCCGGGAAGCAGAAGGGGTCAGG - Intronic
1045883267 8:107065442-107065464 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1046038043 8:108867752-108867774 AATGGGGAGCTGGAAGGGTTTGG + Intergenic
1046100510 8:109609059-109609081 CCTGCAGAGCAGCACGGGTCGGG - Intronic
1047327184 8:123851130-123851152 CCGGGGGAGCAGGAGGGGAGAGG + Intergenic
1047425513 8:124741931-124741953 CCTGGGGAGACAGAAAGGTCAGG - Intergenic
1047877810 8:129157934-129157956 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1048138633 8:131771098-131771120 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1048267877 8:133003777-133003799 GCAGAGGAGAAGGAAGGGTCTGG - Intronic
1048467011 8:134674147-134674169 CCTGGGAAGCACAAGGGGTCGGG + Intronic
1048918708 8:139208225-139208247 CATTGGCAGCAGGAAAGGTCTGG + Intergenic
1048934456 8:139343498-139343520 TCTGGGTAGCAGGGAGGGTGTGG + Intergenic
1048988942 8:139750171-139750193 CCTGGGGAGCAGGGGAGGTTGGG - Intronic
1049285155 8:141770755-141770777 TCTGGGGAGCTGGAAGGGTAGGG - Intergenic
1049470531 8:142773306-142773328 CCTGGAGAGCAGGACCGGCCCGG - Intronic
1049522503 8:143101061-143101083 CCAGCAGAGCAGGAATGGTCTGG - Intergenic
1049758859 8:144322849-144322871 CTTGGGGAGGAGGGAGGCTCTGG - Intronic
1050047085 9:1558629-1558651 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1051112154 9:13651376-13651398 CCAGGGAAGCAGAAGGGGTCGGG - Intergenic
1051308776 9:15746806-15746828 CCTGGGAAGCACAAGGGGTCAGG + Intronic
1051320737 9:15902744-15902766 CCTGGGAAGCACAAGGGGTCAGG + Intronic
1051929025 9:22363567-22363589 CCCGGGGAGCGGGGAGGCTCGGG + Intergenic
1052098031 9:24408665-24408687 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1052235704 9:26211562-26211584 CCTGAAGAGCATGCAGGGTCAGG + Intergenic
1052746709 9:32448615-32448637 CCTGGGAAGCACAAAGGGTCAGG - Intronic
1052752669 9:32508479-32508501 CCTGGGAAGCACAAGGGGTCTGG + Intronic
1052856230 9:33408236-33408258 CCTGGGGTGCAGGCTGGGCCAGG + Intergenic
1053141395 9:35684949-35684971 GCTGGGGATCAGGAAGGGCCTGG - Intronic
1053495239 9:38544514-38544536 TCTGGGGTGCAGGGAGGGGCAGG + Intronic
1053520996 9:38779585-38779607 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1054193153 9:62003578-62003600 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1054645254 9:67585113-67585135 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1054835753 9:69672938-69672960 CCTGGGAAGCGGGAAAGCTCGGG - Intergenic
1054886529 9:70204864-70204886 CCTGGGAAGCACAAGGGGTCAGG - Intronic
1056502211 9:87221199-87221221 ACTGAGGAGCAGCAAGGGTCTGG - Intergenic
1056770499 9:89475027-89475049 GCTGGGGAGAAAGAGGGGTCTGG - Intronic
1057263224 9:93597888-93597910 CCTGGGGAGGAGGAGGGATTTGG - Intronic
1057725840 9:97567631-97567653 TCCTGGGAGCAGGAAGGTTCTGG + Intronic
1058819218 9:108713660-108713682 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1058923517 9:109640462-109640484 CCTGGGGAGAAGGGTGGGTGGGG - Intergenic
1058995143 9:110292244-110292266 CCTGGGGAGCAGGCAGTGGATGG - Intergenic
1059317964 9:113443373-113443395 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1059326324 9:113506095-113506117 CCTGGGGAGGGGTAAGGGCCCGG + Intronic
1059343610 9:113613448-113613470 CATGAGGAGGAGGAAGGGTGTGG + Intergenic
1059414832 9:114156119-114156141 GCGGGGGCGCAGGAAGGGGCAGG - Intronic
1059673563 9:116514925-116514947 CCCGGGAAGCACAAAGGGTCAGG - Intronic
1059825793 9:118027510-118027532 CCAGGGCAGAAGGAAGGGGCGGG - Intergenic
1060468076 9:123925361-123925383 TCTGGGGAGGAGGGAGGGTCAGG - Intronic
1060779492 9:126401028-126401050 CCAGGTCAGCAGGAAGGGTGGGG - Intronic
1061009299 9:127945753-127945775 CCTGGAAGGCAGGAAGGGGCAGG + Exonic
1061230393 9:129312556-129312578 CATGGGGGGCAGGATGGGGCTGG - Intergenic
1061309089 9:129750790-129750812 CCTGGGGACCTGGAAAAGTCTGG - Intronic
1061364539 9:130164988-130165010 TCTGCAGAGCAGGAAGGGCCAGG + Intergenic
1061405240 9:130390248-130390270 CTTGGGGGACAGGAAGGGTGGGG - Intronic
1062043312 9:134414089-134414111 GCTGGGGGGCAGGAGGGGCCGGG - Intronic
1062057327 9:134475356-134475378 CCGGGGAAGCAGGAGGGGTTCGG + Intergenic
1062197668 9:135283139-135283161 CCTGGGGAAGGGGCAGGGTCAGG + Intergenic
1062235528 9:135506013-135506035 CATGAGGAGCAGGGAGGGACGGG + Intergenic
1062340248 9:136090928-136090950 CCTGGGAAGCAGGCAGGGCTGGG - Intronic
1062380326 9:136283946-136283968 CCTGGGCAGCAGGTGGGGTTGGG + Intronic
1062469305 9:136695574-136695596 GCTGGGGAGGAGGAAGGCCCAGG - Intergenic
1062583390 9:137237978-137238000 CCTGGGGAGCCTGAGGGGCCGGG + Intergenic
1203758287 Un_GL000218v1:156318-156340 CCTGGGAAGCACTAGGGGTCAGG - Intergenic
1203533568 Un_KI270743v1:9243-9265 CCTGGGAAGCACTAGGGGTCAGG + Intergenic
1203651872 Un_KI270751v1:132581-132603 CCTGGGAAGCACAATGGGTCAGG - Intergenic
1185911071 X:3981882-3981904 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1186545898 X:10449321-10449343 TCTGGGGAACAGTAAGGTTCAGG - Exonic
1186775874 X:12864224-12864246 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1186820345 X:13281791-13281813 CCTGGAGAACTGGCAGGGTCAGG - Intergenic
1186961022 X:14736498-14736520 CCTGGGAAGCACAAGGGGTCGGG - Intergenic
1187473269 X:19588216-19588238 CCTGCAGAGCAGTGAGGGTCAGG + Intronic
1187784238 X:22866560-22866582 CCTGGGAAGCACAAAGGGTCAGG + Intergenic
1188461197 X:30429412-30429434 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1188978665 X:36706116-36706138 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1189988776 X:46575482-46575504 CCTGGGGAGGGGGAAGTGTAGGG + Intronic
1190062670 X:47221223-47221245 TTTGGGGATCAGGAAGGGTCAGG + Intronic
1190109285 X:47579528-47579550 TCTGGGGAGCTGGATGGGTGTGG - Intronic
1190247935 X:48702772-48702794 TGTGGAGAGCAGGAAGGGTGAGG - Intronic
1190341536 X:49300271-49300293 CCGGGGAAGCAGTAGGGGTCGGG - Intronic
1190615097 X:52222290-52222312 CCTGGGAAGCGCAAAGGGTCAGG + Intergenic
1190959840 X:55235081-55235103 CCTGGGAAGCACAAGGGGTCAGG - Intronic
1191043262 X:56107658-56107680 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1191686670 X:63899317-63899339 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1191828311 X:65389565-65389587 CCTGGGAAGCACAACGGGTCAGG - Intronic
1191834920 X:65454201-65454223 CCTGGGAAGCACAAGGGGTCAGG + Intronic
1192584633 X:72309257-72309279 CCTGGGGAGCAGGAACGAGAGGG + Intergenic
1192712685 X:73607749-73607771 CCTGGGAAGCACAAGGGGTCAGG - Intronic
1193030794 X:76896413-76896435 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1193582857 X:83286494-83286516 CCTGGGAAGAACAAAGGGTCAGG + Intergenic
1193685357 X:84571359-84571381 CCTGGGAAGCACAAGGGGTCGGG + Intergenic
1193806558 X:86002608-86002630 CCTGGGAAGCACAAGGGGTCGGG + Intronic
1194190942 X:90836428-90836450 CCTGGGAAGCGCGAGGGGTCAGG + Intergenic
1194254781 X:91622590-91622612 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1194576421 X:95619193-95619215 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1194798468 X:98241103-98241125 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1194813459 X:98415194-98415216 CCCGGGAAGCAGAAGGGGTCAGG + Intergenic
1195355178 X:104032685-104032707 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1195519324 X:105812713-105812735 CCTAGGAAGCACGAGGGGTCAGG - Intergenic
1195571986 X:106407221-106407243 CCTGGGAAGCATAAGGGGTCGGG + Intergenic
1196230224 X:113212472-113212494 CCTGGGTAGCACGAGGGGTTGGG - Intergenic
1196489835 X:116252904-116252926 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1196797090 X:119511074-119511096 CCTGGGAAGCAGCAAGGGGAAGG - Intergenic
1197906172 X:131428145-131428167 CCTGGGAAGCACAACGGGTCAGG + Intergenic
1198143082 X:133825514-133825536 CTTGGGGAGGAGGGAGGGTTGGG + Intronic
1198168342 X:134079659-134079681 CCTGGGAAGCACAACGGGTCGGG + Intergenic
1198533172 X:137564482-137564504 ACTGGGGAGCAGGAAGTGAAAGG + Intergenic
1198572325 X:137971157-137971179 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1198609569 X:138382973-138382995 CCTGGGGAGCAGGCAGAAACAGG + Intergenic
1198704660 X:139435894-139435916 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1199016229 X:142819473-142819495 CCTGGGGAGCAGGGAGAGACAGG + Intergenic
1200070658 X:153527404-153527426 CGTGGGGAGCACGTAGGGGCAGG + Intronic
1200122520 X:153797850-153797872 CCTGGGGAGCAGGATGGGCTGGG + Intronic
1200371426 X:155728748-155728770 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1200537603 Y:4418845-4418867 CCTGGGAAGCGTGAGGGGTCAGG + Intergenic
1200573567 Y:4862193-4862215 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1200810520 Y:7479768-7479790 CCTGGGAAGCACAAGGGGTCGGG - Intergenic
1200879083 Y:8193664-8193686 CCTGGGAAGCCTAAAGGGTCAGG + Intergenic
1201067588 Y:10112875-10112897 CCTGGGAAGCACAAGGGGTCAGG - Intergenic
1201072956 Y:10166005-10166027 CCTGGGATGCAGAAGGGGTCAGG - Intergenic
1201171818 Y:11273928-11273950 CCTGGGAAGCACAATGGGTCAGG - Intergenic
1201466044 Y:14282363-14282385 CCTGGGAAGCACAAGGGGTCAGG + Intergenic
1201620105 Y:15946887-15946909 CCTGGGAATCACAAAGGGTCAGG - Intergenic
1201954920 Y:19613187-19613209 CCTGGGAAGCACAACGGGTCAGG + Intergenic
1202054809 Y:20818659-20818681 CCTGGGAAGCACAAAGAGTCAGG + Intergenic