ID: 1105418428

View in Genome Browser
Species Human (GRCh38)
Location 13:20232434-20232456
Sequence GCGGCTAGTGCGCCCCGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 43}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105418428_1105418435 1 Left 1105418428 13:20232434-20232456 CCTACCCGGGGCGCACTAGCCGC 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1105418435 13:20232458-20232480 GGGCGCGGACCGTCCCCCTGAGG 0: 1
1: 0
2: 1
3: 8
4: 59
1105418428_1105418443 21 Left 1105418428 13:20232434-20232456 CCTACCCGGGGCGCACTAGCCGC 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1105418443 13:20232478-20232500 AGGAGCAAGGAGTGCAGGACCGG 0: 1
1: 0
2: 3
3: 52
4: 450
1105418428_1105418441 16 Left 1105418428 13:20232434-20232456 CCTACCCGGGGCGCACTAGCCGC 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1105418441 13:20232473-20232495 CCCTGAGGAGCAAGGAGTGCAGG 0: 1
1: 1
2: 2
3: 52
4: 1186
1105418428_1105418445 23 Left 1105418428 13:20232434-20232456 CCTACCCGGGGCGCACTAGCCGC 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1105418445 13:20232480-20232502 GAGCAAGGAGTGCAGGACCGGGG 0: 1
1: 0
2: 0
3: 11
4: 198
1105418428_1105418436 8 Left 1105418428 13:20232434-20232456 CCTACCCGGGGCGCACTAGCCGC 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1105418436 13:20232465-20232487 GACCGTCCCCCTGAGGAGCAAGG 0: 1
1: 0
2: 1
3: 19
4: 117
1105418428_1105418444 22 Left 1105418428 13:20232434-20232456 CCTACCCGGGGCGCACTAGCCGC 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1105418444 13:20232479-20232501 GGAGCAAGGAGTGCAGGACCGGG 0: 1
1: 0
2: 0
3: 25
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105418428 Original CRISPR GCGGCTAGTGCGCCCCGGGT AGG (reversed) Intergenic
907513812 1:54980838-54980860 GCGGCTGGTGAGCCCTGGGAGGG + Exonic
921155011 1:212432789-212432811 GCGCCTCCTGCGCCCCGGGGTGG - Intergenic
922641329 1:227234814-227234836 GCGGCCTGTGGGCCACGGGTTGG - Intronic
1073057221 10:100710384-100710406 GCGGCTAGGGCGCCCCAGGCCGG - Intergenic
1084264447 11:67997659-67997681 GCTGCTGGTGCGGCCCGGGATGG - Exonic
1105202763 13:18194239-18194261 GCGGCCCGTGCGCCCCGGCCAGG + Intergenic
1105418428 13:20232434-20232456 GCGGCTAGTGCGCCCCGGGTAGG - Intergenic
1120780158 14:88479579-88479601 GCAGCGAGTGCGCCACGGGCAGG + Exonic
1127103351 15:55588587-55588609 GCGGCTCTTGCAGCCCGGGTGGG + Intronic
1129162168 15:73752996-73753018 GAGCCTAGTGCGCCCCGGCCCGG - Intergenic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1132522276 16:397291-397313 CCTGCTAGTGCGCCACGGCTCGG + Exonic
1139469414 16:67170353-67170375 TCTCCTGGTGCGCCCCGGGTGGG + Intronic
1143446866 17:7014944-7014966 GCGGCTCTTCCGCCCCGGGCGGG + Intronic
1147879278 17:43643472-43643494 GCGCCAGGTGCGCCCCCGGTGGG - Exonic
1152720733 17:81922690-81922712 GCGGCAAGGGGGCCCCGGGCTGG + Exonic
1160796784 19:949300-949322 GCGGCTGCTGCTCCCCAGGTGGG - Intronic
933772600 2:85753818-85753840 GCGGCTCGGGCGGCCCGGGCTGG + Intronic
938319923 2:130355917-130355939 GCGGCCCGAGCGCCCGGGGTGGG + Intergenic
947119520 2:226800149-226800171 GCGGCTACAGAGCCCCGAGTGGG + Intergenic
1176550561 21:8219143-8219165 GCGGCTCGTCCGCTCCGGGCCGG + Intergenic
1176569491 21:8402184-8402206 GCGGCTCGTCCGCTCCGGGCCGG + Intergenic
1176577403 21:8446413-8446435 GCGGCTCGTCCGCTCCGGGCCGG + Intergenic
1178948289 21:36966303-36966325 GCGGCCTGTGCGGCCCGGGAGGG - Intronic
1180603160 22:17036189-17036211 GCGGCTCGTGCTCCCCGGCCAGG + Intergenic
1180702435 22:17788942-17788964 GCGGCTGGAGCGCCCCTGGCAGG + Exonic
1182415455 22:30218300-30218322 GTGGCTGGTGTGCCCCGGGGAGG - Intergenic
1182605129 22:31496924-31496946 GCGTCTAGTGCGCTCCTGGCCGG + Intronic
1184086940 22:42270809-42270831 GAGGCTGGCGCGCGCCGGGTAGG + Intronic
1203255460 22_KI270733v1_random:135486-135508 GCGGCTCGTCCGCTCCGGGCCGG + Intergenic
966787729 3:183636053-183636075 GCGGCTGGTGCGGCCTGGCTAGG + Intronic
967233639 3:187364785-187364807 GAGGATAGTGTGCCCAGGGTGGG + Intergenic
967762601 3:193242016-193242038 GCGGTTAGTGAGCCACGGGTTGG - Intronic
968521418 4:1036275-1036297 GCGGCTTGTGCGCCCAGTGCTGG + Intergenic
991676541 5:69094237-69094259 GCGGCTCGTGAGCCCCGGGATGG + Exonic
998833468 5:146182861-146182883 GCCGCGAGTGCGCCCTGGTTAGG + Intergenic
999062783 5:148654033-148654055 GCGGCAAGTGCGCCGGGGGTCGG - Intronic
1016340824 6:143060487-143060509 GTGGCTAGTGGGCGCCGGGCCGG - Intronic
1019342999 7:517326-517348 GCGGCCTGTGCGCCCCGAGCTGG - Intronic
1034166392 7:149028294-149028316 GCGGCAAGCGCGCCGCGGGTCGG - Intronic
1043401865 8:79891962-79891984 GAGGCTCGGGCGCCCCGGGAGGG - Intergenic
1053651920 9:40177589-40177611 GAGGCTCGCGCGCCCCTGGTGGG + Intergenic
1053902310 9:42806902-42806924 GAGGCTCGCGCGCCCCTGGTGGG + Intergenic
1054532666 9:66198617-66198639 GAGGCTCGCGCGCCCCTGGTGGG - Intergenic
1062145687 9:134988477-134988499 GCGGCTACTGAGCCCCAGCTCGG - Intergenic
1062209434 9:135355826-135355848 GCAGCTGGTGGGCCCCAGGTGGG - Intergenic
1062476031 9:136727996-136728018 GCGGCCAGGACGCCCCAGGTCGG + Intergenic
1203471856 Un_GL000220v1:118621-118643 GCGGCTCGTCCGCTCCGGGCCGG + Intergenic
1190056678 X:47185293-47185315 TCGGCTAGTGCTCCCTGGGGTGG - Exonic