ID: 1105418540

View in Genome Browser
Species Human (GRCh38)
Location 13:20232794-20232816
Sequence GGACACATCCTCAGTCTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105418536_1105418540 17 Left 1105418536 13:20232754-20232776 CCGTGGGGAGCAGTGTGAGGGGC 0: 1
1: 0
2: 1
3: 25
4: 349
Right 1105418540 13:20232794-20232816 GGACACATCCTCAGTCTTTCTGG 0: 1
1: 0
2: 1
3: 12
4: 148
1105418534_1105418540 18 Left 1105418534 13:20232753-20232775 CCCGTGGGGAGCAGTGTGAGGGG 0: 1
1: 0
2: 1
3: 27
4: 287
Right 1105418540 13:20232794-20232816 GGACACATCCTCAGTCTTTCTGG 0: 1
1: 0
2: 1
3: 12
4: 148
1105418530_1105418540 28 Left 1105418530 13:20232743-20232765 CCCTAGTGCACCCGTGGGGAGCA 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1105418540 13:20232794-20232816 GGACACATCCTCAGTCTTTCTGG 0: 1
1: 0
2: 1
3: 12
4: 148
1105418531_1105418540 27 Left 1105418531 13:20232744-20232766 CCTAGTGCACCCGTGGGGAGCAG 0: 1
1: 0
2: 0
3: 8
4: 133
Right 1105418540 13:20232794-20232816 GGACACATCCTCAGTCTTTCTGG 0: 1
1: 0
2: 1
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105418540 Original CRISPR GGACACATCCTCAGTCTTTC TGG Intergenic
900156367 1:1204831-1204853 GGACCCAGCCTCACTCTCTCTGG - Intronic
902974343 1:20078165-20078187 GGTCACCTCCTCAGTCCTTCAGG - Intronic
903381842 1:22902672-22902694 AGACACAGCCTCGGTCTTCCTGG + Intronic
903650017 1:24916596-24916618 GGACAAATCCTTGGCCTTTCGGG - Intronic
904671625 1:32170432-32170454 GGGCACATCATCAGCCTCTCAGG - Intronic
904702554 1:32366532-32366554 GGGAACATTCTCAGTCTTCCAGG + Exonic
905484587 1:38286309-38286331 GGGCACCTCCTCAGCCTTTCTGG - Intergenic
908555247 1:65251072-65251094 GGCTACATCCTCATTCTGTCAGG + Intronic
910015916 1:82523072-82523094 GGTCGCATCCTCAATCCTTCAGG - Intergenic
915963252 1:160284446-160284468 GAAAACATCCCCCGTCTTTCAGG + Intronic
916725101 1:167516538-167516560 GGACACCTCCACAGTCTCCCCGG - Intronic
922456866 1:225781001-225781023 TGACCCATCTCCAGTCTTTCTGG + Intronic
923493307 1:234503451-234503473 TAACACATCCTCACTTTTTCTGG + Intergenic
923712517 1:236398475-236398497 CGACAGATCCTCAGTCCTTGAGG + Intronic
924026186 1:239835208-239835230 GGGCAGATCTTCAGTCTTTCCGG + Intronic
924442584 1:244098830-244098852 GGAGAATTCCTCAGTCTTTAAGG + Intergenic
924510583 1:244726469-244726491 GAAGACATCCTCCTTCTTTCTGG + Intergenic
1063474636 10:6317721-6317743 GGACACATCATCATTCTTTATGG - Intergenic
1064099387 10:12450622-12450644 GGACACAGCCTCCTTCTCTCTGG - Intronic
1064407401 10:15076285-15076307 GGCCCCCTACTCAGTCTTTCTGG - Intergenic
1067728287 10:48790150-48790172 GAACAGATCCTCATGCTTTCTGG - Intronic
1067762295 10:49057473-49057495 GGCCACTTACTCAGCCTTTCTGG - Intronic
1070538857 10:77401502-77401524 GGACACTTCCCCAGACTTTGGGG + Intronic
1070593941 10:77819548-77819570 GGACGCAGCCGCAGTCTTTTGGG + Intronic
1070704160 10:78625405-78625427 GGTCACATCCTTGGTCTTCCAGG + Intergenic
1071677842 10:87673003-87673025 GTACACATTCTCAGCCTTTCAGG - Intronic
1077003394 11:337056-337078 AGACACATTCTGAGGCTTTCTGG + Intergenic
1077251336 11:1562002-1562024 GGACACAGCCTCAACCTTGCAGG + Intronic
1080783103 11:35449377-35449399 GGACAGAACCCCAGTCTTCCTGG - Intronic
1086402465 11:86472076-86472098 GCACCCATCCACAGTCTGTCTGG - Intronic
1086793148 11:91066251-91066273 GGACACATTCTCAGACTCTGAGG - Intergenic
1086821283 11:91439059-91439081 GAACACATCCTGAGTGATTCTGG - Intergenic
1087733385 11:101804246-101804268 GCACACATCCTCCCTCTTTTTGG + Intronic
1088091683 11:106047689-106047711 GGACACATCTTCAGCATTTCTGG - Intergenic
1088228716 11:107650649-107650671 GCCCACCTCCTCAGTCTTCCTGG - Intronic
1088736091 11:112728897-112728919 GCACACATACTCAGTCACTCCGG - Intergenic
1089044081 11:115484220-115484242 GGAACCATGCACAGTCTTTCTGG + Intronic
1089609136 11:119659890-119659912 GGTCACTTCCTCAGTTTTCCAGG - Intronic
1089667115 11:120027431-120027453 GGACACAGGCTCAATCTTGCTGG + Intergenic
1090229730 11:125092871-125092893 GGACCCTTCCTCAGTCTTCAAGG - Intergenic
1091010064 11:131992972-131992994 GGAAACATACTCAGTACTTCTGG + Intronic
1092747277 12:11685470-11685492 GGACACTTCCTAATTTTTTCTGG + Intronic
1092867472 12:12776453-12776475 GGACTCAGCTGCAGTCTTTCTGG + Intronic
1093138642 12:15480638-15480660 TGACAAAATCTCAGTCTTTCTGG - Intronic
1093572355 12:20681180-20681202 GGAAAATGCCTCAGTCTTTCGGG - Exonic
1096969921 12:55657451-55657473 GGAAGCACCCTCAGTCTCTCAGG - Intergenic
1100458556 12:94776258-94776280 GGAAACAACCTCAGCCTTGCTGG - Intergenic
1100509149 12:95252076-95252098 GAACGCATGCTCATTCTTTCTGG + Intronic
1105418540 13:20232794-20232816 GGACACATCCTCAGTCTTTCTGG + Intergenic
1106091736 13:26601827-26601849 GGCCACATCCTCATTCTTTGAGG - Intronic
1107029134 13:35833104-35833126 GCACACATCCTCAGGCTTATAGG + Intronic
1111928749 13:94491619-94491641 GAACACATCCTCAAACTTTTGGG + Intergenic
1111944129 13:94645823-94645845 GTACACATCCTCATTCATTTAGG + Intergenic
1118731146 14:68667867-68667889 GGATACATCCTTAGTTTTTGGGG - Intronic
1121608703 14:95260548-95260570 AGACACATCCTTAGTCTTCAGGG + Intronic
1121693431 14:95893878-95893900 GGGCACATGCCCGGTCTTTCTGG + Intergenic
1122947432 14:105019198-105019220 GGACATGTCCTCAGTCCGTCTGG - Intronic
1125091038 15:35793061-35793083 GGGCCCATCCTCAGGCCTTCAGG + Intergenic
1127684809 15:61332762-61332784 GGACAATTCCTGAGTCTTTTGGG + Intergenic
1129467192 15:75730828-75730850 GGACACAGCCTCAGACCTCCTGG - Intergenic
1131390543 15:92044433-92044455 TGCCACATCCTCATTCTCTCAGG + Intronic
1132040927 15:98524095-98524117 GGCCACATCCTCTGTCTTGCCGG + Intergenic
1133218200 16:4306315-4306337 GGACCCATCCTCCGTGTTTGAGG - Intergenic
1134238894 16:12489510-12489532 GGACAAGTCCTCAGCCTTTGTGG + Intronic
1135069289 16:19338164-19338186 GGATGCAACCCCAGTCTTTCTGG - Intergenic
1135126663 16:19816118-19816140 GGAATCATCCTCAGTCATCCAGG + Intronic
1135504087 16:23021412-23021434 GGACCCCTCCTCAGTCTTGTGGG + Intergenic
1135747644 16:25030986-25031008 AGACACATTCTCAGTTTCTCAGG - Intergenic
1139177347 16:64704951-64704973 GGAGACATCTTTAGTCTTTCTGG - Intergenic
1141353126 16:83317438-83317460 GGCCACATCTAAAGTCTTTCTGG + Intronic
1141712462 16:85707998-85708020 GGACACCTCCTCAGGCTTCTGGG + Exonic
1144758244 17:17693223-17693245 TCACCCATCCTCACTCTTTCTGG - Intronic
1149028367 17:52056181-52056203 GGACACCTCCTCTTCCTTTCTGG - Intronic
1150497079 17:65616204-65616226 AGACACATCCTCTGTGTGTCAGG - Intronic
1151996585 17:77613185-77613207 GTTCACATGGTCAGTCTTTCTGG + Intergenic
1153165692 18:2259439-2259461 TGACACATCCACAGTCATGCAGG + Intergenic
1155554477 18:27003238-27003260 CTACACATCATCAGTTTTTCTGG - Intronic
1157138408 18:45081739-45081761 GGACACTTCCTCTTTATTTCAGG - Intergenic
1159500321 18:69260703-69260725 GCACACAACGGCAGTCTTTCTGG - Intergenic
1161369489 19:3902572-3902594 GGAAACAGGCTCAGTGTTTCCGG + Intronic
1161435259 19:4259036-4259058 GGACACAGCCTCAGGCCTCCTGG + Intronic
1161798943 19:6404625-6404647 GGACACAGCCTCAGCATTCCAGG + Intergenic
1162311688 19:9912010-9912032 GGACACACCCACACTCATTCTGG + Intronic
1163084321 19:14968507-14968529 GGCCACATCATCTGTCCTTCAGG - Exonic
926569532 2:14514299-14514321 GCAGCCATCCTCAGCCTTTCTGG + Intergenic
927961670 2:27244139-27244161 GGACTCTTCCTCACTCTTTCTGG + Intergenic
931872915 2:66481024-66481046 AAACACATCCTCAGGATTTCTGG + Intronic
937119020 2:119429367-119429389 GGTCACATTCTCAGTCCTACAGG + Intergenic
939626535 2:144484350-144484372 GGACACATCCTTAACCTCTCTGG - Intronic
948213693 2:236213592-236213614 GGAAACATTTTCAGTCTTTTGGG + Intronic
948412842 2:237778071-237778093 TGAAACATGCTCAGTCTTTGGGG + Intronic
948647896 2:239420131-239420153 GGACAAAAACACAGTCTTTCAGG - Intergenic
1168805884 20:672092-672114 GAGCACAGACTCAGTCTTTCTGG - Intronic
1168901672 20:1370223-1370245 GGACCCAGCCCAAGTCTTTCTGG - Intronic
1170423790 20:16218303-16218325 GGACGCAGCCAGAGTCTTTCTGG + Intergenic
1170568923 20:17622047-17622069 GGGCACATCCTCAGCTCTTCAGG + Intronic
1171334598 20:24371655-24371677 GGACACATCATCTCTGTTTCAGG + Intergenic
1172250530 20:33476040-33476062 GGTCACACCCTGAGTCTTTCTGG - Intergenic
1173177164 20:40773210-40773232 AGGAAGATCCTCAGTCTTTCAGG + Intergenic
1175664176 20:60844089-60844111 TGATCCATCCTCAGTCTTTGGGG - Intergenic
1176177152 20:63734110-63734132 GGACACAACCTCTGTCTGCCAGG - Intronic
1179112755 21:38461468-38461490 GGACACATTCTCTGCCTTCCTGG - Intronic
1180116485 21:45709032-45709054 GGACAAATGCTTAGCCTTTCTGG + Intronic
1181361672 22:22342749-22342771 GGACACATCTTCAGTTTGTGTGG + Intergenic
949590856 3:5492700-5492722 GGACCCAAACTCAATCTTTCTGG + Intergenic
953979648 3:47407233-47407255 GGACACCCCCTCAGTCCTACCGG - Intronic
954679121 3:52332093-52332115 GGACACACAATCAGGCTTTCTGG - Intronic
954712011 3:52509862-52509884 GGACACAGCCGCAGTCTGTATGG - Exonic
956855658 3:73272336-73272358 GGACAAATCCTCAGTCTGGTAGG - Intergenic
961376056 3:126466802-126466824 GGACACCTGCTCAGTCTCCCTGG - Intronic
963107256 3:141657939-141657961 GGGCACATTCTCTGTCTTTAAGG - Intergenic
964381679 3:156103922-156103944 GGTAACATCCTGAGTCCTTCTGG + Intronic
964465906 3:156992217-156992239 AGAGAAATCGTCAGTCTTTCTGG - Intronic
964856677 3:161153257-161153279 GGGCACATCCTCAAACTTTGGGG - Intronic
967591638 3:191283039-191283061 GGATACATCCAAAGTCTTTTGGG - Intronic
968206815 3:196809714-196809736 TGTCACATCCCCAGTCTTTTTGG + Intronic
969365285 4:6690533-6690555 GGAGACATCCCCAGTCAGTCGGG - Intergenic
971397620 4:26243449-26243471 TGACACTTTCTCAGTATTTCTGG + Intronic
973043246 4:45500897-45500919 AGACACATCTTCAGTTATTCAGG - Intergenic
984507798 4:180641440-180641462 GGACACAATGGCAGTCTTTCTGG - Intergenic
985897544 5:2757822-2757844 GGGCACATCCTAGGCCTTTCTGG - Intergenic
989154397 5:38330360-38330382 GGACCCATCGCCAGTCTTGCGGG + Intronic
993050751 5:82923301-82923323 GGACAACTCCTCAGTATTTTAGG + Intergenic
997857302 5:137383780-137383802 GGACACACTTTCACTCTTTCAGG + Intronic
1004526160 6:16409980-16410002 GGACACATGCCCAGTCTTGAAGG - Intronic
1005095502 6:22110353-22110375 GGGCAGATTTTCAGTCTTTCGGG - Intergenic
1006246527 6:32741802-32741824 GGAAACATCCCTAGTCTTTGAGG - Intronic
1007632452 6:43280200-43280222 GGACAGATCCTCAGCCTTGGAGG + Intronic
1011675645 6:89730923-89730945 GGACTGATCCTCTGTCTTTTAGG - Exonic
1013567248 6:111379368-111379390 AGAGGCATACTCAGTCTTTCAGG + Intronic
1013652789 6:112212847-112212869 TCACACATCCTTAGTCTTACAGG + Intronic
1017630423 6:156391522-156391544 GGAAACAGCCTGAGTTTTTCAGG - Intergenic
1020458397 7:8400418-8400440 AGACAGCTCCTCAGTATTTCCGG + Intergenic
1022920784 7:35012062-35012084 GGACACAGCTTCAAGCTTTCAGG - Intronic
1023628888 7:42143201-42143223 TGACCCAACATCAGTCTTTCTGG + Intronic
1024969603 7:55056197-55056219 GGAAAAATCATCAGTATTTCTGG + Intronic
1027858443 7:83543429-83543451 GGACACATAGGCAGTCTCTCTGG - Intronic
1035205707 7:157292799-157292821 GGACACAGCCTCACCCTATCAGG + Intergenic
1037017163 8:13923259-13923281 GGAAACATCATCAGAGTTTCAGG - Intergenic
1037023634 8:14005228-14005250 GTACAAATATTCAGTCTTTCAGG - Intergenic
1037682349 8:21108052-21108074 GGACAAATCCTCAGAATTTTAGG - Intergenic
1037970197 8:23166213-23166235 GAAGACATCATCAGTTTTTCAGG - Intergenic
1039427360 8:37496644-37496666 GGACACATAATAAGTCTTTCTGG - Intergenic
1041627047 8:60042118-60042140 GGAAACACACTCAGCCTTTCTGG + Intergenic
1041866701 8:62582319-62582341 AGACACATTCTCTGTCTTCCTGG + Intronic
1043502483 8:80872081-80872103 GGACACACTTTCAGTATTTCTGG + Intronic
1047481151 8:125284253-125284275 GAAGACATACTCTGTCTTTCAGG - Intronic
1048218837 8:132522496-132522518 GGACACTTCCTCTTTCTTTAAGG + Intergenic
1048712216 8:137224955-137224977 AGATACATCCTCAGTATCTCAGG + Intergenic
1051753842 9:20373807-20373829 GTATTCATCCACAGTCTTTCTGG - Intronic
1052557876 9:30042290-30042312 GGAAACATTCTCATTTTTTCTGG - Intergenic
1055509116 9:76977399-76977421 TGCCACTTCCTGAGTCTTTCAGG - Intergenic
1056299472 9:85226775-85226797 TGACCCATCCTCTGTCTTTAAGG + Intergenic
1058750612 9:108035273-108035295 GGACACATCCTTTAGCTTTCTGG + Intergenic
1061215364 9:129218567-129218589 GGTCACCTCCTCAGTTTTCCTGG - Intergenic
1187673618 X:21693195-21693217 GGACACATCCCCAGTCTTTATGG + Intergenic
1190761278 X:53440187-53440209 GAATAGATCCTCAGTCTCTCAGG - Intergenic
1193229131 X:79022591-79022613 TGACACATGCTCAGTTTTTGGGG + Intergenic
1193793140 X:85841073-85841095 GGGCACATCCTCAGACCTCCAGG - Intergenic
1195275041 X:103273954-103273976 GGACATCTTCTAAGTCTTTCTGG + Exonic
1196897630 X:120353361-120353383 GGACAAATCATCAGGCCTTCTGG - Intergenic
1198190150 X:134296017-134296039 TGCAACATCCTCAGCCTTTCAGG + Intergenic