ID: 1105421512

View in Genome Browser
Species Human (GRCh38)
Location 13:20256451-20256473
Sequence CTCTTCCTGATATAAATGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105421510_1105421512 14 Left 1105421510 13:20256414-20256436 CCCGGTTGTTCTTAATGAACTCT 0: 1
1: 0
2: 0
3: 13
4: 139
Right 1105421512 13:20256451-20256473 CTCTTCCTGATATAAATGTCTGG 0: 1
1: 0
2: 0
3: 6
4: 183
1105421511_1105421512 13 Left 1105421511 13:20256415-20256437 CCGGTTGTTCTTAATGAACTCTC 0: 1
1: 0
2: 0
3: 15
4: 170
Right 1105421512 13:20256451-20256473 CTCTTCCTGATATAAATGTCTGG 0: 1
1: 0
2: 0
3: 6
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105421512 Original CRISPR CTCTTCCTGATATAAATGTC TGG Intergenic
902868700 1:19298951-19298973 CTGTTACTGATATAACTGTTTGG - Intergenic
904013338 1:27402749-27402771 CACTTCCTGCTCTAAAGGTCTGG + Intergenic
908010527 1:59772285-59772307 GTGTTCCTGATATAAATAGCAGG - Intergenic
910312770 1:85844473-85844495 CTCTTCTTGAATTAAATGTCTGG - Intronic
912282814 1:108334612-108334634 CTCTTCCTGAAACAGATGTATGG - Intergenic
916329979 1:163604561-163604583 CTCTCCATGATAAACATGTCTGG - Intergenic
917044312 1:170840770-170840792 TTCTTCCTGTTACAAATGACAGG + Intergenic
918573412 1:186025855-186025877 ATCTTCCTGATACAAATCACAGG + Intronic
918652967 1:186988734-186988756 AACTTCCTGATACAAATGTAGGG + Exonic
919738484 1:200968439-200968461 ATATTCCTGATACAAATATCAGG + Intergenic
924378898 1:243442814-243442836 TTCTTCCTGATTTAAATGTTTGG + Intronic
924402555 1:243701829-243701851 CTATTCCTGACATACATGTGAGG - Intronic
1063152742 10:3351822-3351844 CTCTTCCTCATCTCAATGCCTGG + Intergenic
1063197621 10:3758336-3758358 CTTTTCCTGATAGAAATGCTGGG - Intergenic
1066170274 10:32835990-32836012 CTCTATTTGATAAAAATGTCAGG + Intronic
1067011065 10:42714341-42714363 CTCTTCCTAATATAGCTTTCTGG - Intergenic
1067579784 10:47435790-47435812 ATCATCCTGATATCAAAGTCTGG - Intergenic
1068507725 10:57924264-57924286 CTCTGTATCATATAAATGTCTGG + Intergenic
1070411425 10:76145171-76145193 CTCATCCTGATACCAAAGTCTGG - Intronic
1071846698 10:89528033-89528055 ATCTTTCTTATATAAAAGTCTGG + Intronic
1073442452 10:103560419-103560441 CTCTGGCTGCTAGAAATGTCAGG + Intronic
1074616191 10:115070681-115070703 CTCTTCCTTTCATAATTGTCAGG + Intergenic
1075580403 10:123613476-123613498 CTCCTCCTGATAGAAGCGTCAGG + Intergenic
1080347262 11:31338853-31338875 TTCTTACTCATATAAAAGTCTGG - Intronic
1080724088 11:34877634-34877656 TTATTCCTTATATAAATTTCAGG - Intronic
1081323339 11:41717117-41717139 CTCCACCTGCTAGAAATGTCAGG - Intergenic
1083199464 11:61111359-61111381 ACGTTCCTGGTATAAATGTCAGG - Intronic
1085051575 11:73382808-73382830 CTCTGCCCGAGATAACTGTCTGG + Intronic
1090344391 11:126056779-126056801 TTCTTCCTGATATAAGTGCTTGG + Intronic
1091184243 11:133633475-133633497 CTCTTCCTGATATATGAATCAGG + Intergenic
1091989062 12:4939864-4939886 CTCTGGCTGTTCTAAATGTCGGG + Intergenic
1095247002 12:39934874-39934896 CTCTTCCTGCCATGAATGGCAGG + Intronic
1096139652 12:49232489-49232511 CTATTCCTGATACAGAAGTCAGG + Intronic
1098540862 12:71655682-71655704 ATCTTGCTGATAAAAGTGTCTGG - Intronic
1101236065 12:102791660-102791682 CTTTTCCTGAGATTGATGTCTGG - Intergenic
1101755207 12:107616211-107616233 CCATTCCTGATTTAAAGGTCGGG - Intronic
1102398229 12:112605891-112605913 CTCTTCCTGAAATAATTATATGG + Intronic
1104028008 12:125043224-125043246 CTCTTCATGATGTTCATGTCAGG + Intergenic
1105421512 13:20256451-20256473 CTCTTCCTGATATAAATGTCTGG + Intergenic
1107816001 13:44244871-44244893 CTCTTACTGCTGTAAAAGTCAGG + Intergenic
1108233883 13:48380977-48380999 CTGTTCCTGATATAAGTTTAGGG + Intronic
1108751685 13:53453844-53453866 CTCTTTCTAAAATAAATGTGTGG - Intergenic
1108782123 13:53849025-53849047 CTCTTCCTGATAGTAATGTGGGG - Intergenic
1111696217 13:91627516-91627538 CTATTCCTAATAGATATGTCTGG - Intronic
1111834046 13:93365227-93365249 CTCTTCCTGATATAAGTACGTGG + Intronic
1115223750 14:31082986-31083008 CTCTTCCTGTTTTAGATGTAAGG - Intronic
1116978094 14:51138321-51138343 CACTTCCTCCAATAAATGTCCGG - Intergenic
1121629458 14:95411922-95411944 GTCTTCCTGGTAAAAATGTGTGG - Intronic
1123687639 15:22810685-22810707 CTCTTCCTGATATACGTAGCTGG + Intronic
1127453544 15:59138664-59138686 ATGTTCCTGATTTAAATGTATGG - Intronic
1127462381 15:59211383-59211405 CTCTACCACATATAAAGGTCTGG - Intronic
1130037371 15:80373608-80373630 CTCTCTCTGATATCAATGTGGGG - Exonic
1133725834 16:8536724-8536746 CTTTTCCTGAGCTAAATGCCTGG - Intergenic
1136001813 16:27300316-27300338 ATCTTGCTGAAATAAATTTCTGG + Intergenic
1137689763 16:50414827-50414849 ATCTTCCTGGGAGAAATGTCAGG + Intergenic
1138258689 16:55596320-55596342 ATCATCCTGATACAAAAGTCTGG + Intergenic
1139327797 16:66165495-66165517 CTCATTCTGCTATAAATGACAGG - Intergenic
1140566640 16:76049838-76049860 CTCATCTTTATATAAATTTCAGG + Intergenic
1140616229 16:76667799-76667821 CTCTTCCTGCTATGAATTTTTGG - Intergenic
1146328819 17:31910490-31910512 CTCTTCCCCAGATAAATGTATGG + Intergenic
1148604487 17:48918673-48918695 CTCCTCCTGAAATGAATGTTTGG - Intronic
1155634010 18:27929481-27929503 CACTTTTTGATATAAATGTAAGG + Intergenic
1155996817 18:32339266-32339288 CCCTTGCTGATATGAATGCCAGG + Intronic
1157336287 18:46739862-46739884 CTCTTCCAGGTATAAAGGTCAGG + Intronic
1163576734 19:18115311-18115333 CTCTCCCTGCTACAGATGTCAGG + Intronic
1166761578 19:45227695-45227717 GTCTTGCTGATATAGGTGTCAGG + Exonic
1167742470 19:51332354-51332376 CTCTTGCTGATCTAACTGTGTGG - Exonic
926227382 2:10977990-10978012 CTCTTCCTTTGAAAAATGTCAGG - Intergenic
926460337 2:13122068-13122090 CTCTTCTTCATTTAAATGTGAGG + Intergenic
926730051 2:16029975-16029997 CTCTGCCTATTATAAAAGTCAGG - Intergenic
928247069 2:29639767-29639789 CTCTTGTAGATTTAAATGTCAGG - Intronic
929977335 2:46647536-46647558 CTATTTCTTACATAAATGTCTGG + Intergenic
930513570 2:52377471-52377493 ATCATCCTGATATAAAAATCTGG - Intergenic
933450098 2:82438204-82438226 CTCTTCCTTATATTCATGCCTGG + Intergenic
933638802 2:84737308-84737330 ATCATCCTGATACAAATATCTGG - Intronic
940101069 2:150039059-150039081 ATCATCCTGATATGAAAGTCTGG + Intergenic
941457417 2:165725866-165725888 CTATTCCTGATAAGAATGTATGG + Intergenic
941460117 2:165760629-165760651 CTCTTCATTTTCTAAATGTCTGG + Intronic
943202124 2:184841813-184841835 CTCTTCTTGAGAGCAATGTCAGG + Intronic
943903072 2:193465872-193465894 AGCTTCCTGATAAAAATCTCAGG - Intergenic
944497278 2:200319709-200319731 CTGTTCCTGATTTACATGTGAGG - Intronic
946797278 2:223369210-223369232 TTCTTCTTGATAAAAATGGCAGG - Intergenic
1172138643 20:32705894-32705916 CTCTTCATGATATAAAAGCAAGG + Intronic
1174183223 20:48687938-48687960 CTCTTCCTGAGTTACATGTGAGG - Intronic
1175811500 20:61860831-61860853 CTCCTGCAGATATAAATGCCAGG - Intronic
1177106550 21:16963455-16963477 ATCAGCCTGATATAAAAGTCTGG - Intergenic
1177629271 21:23705729-23705751 CTTTTCATAATATGAATGTCAGG - Intergenic
1181689132 22:24548707-24548729 CTCTCCATGATAGTAATGTCTGG - Intronic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
1184421621 22:44385618-44385640 CTCCTCCTTATAGAAATGACCGG - Intergenic
949661729 3:6286649-6286671 AACTTCCTGATGTAAATGTTGGG - Intergenic
950571144 3:13800815-13800837 GTCTTCCTCATTTAAATGTGGGG - Intergenic
951333767 3:21396681-21396703 ATATTCCTGATATATATATCAGG + Intergenic
952148619 3:30561660-30561682 CTATTCCTGATCCAAATGTCAGG - Intergenic
954521077 3:51227232-51227254 ATCTTCCTGGTAGGAATGTCTGG - Intronic
956012193 3:64843825-64843847 CTCTTCCTAAGAGAAATGGCTGG + Intergenic
956758029 3:72409236-72409258 ATCTACCTGATTTAAATCTCTGG + Intronic
957451633 3:80388341-80388363 CTCTTCCTGCTAATCATGTCTGG + Intergenic
960739926 3:120821789-120821811 CTATTCCTGGTATCAATTTCAGG + Intergenic
962189667 3:133297221-133297243 CTCTGCCTGAGACAGATGTCAGG + Intronic
964192292 3:154017005-154017027 TTCCTCCTGATATAAAGGACAGG + Intergenic
965140194 3:164823103-164823125 CTCATCCTGAGATAAGTTTCAGG - Intergenic
965250227 3:166333120-166333142 CTCCTGCTGCTATCAATGTCGGG + Intergenic
965653961 3:170964163-170964185 CTCATCCTCATATACATATCTGG - Intergenic
965654145 3:170965890-170965912 ATCATCCTGACAGAAATGTCAGG + Intergenic
966702014 3:182863887-182863909 TTCTTCCTGATCTACATGTGTGG + Intronic
971102392 4:23482310-23482332 CTCTTTCTTTTATAAATTTCTGG - Intergenic
972177880 4:36429617-36429639 ATCATCCTGATATAAAAATCTGG + Intergenic
975055995 4:69929630-69929652 ATCATCCTGATATCAATGCCTGG - Intergenic
976552268 4:86410383-86410405 ATCATCCTGATACAAAAGTCTGG - Intronic
976993753 4:91403877-91403899 ATCATCCTGGTATCAATGTCTGG - Intronic
977427077 4:96880446-96880468 GTCTTCCTGATAGAAATGGGAGG + Intergenic
981195332 4:141913048-141913070 CAGTTACTGATATACATGTCTGG - Intergenic
982348069 4:154383714-154383736 GTCTGGCTGATATAAATGGCTGG - Intronic
982874780 4:160633269-160633291 CTATTCCAGATAAATATGTCTGG + Intergenic
983232675 4:165145387-165145409 CTCTTCATTATTTAAATGCCGGG - Intronic
983691001 4:170469145-170469167 CTCTTTGTGGTATAAATTTCTGG + Intergenic
986434289 5:7713149-7713171 CTCTTCTTAATATTAATGTGTGG + Intronic
986797782 5:11229134-11229156 TTCTTTTTGATAGAAATGTCCGG - Intronic
987236571 5:15948364-15948386 CTCTTCCTGCTATATTTTTCCGG - Intergenic
987348553 5:17000288-17000310 GTCTTCTTGAAAGAAATGTCAGG + Intergenic
987438002 5:17921662-17921684 TTCCTCCTGGTATAAATGTGAGG + Intergenic
990207251 5:53442590-53442612 CTTTTCCAGAAATGAATGTCAGG - Intergenic
990516027 5:56531571-56531593 ACCTTCCTGATGGAAATGTCTGG - Intronic
991508503 5:67351108-67351130 CTCTTCCTGACCTCAATGCCAGG - Intergenic
996894709 5:128466397-128466419 CTCTTCCTCCTTTAAATGTTAGG - Intronic
997160475 5:131603769-131603791 TTCTTCCTGATATAATTATTTGG + Intronic
998981722 5:147711424-147711446 CTCTGCCTGATTGAAAGGTCTGG - Intronic
999867448 5:155716419-155716441 ATCATCCTGATACAAATGCCCGG - Intergenic
1000201901 5:159019320-159019342 GTCTTGTGGATATAAATGTCGGG + Intronic
1001499830 5:172222097-172222119 CTCTTCCTGAATTAAATATCTGG + Intronic
1003420519 6:5953594-5953616 CTTTTCCTGATGTAAATGAACGG + Intergenic
1003527582 6:6910878-6910900 CTGTTCCTGTTTTAAATGTGAGG + Intergenic
1004543357 6:16572975-16572997 GTCCTCTTGATAAAAATGTCAGG - Intronic
1005674313 6:28138079-28138101 CTCTTCCTGTCAGAAATGTATGG + Intergenic
1008210614 6:48719864-48719886 TTCTTCTTGATATATATGGCTGG + Intergenic
1008695446 6:54030830-54030852 CTTTGCTTCATATAAATGTCTGG - Intronic
1009472296 6:64042749-64042771 CTCTTCCTGATCCAAAGATCAGG + Intronic
1010004198 6:70977809-70977831 ATCATCCTGATATCAAAGTCTGG + Intergenic
1011543848 6:88463574-88463596 CTGTTGCTGATGTAAATCTCAGG + Intergenic
1012864861 6:104606693-104606715 CTCTTCCTGAAACACATCTCTGG + Intergenic
1013423189 6:109985175-109985197 CTGGTCCTAATAAAAATGTCTGG + Intergenic
1014485866 6:121998438-121998460 ATCATCCTGATACAAAAGTCTGG - Intergenic
1015402592 6:132802677-132802699 CTCTGACTGATAGAAATGCCAGG - Intergenic
1016109709 6:140207125-140207147 CTCTTCCATCTATAAATTTCAGG - Intergenic
1021093085 7:16505652-16505674 CTCTTCCTGATTTACATGAGTGG - Intronic
1022283339 7:28932496-28932518 CTCTTCCTCAAAGAAAAGTCCGG + Intergenic
1022307904 7:29166388-29166410 TTCTTTCTGATTTAAGTGTCTGG + Intronic
1026886845 7:73954820-73954842 ATCTTTCTGATAAAAATTTCAGG + Intergenic
1027581251 7:79998589-79998611 CTATTCCTGGCAAAAATGTCAGG + Intergenic
1028442411 7:90879631-90879653 CTGTTCCTAATGTAAATGACAGG + Intronic
1028824817 7:95259469-95259491 CCCTTATGGATATAAATGTCTGG - Intronic
1029219806 7:98979223-98979245 TTTTTACTGATATAAATGACTGG - Intronic
1030026957 7:105333874-105333896 CATTTTCTGATATAAATGACTGG - Intronic
1030379260 7:108793737-108793759 CTATTCCTAAGATAAATGTTTGG + Intergenic
1031727408 7:125258234-125258256 CTCTTACTGAGATAAATGCATGG - Intergenic
1033522854 7:142179841-142179863 ATCATCCTGATATCAATATCTGG - Intronic
1034330200 7:150276140-150276162 ATCTTTCTGACATAAATTTCAGG - Intronic
1034667854 7:152833711-152833733 ATCTTTCTGACATAAATTTCAGG + Intronic
1035561198 8:604854-604876 CTTTTCCTGACATGTATGTCCGG + Intergenic
1037452628 8:19031893-19031915 CTCTTCCTGATACAGTTGTTTGG + Intronic
1039873782 8:41568384-41568406 CTCTTCATCATATAAAAGTGTGG + Intergenic
1041041627 8:53852048-53852070 CTGTTCCTGATATCAAGGTAAGG + Exonic
1041923184 8:63205838-63205860 ACCTTGCTGATATAAATGTGGGG + Intronic
1042096835 8:65225336-65225358 CTCTTCCTGTTATTAATCTAAGG - Intergenic
1044440511 8:92218547-92218569 ATCTTCCTGATACCAATGCCTGG - Intergenic
1045969391 8:108062693-108062715 ATCATCCTGATATCAAAGTCTGG + Intronic
1046039701 8:108887506-108887528 TTCTTCCAGATATAGATGCCAGG + Intergenic
1046810911 8:118532419-118532441 CTCATCCTGATATCAAAGCCTGG - Intronic
1047355678 8:124119429-124119451 ATCCTCATCATATAAATGTCAGG + Intronic
1047795745 8:128253696-128253718 CTATTCCTGATAAAAATTTATGG + Intergenic
1050854013 9:10327763-10327785 CTTGTCCTGATGTAAATGACTGG - Intronic
1050986081 9:12084692-12084714 CTCTTCCTGAAAACAATGTTTGG - Intergenic
1051897427 9:22002938-22002960 ATCTTCTTGGAATAAATGTCAGG + Exonic
1052572559 9:30245927-30245949 TTCTTCATTAAATAAATGTCAGG + Intergenic
1054907695 9:70425138-70425160 CTCTTCTTAAAATACATGTCCGG + Intergenic
1058247796 9:102652629-102652651 CTCTTCCTAACAGGAATGTCAGG + Intergenic
1059197439 9:112383483-112383505 CACTTCCTGAAAGAAATCTCAGG - Intronic
1059721542 9:116964786-116964808 CATTTCCTGAAATAAATTTCTGG - Intronic
1060068177 9:120523085-120523107 CTCTTCAGGTTATACATGTCAGG - Intronic
1185787974 X:2906744-2906766 CTCTTCCTCTTCTAAATCTCAGG - Exonic
1186808122 X:13160592-13160614 CTCTTTCTGAGACAGATGTCTGG - Intergenic
1190930426 X:54944877-54944899 TTATTTCTGATATAAATGGCTGG - Intronic
1191230778 X:58092008-58092030 CTCATCCTGATATGAAAGCCTGG - Intergenic
1191710229 X:64142157-64142179 ATCATCCTGATATTAAAGTCTGG + Intergenic
1194150082 X:90313698-90313720 CACTTCTTGATATAAATATTTGG + Intergenic
1198183702 X:134234539-134234561 CTCTACCTGAAATAAAGGTTTGG + Intergenic
1200078278 X:153562708-153562730 TTCTTCCTGATCTAATTGTGGGG - Intronic
1200496509 Y:3890776-3890798 CACTTCTTGATATAAATATTTGG + Intergenic
1201986304 Y:19971725-19971747 CTCTTCCTGATTTCAGTATCAGG - Intergenic