ID: 1105421706

View in Genome Browser
Species Human (GRCh38)
Location 13:20258257-20258279
Sequence GAAGCTTCTCCCAGTGGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 249}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105421700_1105421706 19 Left 1105421700 13:20258215-20258237 CCTGACTCCTGGCTCCATGGGCT 0: 1
1: 0
2: 5
3: 37
4: 299
Right 1105421706 13:20258257-20258279 GAAGCTTCTCCCAGTGGGAGTGG 0: 1
1: 0
2: 1
3: 24
4: 249
1105421701_1105421706 12 Left 1105421701 13:20258222-20258244 CCTGGCTCCATGGGCTACAGAAG 0: 1
1: 0
2: 3
3: 93
4: 579
Right 1105421706 13:20258257-20258279 GAAGCTTCTCCCAGTGGGAGTGG 0: 1
1: 0
2: 1
3: 24
4: 249
1105421702_1105421706 5 Left 1105421702 13:20258229-20258251 CCATGGGCTACAGAAGCTGCTCT 0: 1
1: 0
2: 1
3: 22
4: 236
Right 1105421706 13:20258257-20258279 GAAGCTTCTCCCAGTGGGAGTGG 0: 1
1: 0
2: 1
3: 24
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105421706 Original CRISPR GAAGCTTCTCCCAGTGGGAG TGG Intergenic
900335936 1:2163462-2163484 GAACCTTCTCCCAGTGGCTGGGG - Intronic
900996670 1:6126680-6126702 GCAGCTTCTCCCAGTAGTCGGGG + Exonic
904075174 1:27836263-27836285 AAAGCTTCTTCCAGTGCTAGTGG - Intronic
904807576 1:33142608-33142630 CAAGCTTCTCCCAGGGTCAGAGG - Intergenic
904963713 1:34355330-34355352 GAAGCACCACCCAGTGGGACTGG - Intergenic
905280375 1:36845474-36845496 TAAGCCTCTCCCAGTGTGACAGG + Intronic
905755244 1:40503769-40503791 GAAGCTACTAGCAGTGGAAGAGG + Intergenic
905848886 1:41258218-41258240 GAAGGAGCTCCCCGTGGGAGGGG - Intergenic
906307225 1:44727024-44727046 GCACCTTCTCCCAGGGGGAGGGG + Intergenic
906316778 1:44791591-44791613 GAAGCCTCTGCCAGAGGAAGAGG + Intergenic
908298549 1:62737807-62737829 GAAGTTTCTCCCTCTGAGAGAGG + Intergenic
908769426 1:67582837-67582859 CAAGGTTCTCCCAGTGAGAGGGG - Intergenic
916524559 1:165597577-165597599 GAAGTTACTCCCGGTGGGATTGG - Intergenic
916871957 1:168925078-168925100 GAAGCTACTTCCATTGAGAGAGG - Intergenic
917585862 1:176425901-176425923 GACACAGCTCCCAGTGGGAGGGG - Intergenic
917586011 1:176426715-176426737 GAAGGAGCCCCCAGTGGGAGGGG - Intergenic
918896358 1:190352306-190352328 TAAGCTTCCCCCAGTGGAACAGG - Intronic
921188160 1:212687142-212687164 ATTGTTTCTCCCAGTGGGAGGGG - Intronic
921582106 1:216907057-216907079 GGAGATTCTCCCAGTGTGACGGG - Intronic
922215874 1:223519691-223519713 GCAGCTTCTCCCTGTGGATGTGG + Intergenic
922384951 1:225073332-225073354 GATGGTACTCCCAGAGGGAGGGG - Intronic
923195477 1:231662382-231662404 GATGCAGCTCCCAGGGGGAGAGG - Intronic
924655765 1:245974134-245974156 GAGGATACTCACAGTGGGAGTGG - Intronic
1063711992 10:8488102-8488124 GATCCTTCTCCCAATGAGAGGGG - Intergenic
1063724007 10:8616511-8616533 GAAGCTCCTGACAGTAGGAGAGG - Intergenic
1063949930 10:11212871-11212893 GGAGCTTCTGCCAGTGGCAGTGG - Intronic
1065847899 10:29761332-29761354 GGAGCTTTTCCCAGTGACAGAGG + Intergenic
1067578775 10:47425984-47426006 GATGGAGCTCCCAGTGGGAGGGG + Intergenic
1068072736 10:52216291-52216313 TAAGCTTCTCACTCTGGGAGAGG + Intronic
1069767135 10:70870903-70870925 CAGTCTTCTCCCAGTTGGAGTGG + Intronic
1071917981 10:90317417-90317439 GGAGCTTATGCCAGTGGGTGTGG - Intergenic
1074640852 10:115378547-115378569 CAAGCTTCTCACAGTGGCAGAGG + Intronic
1075555392 10:123427229-123427251 GAGGCATCTCTCAGTGCGAGGGG - Intergenic
1075893998 10:125978722-125978744 GAAGGAGCTCCCAGGGGGAGGGG - Intronic
1076491727 10:130866417-130866439 GAAGCTTCCACCCCTGGGAGAGG - Intergenic
1076520599 10:131078526-131078548 GATTCTTCTCCCACTGGGAAGGG - Intergenic
1076562251 10:131374956-131374978 GGAGCTTCTTCAAGTGGGTGGGG - Intergenic
1076562699 10:131377298-131377320 GGAGCTTCTTCAAGTGGGTGGGG + Intergenic
1078567361 11:12428003-12428025 GAGACTTCTCCCAGGAGGAGGGG - Intronic
1078816145 11:14823919-14823941 GAAAGAACTCCCAGTGGGAGGGG + Intronic
1078921337 11:15833480-15833502 GCAGCTTCTCCCAGTGTGTCTGG + Intergenic
1079533690 11:21485630-21485652 TAAGCTGCTCCCACTGAGAGTGG + Intronic
1079967304 11:26994711-26994733 GGCGCTGCTCCCAGGGGGAGGGG + Exonic
1080253974 11:30268538-30268560 GAGGCATTCCCCAGTGGGAGCGG - Intergenic
1080260526 11:30344931-30344953 TAAACCTCTCACAGTGGGAGGGG + Intergenic
1080555489 11:33412679-33412701 ATAGCTTCTCCCACTGGGTGAGG + Intergenic
1082254872 11:50022758-50022780 GCTGTTTCTCCCAGTGAGAGAGG - Intergenic
1082896793 11:58200505-58200527 TAAGTTTCTCCCATTTGGAGTGG - Intergenic
1084190592 11:67497028-67497050 GAAGCTCCTCCCAGTGGCTTTGG + Intronic
1084337192 11:68466112-68466134 GATGCTACTTCAAGTGGGAGGGG + Intronic
1084458925 11:69285526-69285548 GGAGCTTATTCTAGTGGGAGAGG - Intergenic
1084676466 11:70638292-70638314 CAAGCTACTCCCAGTGACAGAGG + Intronic
1085026001 11:73236961-73236983 GAGGGCTCTCCCAGAGGGAGAGG - Intergenic
1085515330 11:77108255-77108277 GGAGCTCCTCCCAGTGGGCAGGG + Intronic
1086840104 11:91674477-91674499 GAAGCCTCTTGCAGTGGGAGCGG - Intergenic
1087297348 11:96391807-96391829 GAAGATTCTCCCTATGGTAGAGG + Exonic
1087938346 11:104062083-104062105 TAAGCTTTTCTGAGTGGGAGGGG + Intronic
1092579127 12:9820184-9820206 GATGGAGCTCCCAGTGGGAGAGG + Intergenic
1093895015 12:24564616-24564638 GAAGCTTTTCTTTGTGGGAGTGG - Intergenic
1094330045 12:29281341-29281363 GAAGCTTCCTACACTGGGAGTGG + Intronic
1095824400 12:46516464-46516486 GAGGGTGCTCCCAGAGGGAGGGG - Intergenic
1096032723 12:48434501-48434523 GAGGCATCCCCCAGTAGGAGGGG + Intergenic
1098946739 12:76598310-76598332 GAAGGTTTTTCCAGTAGGAGGGG + Intergenic
1100437595 12:94585736-94585758 GAAGCTTTTCCCAGTCCCAGTGG + Intronic
1102545511 12:113652138-113652160 GGACCTTCCCCCAGTGGAAGTGG + Intergenic
1104199773 12:126577213-126577235 GAAGAATATCCCAGGGGGAGTGG - Intergenic
1105421706 13:20258257-20258279 GAAGCTTCTCCCAGTGGGAGTGG + Intergenic
1105767026 13:23570404-23570426 GAAGCTTTTCCTAGTGCCAGCGG - Intronic
1110808747 13:79789294-79789316 GATGGAGCTCCCAGTGGGAGAGG + Intergenic
1113809846 13:113132575-113132597 GGAGCTACACTCAGTGGGAGAGG - Intronic
1114866094 14:26597451-26597473 GAACCTTCTCCCGGTAGCAGCGG - Exonic
1120036326 14:79702652-79702674 GAAACTTTGCCAAGTGGGAGAGG + Intronic
1121008928 14:90508592-90508614 GAAGCTTCTCCTGGTGGCAGGGG + Intergenic
1121508517 14:94494562-94494584 GAAGATGTTCCCAGTGGGAGGGG - Intronic
1123024421 14:105418015-105418037 GCTCCTTCTCCCAGTGGGAGTGG - Intronic
1125175458 15:36817199-36817221 GCAGCCTCTTCTAGTGGGAGGGG - Intergenic
1125484045 15:40100182-40100204 GAAGACTCTCCCAAGGGGAGGGG + Intronic
1125715870 15:41819626-41819648 GACTCATCTCCCAGTGGGACAGG - Exonic
1127662384 15:61112435-61112457 AAAGCCTCCCCCAGGGGGAGTGG + Intronic
1129488558 15:75902089-75902111 GCACCTTCTCCCAGAGGGATGGG + Intergenic
1129673612 15:77620733-77620755 GAAGAATCTCTCTGTGGGAGGGG + Intronic
1130539052 15:84808703-84808725 GAAGCTTCTCCTAGTTAGAATGG - Intergenic
1131158049 15:90087077-90087099 GACGCTGCTCCCTGTGGGGGTGG - Intronic
1131692099 15:94838233-94838255 GAAGTTTCTGGCAGTGGGACAGG + Intergenic
1132632671 16:927395-927417 GATGCTTCTCCCCCAGGGAGGGG + Intronic
1132659949 16:1056837-1056859 GAAGAGGCTCTCAGTGGGAGGGG + Intergenic
1132687797 16:1169551-1169573 GAAGTGTCTCTCGGTGGGAGAGG - Intronic
1132870854 16:2115198-2115220 AGAGCTTCTCCCACTGGGAGAGG + Intronic
1133166795 16:3953707-3953729 GAAGCTTCAGCCAGTGTGTGTGG + Intronic
1134521676 16:14921706-14921728 AGAGCTTCTCCCACTGGGAGAGG - Intronic
1134709346 16:16320357-16320379 AGAGCTTCTCCCACTGGGAGAGG - Intergenic
1134716558 16:16360386-16360408 AGAGCTTCTCCCACTGGGAGAGG - Intergenic
1134950256 16:18348288-18348310 AGAGCTTCTCCCACTGGGAGAGG + Intergenic
1134958192 16:18391773-18391795 AGAGCTTCTCCCACTGGGAGAGG + Intergenic
1138238930 16:55410890-55410912 GAAGCCTCTGGCAGGGGGAGAGG + Intronic
1139938755 16:70590138-70590160 GAAGCTGCTCACGGCGGGAGAGG + Intronic
1141409989 16:83826514-83826536 GAAGCTTCTCATCCTGGGAGCGG - Intergenic
1141438655 16:84015271-84015293 GATGCTTCTTCCAGTGGAAAAGG - Intronic
1142271584 16:89092530-89092552 CAAGCCTGTCCCAGTGGCAGAGG + Intronic
1142613398 17:1121513-1121535 GCAGCTGCTCACAGTGGGATGGG + Intronic
1142901900 17:3017411-3017433 GAAGCCCCTGCAAGTGGGAGGGG + Intronic
1147985851 17:44307720-44307742 GCAGCTTCTCCCCGGGGGTGGGG - Intergenic
1151341398 17:73473297-73473319 GGAGCTTCTGACAGTGGGACAGG + Intronic
1151461971 17:74259866-74259888 GACGCTGCCCCCAGTGTGAGGGG + Intronic
1152046955 17:77943063-77943085 GAAGCTCTGCCCAGTGGCAGAGG + Intergenic
1153848348 18:9069886-9069908 GCAGCTTATCCCAGAGGAAGTGG - Intergenic
1153953700 18:10077961-10077983 GAAGCTTCACCAGGAGGGAGGGG - Intergenic
1155270722 18:24139177-24139199 GGAGTCTCTCGCAGTGGGAGAGG + Intronic
1155959109 18:31978676-31978698 GATGCTTCTCCTCATGGGAGGGG + Intergenic
1156562170 18:38137554-38137576 GAAGCTCTTCCCAGTAAGAGAGG - Intergenic
1158157436 18:54441920-54441942 GAAGCAGCTCCCAGTGGGCATGG + Intergenic
1158501129 18:58002965-58002987 GAATCTTCTGCCAGTGTGAGGGG + Intergenic
1159359496 18:67381846-67381868 GAAGGAGCTCCCAGAGGGAGGGG - Intergenic
1159657298 18:71047393-71047415 GTAGCTTAGACCAGTGGGAGTGG - Intergenic
1159917082 18:74197709-74197731 CTGGCTTCTCCAAGTGGGAGGGG - Intergenic
1160358541 18:78249483-78249505 TAAGCTTTTCGCAGTGAGAGGGG + Intergenic
1161218499 19:3106613-3106635 GTGGCTTCACCCAGCGGGAGTGG + Intronic
1162739301 19:12765071-12765093 GAAGCTTCTGCCTGTGGGCCGGG + Exonic
1163940773 19:20491039-20491061 GAGGCATCTCCCAGTAGGGGTGG + Intergenic
1166593849 19:44027133-44027155 GAACCTGCTCTCAGTGGGTGAGG + Exonic
1166601639 19:44100911-44100933 GAACCTGCTCTCAGTGGGTGAGG + Exonic
1166603414 19:44118298-44118320 GAACCTGCTCTCAGTGGGTGAGG + Exonic
1166990875 19:46691976-46691998 GAAGCTTGTCCTAGGGAGAGGGG + Exonic
1167216664 19:48170039-48170061 GAGGTGTCTCCCAGAGGGAGGGG - Intronic
1167675327 19:50880462-50880484 GGAGCCTTTCCCAGTGGGTGTGG + Exonic
1168162005 19:54516725-54516747 ATATCTTCTCCCAGTGAGAGAGG + Intergenic
925006186 2:444802-444824 ATAGCTTCTGCCAGTGGAAGAGG - Intergenic
925720236 2:6820348-6820370 GAAAAGTCTCCCAGGGGGAGTGG + Intergenic
927235684 2:20872256-20872278 GAGGCATCTCCCAGTAGGGGAGG + Intergenic
927445497 2:23157497-23157519 GACCCATTTCCCAGTGGGAGAGG + Intergenic
928202773 2:29261096-29261118 GCAGCTTCTGAAAGTGGGAGCGG - Intronic
929417421 2:41757499-41757521 GAAGTTTCTCACTGTTGGAGTGG + Intergenic
931798651 2:65736804-65736826 AAATCTTCCCCCAGTGTGAGTGG + Intergenic
932659747 2:73641814-73641836 CTACCTTCTCCCAGTGGCAGAGG - Intronic
932666315 2:73701492-73701514 CTACCTTCTCCCAGTGGCAGAGG - Intergenic
932668586 2:73717892-73717914 CTACCTTCTCCCAGTGGCAGAGG - Intergenic
932873672 2:75428971-75428993 GATGCATCTCCCTGTGGAAGAGG + Intergenic
933024550 2:77238563-77238585 GAAGAGTCTGCCACTGGGAGTGG + Intronic
934676766 2:96254801-96254823 GAGCCTGCTCACAGTGGGAGAGG - Intronic
934734931 2:96685382-96685404 GCAGTTTCTCCCACTGGTAGAGG - Intergenic
937358080 2:121211023-121211045 GGAGCTCCTCCCAGTGGGAGAGG + Intergenic
937853971 2:126659546-126659568 GGACCTGCTCCCAGTGGCAGAGG + Intronic
938342500 2:130544802-130544824 GAAGATTCTCCAGGTGGGAAAGG - Intronic
938347332 2:130575907-130575929 GAAGATTCTCCAGGTGGGAAAGG + Intronic
939162204 2:138604067-138604089 GAAACATCTCACAGTGGAAGAGG + Intergenic
939868297 2:147499432-147499454 TAAAATTCTCCCAGTGGAAGTGG + Intergenic
939875255 2:147570631-147570653 AAAGTTTGTCACAGTGGGAGTGG + Intergenic
941157641 2:161999000-161999022 GAGGCTTCTCCCAGTGAGCAGGG - Intronic
941883587 2:170505794-170505816 GAACCTTCTCCCAGGAGGAGTGG + Intronic
943046430 2:182866806-182866828 GATGCTTCTGCCAGAGGGAGAGG - Exonic
945176142 2:207045373-207045395 GAATTCTCGCCCAGTGGGAGTGG - Intergenic
946144655 2:217720209-217720231 GCAGCCGCTCCCAGTGGGAATGG + Intronic
947472658 2:230412971-230412993 GACGCTTCTCTGACTGGGAGTGG - Intergenic
948585709 2:239018397-239018419 GAATTTGCTCCCAGTGGTAGAGG - Intergenic
1173222545 20:41141585-41141607 GCTGTTACTCCCAGTGGGAGAGG + Intronic
1177146406 21:17411703-17411725 AATTCTTGTCCCAGTGGGAGAGG + Intergenic
1178900404 21:36593451-36593473 GAGGCATGCCCCAGTGGGAGAGG + Intergenic
1180742139 22:18061219-18061241 CAAGAATCTCCCAGAGGGAGAGG + Intergenic
1180802495 22:18638384-18638406 CCAGCTTCTTCCAGTGGGTGGGG + Intergenic
1180853730 22:19033940-19033962 CCAGCTTCTTCCAGTGGGTGGGG + Intergenic
1181219228 22:21356877-21356899 CCAGCTTCTTCCAGTGGGTGGGG - Intergenic
1181732830 22:24859898-24859920 GAAGTTCCTCCCCGGGGGAGGGG + Intronic
1184684968 22:46092202-46092224 GAGGCTTCTCCCATTGTGAACGG - Intronic
949302103 3:2595688-2595710 CTACCTTCTCCCAGTAGGAGGGG - Intronic
950115258 3:10446659-10446681 GAAGCATCTCCCAGGGGGCTGGG - Intronic
950491799 3:13309775-13309797 GAAGCCTCTCCAAATGGAAGTGG + Intergenic
952207580 3:31195643-31195665 GAAGCATCACCCATTGGAAGGGG + Intergenic
952460998 3:33525914-33525936 GAAGGAGCTCCCAGCGGGAGGGG + Intronic
952680795 3:36089080-36089102 GAAGCTTTTTGCAGTGTGAGAGG + Intergenic
954301352 3:49702322-49702344 GAAGCTTCACCCTTTGAGAGAGG - Exonic
954486836 3:50860737-50860759 GAAGGAGCTCCCAGGGGGAGGGG - Intronic
957955890 3:87186562-87186584 GTATCTTCTCCCAGAGGAAGAGG + Intergenic
961004938 3:123398518-123398540 GAAGATTATCCCTGTGGTAGTGG - Intronic
961525216 3:127492502-127492524 GAAGCTTCCAGCAGTGGAAGGGG + Intergenic
961621489 3:128228205-128228227 GCAGCTTCACCCACTGGGACAGG - Intronic
962762687 3:138530567-138530589 GAAGCTTTTGCCACTGCGAGAGG + Intronic
962975567 3:140442933-140442955 CTAGCTTCTTCCAGTAGGAGGGG + Intronic
963781794 3:149493849-149493871 GGAGCTTCTCCCAGAGGAGGTGG + Intronic
965400474 3:168207174-168207196 GAATCTTCTTCTAGTGGGAAAGG + Intergenic
966580349 3:181555146-181555168 GAAGCCTCTCCAGGTGGGAGGGG + Intergenic
966882555 3:184358507-184358529 GAAGCTGTGCCCTGTGGGAGTGG + Intronic
968629511 4:1642741-1642763 AAGGCTGCTCCCAGTGGCAGTGG - Intronic
968632561 4:1659562-1659584 GCAGCTACTCCCAGTGGCACTGG + Intronic
968703436 4:2067278-2067300 GAAGCTGCCCCCGGAGGGAGGGG + Exonic
971105909 4:23524240-23524262 GATACTGCTCCCAGAGGGAGGGG + Intergenic
971267814 4:25110537-25110559 GAAGCTTATCCCACTGGGAAGGG + Intergenic
974972540 4:68847204-68847226 GAAGGAGCTCTCAGTGGGAGTGG + Intergenic
977394197 4:96451072-96451094 GATGGAGCTCCCAGTGGGAGGGG - Intergenic
979170363 4:117594510-117594532 TAGTCTTCTCTCAGTGGGAGTGG + Intergenic
979823638 4:125205359-125205381 GAAGATTCACACAGTGGGAACGG + Intergenic
981250838 4:142598763-142598785 GAGGCAGCTCACAGTGGGAGGGG - Intronic
981606659 4:146547174-146547196 GATGGAGCTCCCAGTGGGAGGGG - Intergenic
983400105 4:167252164-167252186 GAAGATTCTCCCAATGGCAAAGG - Intergenic
985658943 5:1146167-1146189 GAACCTGCTCCCAGCAGGAGGGG + Intergenic
985794309 5:1950494-1950516 GAGGCGTCTCCCAGTGGTTGTGG - Intergenic
986351793 5:6886964-6886986 GATGGTTGTCCCTGTGGGAGGGG + Intergenic
992093384 5:73339124-73339146 GAACCTTCTCCAAAAGGGAGGGG - Intergenic
992269339 5:75050442-75050464 GAAGCTGCTCCCAGAGTGAGAGG - Intergenic
994814684 5:104569937-104569959 GAAGCATATCCCAATGGGATTGG + Intergenic
995063266 5:107834704-107834726 GCAGCTTCTGACAGTGGAAGGGG - Intergenic
997030271 5:130119524-130119546 GGTGCTGCTGCCAGTGGGAGAGG - Intronic
997262201 5:132473884-132473906 TGAGCTTCTCCCAGAGGGAATGG + Intronic
1000423198 5:161060740-161060762 GATGCTTCTGCCACTGGGATGGG + Intergenic
1002082635 5:176746549-176746571 GGAGGGTCTCCCAGTGAGAGCGG + Intergenic
1002983419 6:2164513-2164535 GAGGCTACTCCCATTGGGGGTGG + Intronic
1004298234 6:14433705-14433727 GAAGCCACTACCACTGGGAGTGG - Intergenic
1006392520 6:33766779-33766801 GAAGCTCCACCCAGGGGCAGGGG - Intergenic
1009322818 6:62312756-62312778 GAGGCATCCCCCAGTGGGGGCGG + Intergenic
1010045139 6:71432943-71432965 GAAGCCTGTCCCAGTGGAATGGG - Intergenic
1011391282 6:86856513-86856535 GAAGCCACTGCCAGTAGGAGTGG - Intergenic
1012033120 6:94098476-94098498 GAAGCTTCTATCACTGAGAGTGG - Intergenic
1016579156 6:145609060-145609082 GGAAGTTCTTCCAGTGGGAGAGG + Intronic
1018197248 6:161366170-161366192 GCATCTTCTCACAGTGGAAGAGG - Intronic
1019713116 7:2526355-2526377 GCAGGTTCTCCAGGTGGGAGTGG - Exonic
1020500209 7:8908956-8908978 GGAGTTTCTCACAGTGGAAGAGG + Intergenic
1021818535 7:24473958-24473980 GAGGCTACTCCCAAAGGGAGGGG - Intergenic
1023485656 7:40683543-40683565 GAAGATTCCCACAGTGGGAAAGG - Intronic
1024171793 7:46795475-46795497 GAGGCTTCTTGCAGTTGGAGTGG - Intergenic
1024912393 7:54459850-54459872 GAAAATTTTCCCAGTGGAAGAGG - Intergenic
1027217511 7:76193634-76193656 GAAGCTCCTCCAAGTGGGTGAGG + Intergenic
1028177097 7:87672117-87672139 GATGATGCTCCCAGAGGGAGAGG - Intronic
1029167179 7:98600658-98600680 GACACTTCTCACAGTGGGTGTGG - Intergenic
1029169316 7:98619547-98619569 GAAGCTTCTCCCTGTGTGGTCGG + Intronic
1029835154 7:103301592-103301614 AGAGCTTCTGCTAGTGGGAGTGG + Intronic
1031627290 7:124005315-124005337 GAAGGAGCTCCCAGGGGGAGGGG - Intergenic
1031769690 7:125828520-125828542 CAAGCTTCTCCCATTTGGAATGG + Intergenic
1034123181 7:148645707-148645729 GTTGCCTCTCCCAGTGGGAGAGG + Intergenic
1035024604 7:155817564-155817586 GAACCCTCCTCCAGTGGGAGTGG - Intergenic
1035024632 7:155817663-155817685 GAACCCTCCTCCAGTGGGAGTGG - Intergenic
1035024661 7:155817762-155817784 GAACCCTCCTCCAGTGGGAGTGG - Intergenic
1035077503 7:156190610-156190632 GAATGTCCTCCCAGTGGGCGAGG - Intergenic
1035426986 7:158784543-158784565 GAAGCTAGTCTCAGAGGGAGAGG + Intronic
1037468537 8:19184614-19184636 GCAGGTTGCCCCAGTGGGAGGGG + Intergenic
1037894728 8:22644327-22644349 GAAGCTTTTCCCAGTGGCCTCGG - Intronic
1041887525 8:62828592-62828614 GACGCTTCTCCCATTGAGACAGG + Intronic
1042875372 8:73436273-73436295 GCAGTTTCTCTCAGTGGGTGAGG + Intronic
1043363152 8:79499469-79499491 GAAGGAACTCCCAGGGGGAGAGG - Intergenic
1044174762 8:89106089-89106111 GAAGCTTATGCTAGTGGGGGAGG + Intergenic
1046396833 8:113651163-113651185 GAAGTAGCTCCCAGTGGAAGGGG - Intergenic
1047692107 8:127366415-127366437 GAATTTTCACCCAGTGGCAGGGG - Intergenic
1048203925 8:132400687-132400709 GAGGCTTATCCCAGTGGGGAGGG + Intronic
1050990791 9:12149324-12149346 AAAGCGTCTCTCAGTGGGAAGGG + Intergenic
1052378312 9:27742132-27742154 GACGGTGCTCCCAGAGGGAGGGG - Intergenic
1053146433 9:35715177-35715199 GCAGCTGCTCCCTGAGGGAGAGG + Exonic
1055640093 9:78312786-78312808 CTACCTTCTCCCAGTGGGATGGG + Intronic
1056128039 9:83555521-83555543 GAAGGATCTCCTAGGGGGAGGGG - Intergenic
1056554483 9:87677341-87677363 GAAGCCTCTCACAGGGGCAGCGG + Intronic
1056635249 9:88326271-88326293 GGAGCTGCTCCCAGCAGGAGGGG - Intergenic
1056843674 9:90019079-90019101 GGAGCTGCTCCCAGATGGAGTGG + Intergenic
1056860319 9:90175160-90175182 GGAGCTTCCCACTGTGGGAGAGG - Intergenic
1056989148 9:91393656-91393678 GTAGCTCTTCCCAGTGTGAGTGG - Intergenic
1057258367 9:93568796-93568818 GAAGAATCTCCCAGTGGGGAAGG + Intergenic
1057803781 9:98206444-98206466 GAAGCTTCTCCCTGTGTGGAAGG - Intronic
1057826380 9:98375445-98375467 GTAGCTTCATCTAGTGGGAGAGG - Intronic
1057830191 9:98400410-98400432 GAATCCTCTGCCAGTGGGTGTGG + Intronic
1059023372 9:110599371-110599393 GATGGAGCTCCCAGTGGGAGGGG - Intergenic
1061945244 9:133905044-133905066 GAGGCTTCTCCCAGGGCGGGGGG + Intronic
1062430997 9:136526856-136526878 GCAGCTGCTCCCAGCGGGTGGGG + Intronic
1062452641 9:136621975-136621997 GCAGCTTCCCCCACAGGGAGGGG - Intergenic
1187814161 X:23212953-23212975 CTAGCTTTTCCCAGTGGTAGTGG - Intergenic
1188755559 X:33956776-33956798 AAAGCTTGTACCAGTGAGAGAGG - Intergenic
1190661092 X:52654862-52654884 GAACCTTCTCAAAGTGGGGGTGG - Exonic
1190667320 X:52707260-52707282 GAACCTTCTCAAAGTGGGGGTGG - Intergenic
1190672098 X:52751148-52751170 GAACCTTCTCAAAGTGGGGGTGG + Intronic
1193805162 X:85985690-85985712 GATGGATCTCCCAGAGGGAGGGG + Intronic
1194097934 X:89666257-89666279 GAGGCTGCTATCAGTGGGAGTGG + Intergenic
1196241437 X:113346863-113346885 GAAGGGGCTCCCAGAGGGAGAGG - Intergenic
1196457732 X:115901982-115902004 GAAGCAGGCCCCAGTGGGAGTGG - Intergenic
1196485006 X:116196372-116196394 GAAACTTCTTCCAGTGAGAATGG - Intergenic
1196783470 X:119402686-119402708 GAAGCTTTTTCCAGTGAGACTGG - Intronic
1198271487 X:135060046-135060068 CAAGGTTCTCCCAGGGGGAGGGG - Intergenic
1199033126 X:143024368-143024390 GAAGATTTTACCATTGGGAGAGG - Intergenic
1199075332 X:143518999-143519021 GAAGATTTTACCATTGGGAGAGG + Intergenic
1199847915 X:151704443-151704465 GATGCTCCACCCACTGGGAGAGG - Exonic
1200450956 Y:3327646-3327668 GAGGCTGCTATCAGTGGGAGTGG + Intergenic