ID: 1105422303

View in Genome Browser
Species Human (GRCh38)
Location 13:20264009-20264031
Sequence CCAGGGGACCACTGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 7, 3: 35, 4: 325}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105422303_1105422321 20 Left 1105422303 13:20264009-20264031 CCCTCTGCCCAGTGGTCCCCTGG 0: 1
1: 0
2: 7
3: 35
4: 325
Right 1105422321 13:20264052-20264074 GGGCCAGAGCTTGTGCTTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 220
1105422303_1105422312 -1 Left 1105422303 13:20264009-20264031 CCCTCTGCCCAGTGGTCCCCTGG 0: 1
1: 0
2: 7
3: 35
4: 325
Right 1105422312 13:20264031-20264053 GGCTCCCCTTGCCTTTCCCCTGG 0: 1
1: 0
2: 2
3: 46
4: 331
1105422303_1105422313 0 Left 1105422303 13:20264009-20264031 CCCTCTGCCCAGTGGTCCCCTGG 0: 1
1: 0
2: 7
3: 35
4: 325
Right 1105422313 13:20264032-20264054 GCTCCCCTTGCCTTTCCCCTGGG 0: 1
1: 0
2: 3
3: 42
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105422303 Original CRISPR CCAGGGGACCACTGGGCAGA GGG (reversed) Intergenic
901325766 1:8364303-8364325 CCTGGGGATGTCTGGGCAGAGGG + Intronic
901645877 1:10716462-10716484 CATGGGGAGCAGTGGGCAGAGGG + Intronic
902863064 1:19259672-19259694 CCTGGGTACCCCTTGGCAGAGGG + Exonic
902883814 1:19390665-19390687 CCAGGAGGCCACTGGAAAGACGG + Intronic
903951386 1:26997899-26997921 CCCGGGGACTACCGGGCAAAGGG - Intronic
904307409 1:29599082-29599104 CCCGGGCACCCCTGGGCAGCAGG + Intergenic
904396332 1:30224865-30224887 CCCGGGCACCCCTGGGCAGCAGG - Intergenic
904829848 1:33299628-33299650 CCTGGGCATCACTGAGCAGAGGG + Exonic
905028222 1:34865591-34865613 CCCTGGGCCCAGTGGGCAGAGGG + Exonic
906209990 1:44007412-44007434 CTGGGGAACCCCTGGGCAGAGGG - Intronic
906216169 1:44042044-44042066 CCAGGGGCCGTGTGGGCAGAAGG - Intergenic
906519492 1:46458813-46458835 CCAGGTGAGGACGGGGCAGAGGG - Intergenic
906745747 1:48221137-48221159 CCCAGGGACCACTGGGCACCTGG + Intergenic
910509761 1:87990658-87990680 CTAGAGGACCAGTGGGGAGAAGG - Intergenic
912509132 1:110176491-110176513 CCCTGGAACCCCTGGGCAGAGGG - Intronic
913199715 1:116485703-116485725 CCAGCACACCACTGGGCCGAGGG - Intergenic
913667216 1:121059283-121059305 CCCGTGGAGCACTGGGCAGGAGG + Intergenic
914018906 1:143846434-143846456 CCCGTGGAGCACTGGGCAGGAGG + Intergenic
914657458 1:149754638-149754660 CCCGTGGAGCACTGGGCAGGAGG + Intergenic
915339329 1:155167619-155167641 CCGTGGGAGCACTGGGCAGAGGG - Intergenic
917795432 1:178529538-178529560 CCAGAGGGCCACAGGGCAAAGGG - Intronic
918046454 1:180944491-180944513 CCAGGGGACCACAGTGCAGCTGG + Exonic
919482024 1:198101813-198101835 GCAGGGGACCACTATGCAGATGG - Intergenic
922239753 1:223748024-223748046 CCAGGGAACCTGTGGTCAGAGGG - Intronic
923015497 1:230123410-230123432 CCAGGGGACTACTTTGAAGAGGG + Intronic
923070829 1:230562913-230562935 CCAGGTGACCCCTGGGAACATGG - Intergenic
924455750 1:244217655-244217677 CCAGGACACCAGTGGGCAGGAGG + Intergenic
924606987 1:245543536-245543558 CCACGTGGCCACTGGGCAGATGG - Intronic
924930850 1:248731134-248731156 CAAGGAGACCACTGGGCATGCGG - Intronic
1062898203 10:1121097-1121119 CCATGGGACCTGTGGGCTGAGGG + Intronic
1062980336 10:1717316-1717338 CCTGGGGACCCCAGGGCAGCTGG + Intronic
1063612826 10:7577162-7577184 CCAGGAGATCACTAGGCAGCAGG + Intronic
1063650946 10:7936130-7936152 CCAGGGGACAACAAGGAAGACGG + Intronic
1064005842 10:11698310-11698332 CCAGGTGCCAACTGAGCAGAGGG - Intergenic
1067346982 10:45444052-45444074 CCAGGGGGCAGCTGGGCAGCAGG + Intronic
1067450649 10:46380046-46380068 CCAGGGGACATCTGGGGAGCTGG + Intronic
1067586594 10:47479705-47479727 CCAGGGGACATCTGGGGAGCTGG - Intronic
1068886132 10:62098787-62098809 CCAGGGGACCATGGGGCTGGGGG - Intergenic
1069755926 10:70774468-70774490 CGAGGGGACCTGAGGGCAGAAGG - Intronic
1070589894 10:77794278-77794300 TCGGGGGAGCTCTGGGCAGATGG + Intronic
1070932650 10:80272208-80272230 CCAGGGGAACACTGGGGACTTGG - Exonic
1071974319 10:90939873-90939895 CCACGGGACCACTGGACACAGGG + Intergenic
1073045830 10:100637754-100637776 CCAGGGGAAAAGTGGGGAGAAGG - Intergenic
1073053941 10:100687202-100687224 CCAGGGGACCAGAGGGCAGTTGG - Intergenic
1073098185 10:100993168-100993190 CCTGGGGAACAGGGGGCAGAAGG - Exonic
1073491645 10:103856363-103856385 CCAGGGGAGCCCTGGGCTTAAGG - Intergenic
1075201810 10:120410863-120410885 CCAGAGGAACACTGGGGAGTGGG + Intergenic
1076165545 10:128279576-128279598 CCAGGGAACCACCTGGCAAACGG - Intergenic
1076258104 10:129044846-129044868 CCAGGAGGCCAGTGGGCAGTCGG + Intergenic
1076485078 10:130810551-130810573 CCAGAGGCCCATTGGGTAGAAGG + Intergenic
1076608867 10:131707915-131707937 CAGGGGGATCAGTGGGCAGAGGG + Intergenic
1076893706 10:133298294-133298316 GCTGGGGACAACAGGGCAGATGG + Intronic
1077219321 11:1408406-1408428 CCACGGGAGAACTGGGGAGAAGG + Intronic
1077225187 11:1436492-1436514 CCAGGGCACAGCTTGGCAGAGGG + Intronic
1077409549 11:2397113-2397135 CCCTGGGACCCCAGGGCAGAAGG - Exonic
1077550561 11:3198224-3198246 CCAGGGGTCCTCTGGGGAGATGG + Intergenic
1078338892 11:10485115-10485137 ACAGGGGACCCCAGGGCAGAGGG - Intronic
1082881420 11:58041627-58041649 CCAGTGGCCCAATGTGCAGAAGG - Intronic
1083281683 11:61630563-61630585 CTTGGGGACCACTGGCCAGGGGG - Intergenic
1083369836 11:62169693-62169715 CCAGGGCTCCACTTGGCACATGG - Intergenic
1084409880 11:69000656-69000678 CCCTGGCACCACTGGGCAGTAGG - Intergenic
1084760571 11:71268146-71268168 CCAGGGAACAACAGGGCAGTAGG - Intergenic
1085795056 11:79531713-79531735 TCAGGAGACCACAGTGCAGAGGG - Intergenic
1086931163 11:92694684-92694706 CCAGGGGAACAGAGGGCAAAGGG + Intronic
1088627258 11:111738194-111738216 CCAGGAGAACACTGGGCAACAGG + Intronic
1090183424 11:124720186-124720208 CCAGGAGACCTCTGGGTTGATGG - Intergenic
1090752401 11:129759105-129759127 GCAAGGGGCCAGTGGGCAGACGG + Intergenic
1091001839 11:131916372-131916394 CCTGGGGATCACTTGGCAGGTGG + Intronic
1091553505 12:1554496-1554518 CCAGAAAACCACTGGGCAGCTGG - Intronic
1091641051 12:2237694-2237716 CCTGGGAAGAACTGGGCAGATGG + Intronic
1092044983 12:5425321-5425343 TCATGGGAACACTGGACAGAGGG + Intergenic
1094661450 12:32473397-32473419 CCAGGAGCCCACTGGGGGGAAGG + Intronic
1094833249 12:34310023-34310045 ACTGGGCACCACTGAGCAGAGGG - Intergenic
1095607308 12:44084832-44084854 CCTGGGGAGCACTGGTCTGATGG - Intronic
1097235650 12:57537676-57537698 TCAGGGAATTACTGGGCAGAGGG + Intronic
1100878070 12:98984166-98984188 CCAGAGGACCTCTGGGCTTAAGG - Intronic
1102558218 12:113742813-113742835 CCAGGGCACCAGAAGGCAGAAGG - Intergenic
1102942469 12:116955746-116955768 CCAGAGGGCAACTGGGGAGAAGG - Intronic
1103274571 12:119700916-119700938 CCCAGGGACCCCTGGCCAGATGG + Exonic
1104417332 12:128606312-128606334 CCAGGGAACCCCTGGCCACACGG - Intronic
1105422303 13:20264009-20264031 CCAGGGGACCACTGGGCAGAGGG - Intergenic
1107018663 13:35729990-35730012 GCTGGGGACCATTTGGCAGAGGG - Intergenic
1107372848 13:39771420-39771442 CCTGGGGAGCGCTGGGCAGCGGG - Intronic
1107920710 13:45203914-45203936 TCTGGGAACCACTGGGCAGAGGG + Intronic
1107955102 13:45504114-45504136 CCATGGGACAACTGGGAAGGTGG + Intronic
1108410772 13:50144294-50144316 GGAGGGGACCACATGGCAGAGGG - Intronic
1108556183 13:51595192-51595214 CCAGGAGACCAGTGGGGACAAGG - Intronic
1110615652 13:77539014-77539036 CCTGGGGAGAACTGGGGAGAGGG - Intronic
1112248388 13:97755119-97755141 CCAGAGGACCACTTGGGACAAGG - Intergenic
1112561722 13:100521280-100521302 CAAGGGGAGCACCAGGCAGACGG + Intronic
1115545977 14:34465068-34465090 CCAGGGGACAATTGAGCACATGG + Intergenic
1115849990 14:37583749-37583771 CCCGGGGCGCGCTGGGCAGAAGG - Intergenic
1116565982 14:46444736-46444758 CCAGGAGACCAGAGGACAGAGGG - Intergenic
1117787606 14:59303369-59303391 TCAGGGGACCACTGGGGTGGTGG - Intronic
1119715028 14:76853098-76853120 CCTGGGGACCACTGAGCACCCGG + Intronic
1121013151 14:90533670-90533692 CCTGGTGACCACTGGGCTGTGGG - Exonic
1121235234 14:92387125-92387147 CAAGGGGGCAACTGGGCAGGGGG + Intronic
1121271574 14:92641395-92641417 CCAGGGGCCGCCTGTGCAGAGGG + Intronic
1121443582 14:93964488-93964510 CCAGTGTACCATTGGGCAGGAGG - Exonic
1121940870 14:98069664-98069686 TCAGGCCACCACTGGCCAGAAGG - Intergenic
1122034085 14:98935004-98935026 CAAGGGGAGGACAGGGCAGAGGG + Intergenic
1122267335 14:100552835-100552857 CCTGGTGACTGCTGGGCAGACGG + Intronic
1122299272 14:100722859-100722881 CCAGGAGACAGCTGGGCAGGAGG - Intergenic
1122532263 14:102436708-102436730 GCTGGGGACCACAGTGCAGATGG + Intronic
1124635579 15:31362714-31362736 CCAGGGGAACACTGAGCAGATGG - Intronic
1125477873 15:40059823-40059845 CGAGGTGTCCACTAGGCAGACGG + Intergenic
1128159061 15:65411161-65411183 ACAGGGAACCATTGGGCAGCAGG + Exonic
1128329235 15:66745039-66745061 CCAGGTGACCTCTGGCCAGAGGG + Intronic
1128780846 15:70357639-70357661 CTCGGACACCACTGGGCAGACGG + Intergenic
1129542742 15:76364288-76364310 CCCTGGGACCACCGGGAAGAAGG - Intronic
1129738073 15:77976699-77976721 CCAGGGGACCCTTGGGGACAGGG + Intergenic
1129848003 15:78776910-78776932 CCAGGGGACCCTTGGGGACAGGG - Intronic
1130106796 15:80934807-80934829 CCAGAGGAAGACAGGGCAGAGGG + Intronic
1130577407 15:85104868-85104890 CCAGGGGAGCACTGAGGAGCAGG + Intronic
1131451846 15:92547820-92547842 CCATCACACCACTGGGCAGATGG - Intergenic
1132387116 15:101408474-101408496 CCAGGGAGACACAGGGCAGAAGG + Intronic
1132626472 16:894029-894051 ACAGGGGACGAGTGGGCAGACGG - Intronic
1132626506 16:894124-894146 ACAGGGGACGGGTGGGCAGACGG - Intronic
1132897063 16:2234089-2234111 CCAGGGGATCTGTGGGCAGGTGG + Intronic
1134116921 16:11556002-11556024 CCAGGGCACCCTTGGGCGGAAGG + Intronic
1134131641 16:11654357-11654379 CCAGGGGAGCAGTGGGCAGATGG - Intergenic
1134173767 16:11989792-11989814 CCATGGGAGCACTGTGTAGAGGG + Intronic
1134244739 16:12531527-12531549 CATGAGGACCACGGGGCAGATGG - Intronic
1134812196 16:17177197-17177219 TCAGGAAACCACTGGGCAGAGGG + Intronic
1135573017 16:23563743-23563765 ACAGGGGACCACAGGGCAAACGG - Intronic
1135886274 16:26311337-26311359 CCAGGAGACCACAGGGCATGAGG + Intergenic
1136113313 16:28078673-28078695 CCAGGGGGTCTGTGGGCAGAAGG - Intergenic
1136492939 16:30622348-30622370 CCATCAGACCTCTGGGCAGAAGG - Intronic
1137442848 16:48511029-48511051 ACAGGGGCCTACTGGGCAGCTGG - Intergenic
1137759395 16:50928200-50928222 CCAGGCAAACACTGGGCATAGGG - Intergenic
1138531009 16:57634368-57634390 GCAGAGGAGCAGTGGGCAGAGGG - Intronic
1140123863 16:72104736-72104758 CCTGGGGACCATGGGGCAAATGG + Intronic
1140777580 16:78264178-78264200 CCAGGGACCCACTTGGGAGAAGG + Intronic
1140780723 16:78294092-78294114 GCAGAGGACAAATGGGCAGAAGG - Intronic
1141066175 16:80915864-80915886 GCAGGTGACCACAGGGTAGAAGG + Intergenic
1141080159 16:81043774-81043796 GCAGTGGCCCACTGTGCAGAAGG - Exonic
1141136884 16:81472458-81472480 CCAGGGGACCCCTGGGGAGATGG - Intronic
1141395349 16:83699595-83699617 CCAAGGGAGGACTGGGGAGAAGG - Intronic
1141611471 16:85183502-85183524 CCAGAGGACCACAGGGGTGAGGG - Intronic
1141787464 16:86211344-86211366 ATAGGGGACCACAGGGCAGCAGG + Intergenic
1141927514 16:87179007-87179029 CCAGGAGACCAATGGGGGGAAGG - Intronic
1142899735 17:3004531-3004553 TCAGGGCACCTCTGTGCAGAGGG + Intronic
1142974848 17:3637062-3637084 CCAGGCGGCAACTGAGCAGAAGG - Intronic
1144759051 17:17697020-17697042 CCAAGGGGCAGCTGGGCAGAGGG - Intronic
1146065619 17:29632522-29632544 CCAGGGTACCACTTGGCACCTGG + Exonic
1147998717 17:44375535-44375557 CCCGGGACCCACGGGGCAGAGGG - Intronic
1148019202 17:44542317-44542339 CTAGGGGGACAGTGGGCAGAAGG + Intergenic
1148336966 17:46848445-46848467 TCAGGAGCCCACAGGGCAGAGGG + Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151214144 17:72566125-72566147 CAGGAGGACCACTGGGCACAAGG - Intergenic
1151337307 17:73447530-73447552 CCAGGGGATCATTGGGAAGATGG - Intronic
1151342829 17:73482684-73482706 TGTGGGGACCACTGGGCTGATGG - Intronic
1152377614 17:79926852-79926874 CCAGGGGACGTCTGGGCAGTGGG - Intergenic
1152419379 17:80183899-80183921 CCATGAGACCTGTGGGCAGATGG - Exonic
1152604423 17:81282000-81282022 CCTGGGCACCATGGGGCAGACGG - Intronic
1152691354 17:81719566-81719588 CCCGGGGTCCAGTGGGCAGAGGG - Intronic
1152755750 17:82086328-82086350 CCAGGAGGCCGCTGAGCAGAGGG + Exonic
1153109596 18:1568856-1568878 CCAGCACACCACTGGGTAGAAGG + Intergenic
1154947927 18:21180781-21180803 CCTGGGTAGCACTGGGCAGGTGG - Intergenic
1156016090 18:32548799-32548821 CCAGGGGACCTCTGGGAACAGGG + Intergenic
1157928765 18:51795834-51795856 ACATGGGTCCACTGGGCACAGGG + Intergenic
1158165173 18:54532052-54532074 CCAAGGGACCACTGAACAAAGGG + Intergenic
1158897349 18:61927512-61927534 CCAGAAGACCCCAGGGCAGATGG - Intergenic
1159190392 18:65034467-65034489 CCAGGGGATCATTGGAAAGATGG - Intergenic
1159298155 18:66523520-66523542 CCAGGGTACCAGTGGGCTGGAGG + Intronic
1160227964 18:77025905-77025927 GCAGGGGAGCAGTGGGCAGCGGG + Intronic
1160657725 19:281941-281963 CCAGGGGAGGACTGGGGGGAAGG + Intronic
1160764842 19:802942-802964 CCAGCGGATCACTGGGCGGGAGG + Intronic
1161153415 19:2721001-2721023 CGAGGGGACCAATGCGGAGAGGG + Intronic
1161420143 19:4171996-4172018 CCAAGGCACCCCTGGGCAGAGGG - Exonic
1162046203 19:8002071-8002093 TCAGGTGTCCACTGGGCAGAGGG - Intronic
1163303722 19:16463973-16463995 CCAGGGGGCCACAGAGCAGAGGG + Intronic
1163760427 19:19133312-19133334 CCAGGGGAACACTGGGAGGTAGG + Intronic
1164597421 19:29539402-29539424 CCAGGGGAGAAGTGGGGAGAAGG + Intronic
1164675398 19:30097192-30097214 CCAGCAGGCCAGTGGGCAGATGG - Intergenic
1164771375 19:30812030-30812052 CCAGGGGAGGAGTGGGCAGTAGG - Intergenic
1165068351 19:33241551-33241573 CCTGGGGCCCTCTGGGCAGAGGG - Intergenic
1165941656 19:39417558-39417580 CTAGGGAAGCACTGGGCGGAGGG + Exonic
1166813486 19:45527913-45527935 CAGGGGGACCTCTGGGCTGAGGG + Exonic
1167009274 19:46796226-46796248 CCCAGGGACCACTGGACAAAGGG + Intergenic
1168679932 19:58307565-58307587 CCATCAGACCTCTGGGCAGAAGG + Intronic
925113015 2:1352404-1352426 CCAGGAGCTCAATGGGCAGAGGG - Intronic
925817609 2:7768843-7768865 CCAGGGGACCTGAGGGCACAGGG - Intergenic
927019322 2:19000701-19000723 CCAGGAAATCACTGGGCTGAGGG - Intergenic
927484096 2:23477198-23477220 CCAGGAGGCCACCGGTCAGAAGG - Intronic
927520270 2:23694141-23694163 CCAGAAGGCCACTGAGCAGAGGG - Intronic
927849351 2:26489256-26489278 CCAGGGTGCCACTGCGCAGCAGG + Exonic
927887685 2:26728646-26728668 GCGGGGTCCCACTGGGCAGAAGG - Exonic
928033543 2:27801082-27801104 CTAGCCGGCCACTGGGCAGAGGG + Intronic
928342826 2:30460247-30460269 GCAGATGAACACTGGGCAGATGG - Intronic
930542515 2:52724678-52724700 CAAGGGGATTAGTGGGCAGAAGG - Intergenic
933657923 2:84904992-84905014 ACAGGGGACGACTGACCAGAAGG + Intronic
933811790 2:86037215-86037237 ACAGAGGACCACTCGACAGAAGG + Intronic
933935321 2:87199169-87199191 CCAGGGTGCCTGTGGGCAGATGG + Intergenic
934067127 2:88350654-88350676 CCAGGAGACCACAGAGCAGAAGG + Intergenic
934490972 2:94761933-94761955 CCAGGGCACTACTGGGAAGCTGG - Intergenic
934547602 2:95231667-95231689 CCAGGGGAACATTTGGCAAAAGG + Intronic
935397043 2:102619847-102619869 CCATGGAACCACTGGGCAACTGG + Exonic
936010056 2:108919822-108919844 GCCGGGAGCCACTGGGCAGAAGG - Intronic
936357827 2:111766730-111766752 CCAGGGTGCCTGTGGGCAGATGG - Intronic
941363400 2:164580916-164580938 CCAGGAGCCCAATGGGTAGAGGG - Intronic
942426861 2:175869303-175869325 ACAGGAGAACACTGGGGAGAAGG - Intergenic
943655083 2:190500011-190500033 CCAGGGGACCAATGAGAATAGGG + Exonic
944894060 2:204145991-204146013 AGAGGGAACCACTGGGGAGACGG - Intergenic
947114355 2:226752806-226752828 CCATGCGACCACTGGACAGCAGG + Intronic
948231481 2:236352178-236352200 CCAGGGGGCCAATGAGCAGGAGG + Intronic
948637668 2:239349712-239349734 CCAAGGGACCTCCGGGCGGAAGG + Intronic
948792086 2:240384369-240384391 GCAGGGGACAGCTGGGCCGAGGG - Intergenic
948810302 2:240471905-240471927 CCAGGAGATCCCTGGGCAGATGG - Intergenic
949035015 2:241812262-241812284 CCAGGGGTCCACGGACCAGAAGG + Intronic
1169971256 20:11271520-11271542 CCAGGTGACGCCTGGCCAGATGG + Intergenic
1171248501 20:23632122-23632144 CCATGGGGCCACCGGGCGGAGGG + Intronic
1171481718 20:25459899-25459921 CCAGGGGAGCACTGGAAACAAGG + Intronic
1171996259 20:31734037-31734059 TCTGGGGACTACTAGGCAGAAGG - Intergenic
1172007679 20:31828752-31828774 CCAGGGGACTGTTGGGAAGATGG - Intronic
1172278430 20:33693972-33693994 CCAGGGGCCCAGTGGGCAGGAGG + Intergenic
1173065443 20:39706299-39706321 CCAGGCAACCATTGGGAAGAGGG + Intergenic
1173639538 20:44591108-44591130 CCAGAGGGCTAGTGGGCAGAGGG + Intronic
1175108507 20:56630383-56630405 CCCCGAGACCCCTGGGCAGATGG + Intronic
1175220768 20:57415184-57415206 CCAGGAGCCCCCTGGGCAGGAGG + Intergenic
1175650266 20:60715604-60715626 GAAGGGGAGAACTGGGCAGAGGG - Intergenic
1175911102 20:62405965-62405987 CCAGGGGCCATCTGGGCAGGGGG + Intronic
1176072310 20:63233764-63233786 CCTGGGGCCCACTGGGGAGTTGG - Intergenic
1179172443 21:38982999-38983021 TCACGGGAGCACTGGGCAGGAGG + Intergenic
1179375506 21:40846925-40846947 CCGGGGGCCCACTGAGCTGACGG - Exonic
1179537046 21:42059477-42059499 CCATGGGACCACTGGCCAGATGG - Intergenic
1179918945 21:44496754-44496776 CCAGGGGAAGACTGGGGAGGTGG + Intergenic
1180725514 22:17944041-17944063 GGCGGGGAGCACTGGGCAGATGG - Intronic
1180965927 22:19787975-19787997 CCAGGTGAGTGCTGGGCAGAAGG - Exonic
1181039057 22:20183438-20183460 CCAGGGCCACACAGGGCAGACGG - Intergenic
1181084381 22:20432545-20432567 TGAGGTGACCACTTGGCAGAGGG + Intronic
1181496101 22:23288401-23288423 ACAGGGGATCACAGGGCAGTGGG - Intronic
1182614545 22:31578212-31578234 CCAGGGAAGCAGTGGGCAAAGGG - Intronic
1182681046 22:32080259-32080281 TCAGGGGAGATCTGGGCAGAGGG + Intronic
1183208026 22:36432816-36432838 CCAGGCGAGGTCTGGGCAGATGG + Intergenic
1183332999 22:37231380-37231402 TCTGGGAACCACTGGGCAGGTGG + Exonic
1183486010 22:38088158-38088180 GCAGGGGAAAACGGGGCAGATGG - Intronic
1184048223 22:41985725-41985747 CCACAGGACCACTGGGAAAAGGG - Intronic
1184849513 22:47112286-47112308 CTGGGTGAACACTGGGCAGAAGG - Intronic
1185155911 22:49193434-49193456 CCAGGGGACGCCTGGACCGAAGG - Intergenic
1185287557 22:50009350-50009372 CCAGGCTCCCACGGGGCAGAAGG + Intronic
1185333782 22:50262647-50262669 CCAGGAGCCCACTGGGCTGGTGG + Intergenic
949473273 3:4418643-4418665 CCAGAGCAGGACTGGGCAGAGGG - Intronic
949981159 3:9502398-9502420 CCAGGGCACAAGTGGGCAGAGGG + Intronic
950718715 3:14867622-14867644 CCACGGAACCACTGTGGAGATGG + Intronic
951053940 3:18125925-18125947 CCAGAGGACCACTGAGGAGGTGG + Intronic
952877245 3:37956625-37956647 CCAGGGGAAGACTGGGGAGAGGG - Intronic
952963027 3:38604572-38604594 GTAGGGGAGCTCTGGGCAGAGGG - Intronic
953296571 3:41723822-41723844 CCAGGCGCCCACTGGGCTAAGGG - Intronic
954155183 3:48681475-48681497 CCTGGGGACCACAGAGGAGAAGG - Exonic
954318163 3:49812533-49812555 CCAGGGGAGCCCTGGGTAGGAGG + Exonic
954411229 3:50372067-50372089 CCAGGGAATCCCTGGGCAGATGG - Intronic
954689288 3:52387244-52387266 AGAGGGGATGACTGGGCAGATGG - Intronic
955339257 3:58112326-58112348 CCAGGGGAGCAGAGGGGAGAAGG - Intronic
955397817 3:58569506-58569528 CCAGGGACCCACTGGGGACAGGG + Intronic
956119916 3:65955986-65956008 CCAGGGCAGCCCTGGGCCGAAGG + Intronic
956430454 3:69181019-69181041 CCAGCGGGCCTCTGGGCAGAAGG - Exonic
956799508 3:72744119-72744141 CCAGGGGCCCTCTGGGCTGGTGG + Intergenic
958638630 3:96777268-96777290 CCAGGTGATAACTGGGAAGAAGG + Intergenic
961519133 3:127456707-127456729 CCCGGGGAACAATGTGCAGAAGG + Intergenic
962223436 3:133584042-133584064 CCAGGTGATAACTGGGAAGAAGG + Exonic
962892574 3:139685461-139685483 CCAGGGCACCACTGTGAAAATGG - Intergenic
966332253 3:178827252-178827274 CCAGTTGACCAATGGGCAGCTGG + Intronic
966871497 3:184292795-184292817 CCAGGGAAACAGTGGGCAGCAGG - Exonic
967976333 3:195036554-195036576 CCAGGAGACCCCTGGGCGGTGGG + Intergenic
968400797 4:295382-295404 CCAGGGGACCAAGGTCCAGAAGG - Intronic
968503118 4:960319-960341 CCAGGCCCCCACAGGGCAGAGGG + Exonic
968640077 4:1709974-1709996 CCAGGGGACCAGTTGGAAAATGG - Intronic
968684608 4:1949067-1949089 CCAGGGGAGCACAGGGCATGGGG - Intronic
968801583 4:2746589-2746611 CGAGGCGCCCACTGGGGAGAAGG - Intronic
968830353 4:2930423-2930445 CCAGGCTGCCACTGTGCAGAGGG + Intergenic
969448666 4:7260231-7260253 TCAGGGGGCAACTGGCCAGAAGG - Intronic
969673464 4:8602180-8602202 CCAGAGGGCCACTTGGCAGCGGG + Intronic
970150245 4:13081922-13081944 CCAGTGGAGCTCTGGGAAGAGGG - Intergenic
971038485 4:22722598-22722620 CCTGGATACCACTGGGCAGAGGG - Intergenic
978301182 4:107270674-107270696 CCAGAGGATCCCTGGGCAGTAGG + Intronic
981679804 4:147383891-147383913 ATTGGGGACCACTGGGAAGAAGG + Intergenic
982126662 4:152189716-152189738 CCAGGGGCCCAGTGAGCACAGGG - Intergenic
984901488 4:184590579-184590601 CCAGAGGAACACGGGGCACAGGG - Intergenic
985619369 5:945929-945951 CAAGGGGAACACTGGTCAGCCGG - Intergenic
985726717 5:1520042-1520064 CCAGGGACCCAGTGGGCAGCAGG + Intronic
987325341 5:16807228-16807250 CCAGTGGACCACTGAACATATGG - Intronic
989763616 5:45051224-45051246 CCAGGGCACTCCTGGGCGGAGGG - Intergenic
993229180 5:85210124-85210146 CCAGGAAACCACAGGCCAGAAGG - Intergenic
996677266 5:126190887-126190909 CCAAGGAAACACTGGGCAGAAGG - Intergenic
997481045 5:134184751-134184773 GCTGGGGTCCTCTGGGCAGAGGG - Intronic
997626671 5:135335887-135335909 CCAGGGGACCCCGGAGGAGATGG + Intronic
998227897 5:140341138-140341160 CCTAGGGACCACTGGGAAGGTGG + Intronic
999373124 5:151068284-151068306 CTGGATGACCACTGGGCAGACGG + Intronic
1002447171 5:179296648-179296670 CCAGGGGCGGCCTGGGCAGAGGG + Intronic
1002534442 5:179868565-179868587 CAAAGGGCCCACTGGCCAGATGG - Intronic
1004177875 6:13355925-13355947 CCAGGGGATATCTAGGCAGAGGG + Intergenic
1006022809 6:31127320-31127342 CCAGGGAGACACTGGGCAGTAGG - Intronic
1006161861 6:32043920-32043942 CCAGGGAACCCCAGGGCAGCTGG + Intronic
1006295089 6:33166728-33166750 TCAGGGCTCCCCTGGGCAGAAGG - Exonic
1007431635 6:41780294-41780316 CAGGGGGACCACTGGGGACAAGG + Intronic
1007954613 6:45904881-45904903 ACTGGGGACTACTTGGCAGAGGG - Intronic
1010077902 6:71822297-71822319 CCAGGAGAAAACAGGGCAGAGGG + Intergenic
1010778615 6:79916853-79916875 CCATGTGACCATTGGGCACACGG - Exonic
1015937872 6:138420725-138420747 CCAGGGGAACTCTGGGAAAAAGG - Exonic
1017526313 6:155244097-155244119 CCTGTGGATCACTGGACAGAAGG - Intronic
1017643433 6:156516503-156516525 CCAGTGGACCACTGGACAGGTGG - Intergenic
1017741993 6:157414650-157414672 CCAGGCCACCACTGGGCACAGGG + Intronic
1017905137 6:158752818-158752840 CCAGGGGCCATCTGGGCAGCTGG + Intronic
1019353046 7:564156-564178 GGAGGGGCCCACTGGGCTGAGGG - Intronic
1019427189 7:983290-983312 CCCGGGGGCCACCGGGCAGCTGG - Exonic
1019669555 7:2270105-2270127 CCAGGGAGCTGCTGGGCAGAGGG + Intronic
1019701152 7:2475594-2475616 ACAGGGGGCCAGTGGGCAGCGGG - Intronic
1020204478 7:6104628-6104650 CCAGGGAAGCACAGGGCGGAAGG + Intergenic
1022506272 7:30910222-30910244 CCAGGCCACAGCTGGGCAGAGGG + Intergenic
1023965770 7:44962450-44962472 GCAGGGGACCACTGCGTGGACGG + Intergenic
1024297585 7:47857793-47857815 CCATGTTAGCACTGGGCAGATGG - Exonic
1025019417 7:55468779-55468801 CCAGGGTACCACGGGACAGGAGG + Intronic
1028838796 7:95403517-95403539 ACTGGGGACCACTAGACAGAAGG - Intergenic
1029258867 7:99287804-99287826 TCAGGGGACCACCGAGCAGCTGG + Intergenic
1029365488 7:100113631-100113653 CCAGGGGCACCCGGGGCAGAGGG + Exonic
1032278709 7:130483616-130483638 GAAGGGGGCCACTGGGCAGAAGG - Intergenic
1032322915 7:130900670-130900692 TCAGGGGACCACTGGGAAGAAGG + Intergenic
1032522302 7:132554627-132554649 CCAGGGTGCCTCAGGGCAGAGGG + Intronic
1033243895 7:139702731-139702753 ACAGAGGACCCCTGGGCACACGG + Intronic
1033327736 7:140393377-140393399 CCAGGCCCCCACTGGGCAGCTGG + Intronic
1034655876 7:152729529-152729551 CCAGGAGCCCACCGGGAAGAAGG - Intergenic
1034674736 7:152884315-152884337 CCAGGGGAGCAGGAGGCAGAAGG + Intergenic
1034943571 7:155247941-155247963 ACAGGGGACCACTGAGGAGATGG - Intergenic
1035042120 7:155936515-155936537 CAGGATGACCACTGGGCAGAGGG - Intergenic
1036432090 8:8701481-8701503 CCAGTGTACTTCTGGGCAGAAGG - Intergenic
1036767128 8:11556276-11556298 CCTGGGGTACACTGGGCAGGAGG - Intronic
1036915128 8:12797209-12797231 CCATGAGACCACTGGGAGGAAGG + Intergenic
1037329238 8:17727356-17727378 CCGAGGGAACACTGGGCAGGTGG - Intronic
1038163474 8:25062417-25062439 CCAGGGGAATACTTGGCACATGG + Intergenic
1038598393 8:28911854-28911876 CCAAGGGACAACTGTACAGATGG + Intronic
1039438957 8:37581431-37581453 CCAGGGGAGCACAGGACACATGG - Intergenic
1040341225 8:46442181-46442203 CCAGGGCACTACTGGGTAGGCGG - Intergenic
1045065108 8:98437419-98437441 CCCAGGGACTGCTGGGCAGATGG - Intronic
1047221577 8:122922914-122922936 CCAGCAGCCCACCGGGCAGATGG - Intronic
1048491855 8:134901616-134901638 CCTGGGGACCACAGGAAAGATGG - Intergenic
1049056144 8:140239019-140239041 CCAGGAGCTCACTGGGAAGAGGG + Intronic
1049162475 8:141106132-141106154 CCAGGAGACCCCTGGGAAGCTGG - Intergenic
1049597283 8:143490478-143490500 CCAGGGCCCCACTGGGGAGGAGG - Intronic
1049687469 8:143944675-143944697 GCAGGAGCCCACGGGGCAGACGG + Intronic
1049735310 8:144202051-144202073 CCAAGGGAGGACGGGGCAGACGG + Intronic
1049837903 8:144750762-144750784 CCAGGGAACCGGTGGCCAGATGG - Intronic
1056022433 9:82453855-82453877 CCAAGGGACCATTTTGCAGAAGG + Intergenic
1056576601 9:87859677-87859699 CCAGGTGTCCACTGGGCACCTGG + Intergenic
1056752086 9:89359259-89359281 GCAGGGAGCCACTTGGCAGAAGG + Exonic
1060199715 9:121645397-121645419 CCAGGGCTCCTGTGGGCAGAAGG + Intronic
1060408599 9:123385077-123385099 CCAGGGCACCACTGGGTAGATGG + Intronic
1060523596 9:124308259-124308281 CCAGGGCACAAGTTGGCAGAGGG - Intronic
1060995623 9:127873683-127873705 CCACAGCCCCACTGGGCAGAGGG + Intronic
1061118668 9:128629924-128629946 ACAGGAGACCTCAGGGCAGAGGG - Intronic
1061271638 9:129547104-129547126 CCTGGGGCCCTCTGGGGAGAGGG - Intergenic
1061278512 9:129583605-129583627 CCAGAGAACCAGTGGGGAGAAGG - Intergenic
1061422569 9:130480204-130480226 CCAGGTGCCCACTGGACAGGTGG - Intronic
1061820545 9:133225280-133225302 TCAAGGCAGCACTGGGCAGACGG + Intergenic
1062345451 9:136112428-136112450 CCATGGGACCACTGAGTACAGGG - Intergenic
1062535700 9:137020255-137020277 GCCTGGGACCCCTGGGCAGAGGG - Intronic
1062730039 9:138103585-138103607 ACTGGGGACAGCTGGGCAGATGG - Intronic
1189504906 X:41603010-41603032 GCAGGGGCCCACTGTGCAGCTGG + Intronic
1190106779 X:47566802-47566824 GCCGGGGACCACAGGGCAGAGGG + Intronic
1190281932 X:48936845-48936867 CCAGAGGACCACTGCTCTGATGG + Intronic
1191214171 X:57918838-57918860 GCAGAGGGCCACTGAGCAGAAGG - Intergenic
1191715955 X:64193653-64193675 TCAGGGGACCACTGGGCAGGGGG + Intronic
1194765999 X:97845748-97845770 CCTTGGGACCACTTCGCAGAAGG + Intergenic
1195559186 X:106263869-106263891 CCAGGAGAGCAATGGGCACAAGG + Intergenic
1195696946 X:107674382-107674404 CTGGGGGACCATTTGGCAGAAGG - Intergenic
1199151320 X:144490279-144490301 GCAGGAGATCACTGGGCAGTTGG - Intergenic
1201059715 Y:10035425-10035447 CCAGGGGACGACTGAGCTGCAGG - Intergenic
1201717278 Y:17059506-17059528 ACTGGGGACTACTTGGCAGAAGG + Intergenic