ID: 1105422639

View in Genome Browser
Species Human (GRCh38)
Location 13:20266532-20266554
Sequence GGGTCTCATCCACCACCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105422634_1105422639 3 Left 1105422634 13:20266506-20266528 CCTGCAGCAGGGGCCTCGAGAAT 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1105422639 13:20266532-20266554 GGGTCTCATCCACCACCAGCAGG 0: 1
1: 0
2: 1
3: 9
4: 146
1105422629_1105422639 26 Left 1105422629 13:20266483-20266505 CCTGGGAGAAGTGGAGAAGTTGG 0: 1
1: 0
2: 1
3: 24
4: 318
Right 1105422639 13:20266532-20266554 GGGTCTCATCCACCACCAGCAGG 0: 1
1: 0
2: 1
3: 9
4: 146
1105422638_1105422639 -10 Left 1105422638 13:20266519-20266541 CCTCGAGAATGGCGGGTCTCATC 0: 1
1: 0
2: 0
3: 4
4: 32
Right 1105422639 13:20266532-20266554 GGGTCTCATCCACCACCAGCAGG 0: 1
1: 0
2: 1
3: 9
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105422639 Original CRISPR GGGTCTCATCCACCACCAGC AGG Intergenic
901255326 1:7820448-7820470 GTTTCTCTTACACCACCAGCTGG + Exonic
902015178 1:13301558-13301580 GGATCCCATTCCCCACCAGCTGG - Intergenic
902031091 1:13422750-13422772 TGGTCTCATCTACCAGCAGATGG - Intergenic
903140427 1:21335727-21335749 GGGTCTCACCCACCCCAGGCAGG - Intronic
903501297 1:23801292-23801314 GGCTCTCAGCCCCCACCTGCCGG + Intergenic
903672697 1:25046002-25046024 GGGTCTCAACCACCAGCCACAGG + Intergenic
903824912 1:26137472-26137494 GGCTCTCATCCTGCTCCAGCTGG + Intergenic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
905215104 1:36401230-36401252 GGGGCCCACCCTCCACCAGCGGG - Intergenic
905235057 1:36540523-36540545 CTGTCTCATTCACCACCAGTGGG + Intergenic
912797278 1:112700829-112700851 GGGTCACATCCCCTCCCAGCTGG + Intergenic
913550891 1:119915935-119915957 GGGTCTCATTCACCTCCATGCGG + Exonic
916587007 1:166157636-166157658 GGGTCCCTTCCACCACCAGATGG + Intronic
917591185 1:176478794-176478816 GGTCCTCATCCAAGACCAGCAGG - Intronic
919756078 1:201066906-201066928 GGGACACGGCCACCACCAGCAGG + Exonic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
920505633 1:206513454-206513476 GGGGCTCAGTCAGCACCAGCTGG + Intronic
920843629 1:209575654-209575676 GGGACACATCCAGCCCCAGCTGG - Intergenic
922803546 1:228374658-228374680 GGTCCTCAGCCACCACCACCAGG - Exonic
1065143254 10:22740425-22740447 GGGACTCTTCCACCACCATGTGG - Intergenic
1068832162 10:61507717-61507739 GGGTCTCATCTACCACACCCTGG - Intergenic
1070695629 10:78561232-78561254 GGTCCTCATCCCCCACCACCAGG + Intergenic
1071508394 10:86246463-86246485 GGGTCTCAGCCACCACAACCCGG + Intronic
1075641934 10:124070937-124070959 GGGTCTCTTCCAGAAACAGCGGG + Intronic
1076276071 10:129199860-129199882 AGGTCTCATTTACCACCAGAAGG + Intergenic
1076874817 10:133210870-133210892 GTGTGTCCTCCACCTCCAGCCGG - Intronic
1077745595 11:4901021-4901043 GGCTTTCATCCCCCACCAGCTGG + Intronic
1078619083 11:12891380-12891402 GGTCCTCATCAGCCACCAGCTGG - Intronic
1079022493 11:16921049-16921071 GTGTCTGAAACACCACCAGCTGG + Intronic
1080877989 11:36294289-36294311 GGGCCTAATCCACCTCCTGCAGG - Intergenic
1081334113 11:41842862-41842884 GGGTCTCAGGCACCCCAAGCTGG + Intergenic
1081794032 11:45807623-45807645 GGGTCCCTTCCCCCACCAACCGG - Intronic
1083222816 11:61264646-61264668 GGGCCTCTTGCACCAGCAGCAGG + Intronic
1083234570 11:61343421-61343443 GAGGCTCATCCACCAGCAGGAGG - Exonic
1084195047 11:67519838-67519860 GGATCTCGTCCACCTCCCGCTGG + Exonic
1089277300 11:117346214-117346236 GGGTGTTAGCCACCACTAGCAGG - Intronic
1094213089 12:27913123-27913145 GCCTCCCATCCACCACCCGCAGG - Intergenic
1100543752 12:95582125-95582147 GGATTTCTTCTACCACCAGCTGG - Intergenic
1104569640 12:129913825-129913847 GGGTTTCATCCAGCACGAGAAGG - Intergenic
1105422639 13:20266532-20266554 GGGTCTCATCCACCACCAGCAGG + Intergenic
1112646827 13:101342587-101342609 GGATCTCAGACAGCACCAGCAGG - Intronic
1113373702 13:109744868-109744890 GGGCCTCAGCCACACCCAGCAGG + Intergenic
1113791291 13:113029753-113029775 GGGTCTCGTCCACCATCTCCTGG - Intronic
1119492827 14:75051318-75051340 GGGTCTCTTCTAACACCAGAAGG - Intronic
1122838309 14:104442241-104442263 GGGTCTCAGCCAGGCCCAGCCGG - Intergenic
1122863769 14:104594441-104594463 TGGTCTCAGCCACCCCCACCCGG + Intronic
1123129698 14:105974997-105975019 GGGACTCAGACACCACCAGGGGG + Intergenic
1123129723 14:105975097-105975119 GGGGCTCAGACACCACCAGAGGG + Intergenic
1123218143 14:106831396-106831418 GAGGCTCAGCCACCACCAGGGGG - Intergenic
1125417348 15:39467376-39467398 GGGTCACATCCCCCAGCAGGGGG - Intergenic
1127759308 15:62122108-62122130 TGGTCTCAGCCACCACCACTAGG + Intergenic
1130564155 15:84980651-84980673 GGGGCTCCTCCCCCACCAGCTGG - Intronic
1131931162 15:97443417-97443439 GGTAGTCATTCACCACCAGCAGG + Intergenic
1133237027 16:4392218-4392240 GGGCCTCACCCAGCCCCAGCTGG + Intronic
1134115336 16:11543748-11543770 TGGAATCATCCACCAGCAGCTGG + Intergenic
1136395532 16:29990780-29990802 GGGTCTCATCAAGCCGCAGCTGG - Intronic
1137712245 16:50574501-50574523 GGGCCTCGGCCACCAGCAGCAGG - Intronic
1141884168 16:86880414-86880436 CGAACTCATCCCCCACCAGCCGG + Intergenic
1142114961 16:88351722-88351744 GGAGCTCCTCCCCCACCAGCAGG + Intergenic
1142154453 16:88526828-88526850 AGGCCTCGTCCACCAGCAGCAGG - Exonic
1144780681 17:17807015-17807037 GAGTCTCGCCCACCATCAGCAGG + Intronic
1146208594 17:30924497-30924519 GGGTATCCTCCACCCCCAGAGGG - Intronic
1147659679 17:42110884-42110906 GGCACTCATCCACCACGATCAGG + Exonic
1149566853 17:57646382-57646404 GTGTCTCATCCACTGTCAGCAGG + Intronic
1150284003 17:63945347-63945369 GGGTCACACTCACCACCTGCAGG + Exonic
1150651874 17:67015857-67015879 TGGTCTCACCCACCCACAGCTGG + Intronic
1152755329 17:82084790-82084812 GGGGCTCACCCTCCTCCAGCAGG + Exonic
1154488931 18:14904082-14904104 TGGTTTCATCCACCCACAGCAGG + Intergenic
1155283190 18:24262002-24262024 AGGTCCCAGCAACCACCAGCAGG - Intronic
1156590597 18:38483447-38483469 GGGTCTCAGCCACAACCCCCTGG + Intergenic
1157729398 18:49990601-49990623 GGGGCTCAGCCTCCACCACCTGG - Intronic
1158614568 18:58974715-58974737 GGGTCACATCCATCCACAGCTGG + Intronic
1159128435 18:64252674-64252696 GGGTATGATCCTCCCCCAGCGGG + Intergenic
1160323263 18:77915783-77915805 GGGTGTCTTTCACCACCAGAGGG + Intergenic
1162249212 19:9428320-9428342 GGGTCTAATCCACCCGCAGAAGG + Intronic
1163747481 19:19056936-19056958 GGGTGGCTCCCACCACCAGCAGG - Intronic
1164437036 19:28239473-28239495 GGACCTCAGCCACCACCAGAGGG + Intergenic
1165511157 19:36267476-36267498 GGGGCTCATTGTCCACCAGCAGG + Intergenic
1165667260 19:37643197-37643219 GTGTCTCCTCCTCAACCAGCAGG + Intronic
1166803198 19:45470355-45470377 GGGTGTGATTCACCACCCGCTGG + Intronic
927706479 2:25299419-25299441 GGGTCTCAGCCCCCACCTGGAGG - Intronic
928231273 2:29500731-29500753 CTGTCTCATCCATCCCCAGCTGG + Intronic
928306875 2:30177623-30177645 GGTTCACATCCAGCACCATCGGG + Intergenic
929290669 2:40187211-40187233 GGTTCTCATTCACCACTAGCAGG + Intronic
931682249 2:64760725-64760747 AGTTCTCAACCACCACCAGAGGG - Intergenic
932774012 2:74516312-74516334 AGGGCTCCTCCACCACCGGCCGG + Exonic
932848004 2:75154775-75154797 GGGACTCTTCCAACAGCAGCAGG - Intronic
934735589 2:96688333-96688355 GGGCCTCACCCATCACCAACAGG + Intergenic
937052537 2:118904199-118904221 GGGTCTCCTGCACCACTAACTGG - Intergenic
937311590 2:120906276-120906298 GGGCCTCATCACCCACCTGCTGG - Intronic
938366483 2:130738470-130738492 GTGTCTCACCCCCCTCCAGCTGG - Intergenic
945344192 2:208693552-208693574 GGGTCCCACCTACCCCCAGCTGG + Intronic
948001009 2:234567515-234567537 CGGTCTCATGAGCCACCAGCTGG - Intergenic
948792239 2:240385097-240385119 GGGTCTCAGCAGCCACCTGCTGG - Intergenic
948982209 2:241500148-241500170 GAGCCACATCCACCCCCAGCAGG + Intronic
1170747589 20:19114324-19114346 GCCTCTCTTCCACCACCACCGGG - Intergenic
1170941747 20:20853936-20853958 GGGGCACATCCACCCCCAGCTGG + Intergenic
1172630220 20:36373525-36373547 GTGTACCATCCACCACCAGCTGG + Intronic
1173579004 20:44132932-44132954 AGGTCTCACCCACCCCCACCGGG + Intronic
1175983850 20:62754623-62754645 GGGACTCATGCACCCTCAGCTGG - Intronic
1176231587 20:64035889-64035911 GGCTCCCCTCCCCCACCAGCTGG + Intronic
1179721246 21:43317107-43317129 TGGTCTCCTCCACCAGGAGCTGG + Intergenic
1180178035 21:46099590-46099612 GGGGCTCACCCGCCACAAGCAGG + Intronic
1180859759 22:19071063-19071085 GGGCCTCTTCCACCTCCACCAGG + Intronic
1181332402 22:22103418-22103440 TGGTTTTAGCCACCACCAGCTGG - Intergenic
1184878346 22:47289535-47289557 GGGTATCATCAGCCACCTGCAGG - Intergenic
956604047 3:71053653-71053675 GGTTCTCCTCCAGCAGCAGCAGG - Exonic
961002259 3:123381965-123381987 GGGCCTTGCCCACCACCAGCTGG - Intronic
961624250 3:128248937-128248959 TGCCCTCATCCAGCACCAGCAGG + Intronic
968915404 4:3495062-3495084 GGGCCACATCCACTACCTGCTGG + Intronic
969084631 4:4646719-4646741 GGGTCTCATTCACGACCACATGG + Intergenic
970691931 4:18630581-18630603 GGGTCCCATCCACCACCCAAGGG - Intergenic
971048939 4:22838776-22838798 GTGTCTCTTCCAACACCAGATGG - Intergenic
972585460 4:40433391-40433413 GGGTCTCTTCCACAACAGGCAGG - Intronic
975498203 4:75057510-75057532 GGGTCTCCTGTCCCACCAGCTGG - Intergenic
975791723 4:77960504-77960526 CTGTGTCATCCAGCACCAGCTGG + Intergenic
976767941 4:88617992-88618014 GGGTCTCCTCCAGGACGAGCTGG + Intronic
978238404 4:106487748-106487770 GGGTCTCAACCACCTCCTACTGG - Intergenic
983183964 4:164679836-164679858 GGGTCTCATAAGCCACCTGCAGG - Intergenic
987461332 5:18214762-18214784 GGGTCTCTCCCACAACCTGCAGG + Intergenic
987596805 5:20011801-20011823 AGGGCTCATCCACCACAATCAGG - Intronic
990410934 5:55540365-55540387 GAGTTTCATCCACCACTAGTGGG - Intergenic
991965796 5:72089390-72089412 GGATCTCATGAACCACCAGGGGG - Intergenic
998382614 5:141736318-141736340 GGGTCTCATCCACAGGCATCAGG - Intergenic
1002058473 5:176612137-176612159 GGAGCCCATCCACCTCCAGCTGG + Intergenic
1005878620 6:30036132-30036154 GCGTCATATCCACCACCAGATGG + Intergenic
1010676774 6:78754421-78754443 GGATCTCATCCAAGACCACCAGG + Intergenic
1014740454 6:125143142-125143164 GGGTCACAGGCACCCCCAGCTGG - Intronic
1019219895 6:170464860-170464882 GGGCCCCCTCCACCACCAGCAGG - Intergenic
1023989081 7:45117451-45117473 GGGTCTTTTGCACCCCCAGCAGG + Intergenic
1028484414 7:91342391-91342413 AGGTCTCATCTGCCAACAGCTGG + Intergenic
1029187087 7:98746999-98747021 GGGTCCCATCCGCTGCCAGCTGG + Intergenic
1030674545 7:112370772-112370794 CCATCTCATCCACCCCCAGCTGG + Intergenic
1031994266 7:128218623-128218645 GTGGCTCTTCCATCACCAGCTGG + Intergenic
1034120719 7:148625059-148625081 GGACCTCTTCCTCCACCAGCAGG + Intergenic
1037331596 8:17748597-17748619 GGGTCACAGACACCACCACCTGG + Intronic
1037597152 8:20363795-20363817 GACTCTCATCCACCAGAAGCTGG + Intergenic
1039392996 8:37196976-37196998 GGGTCTCACCCTCCATCAGCAGG + Intergenic
1043951323 8:86311987-86312009 GGGTCTCAGGCACCCCCACCTGG + Intronic
1044694129 8:94905789-94905811 GGCTGGGATCCACCACCAGCTGG + Intronic
1048820721 8:138378275-138378297 GGGTCTCAGCCACCACCAGTAGG - Intronic
1049002421 8:139834497-139834519 GGGACCCCTCCACCGCCAGCAGG + Intronic
1051553474 9:18356268-18356290 AGGTTTCATCCAGGACCAGCAGG + Intergenic
1052620198 9:30898734-30898756 GGATCTCTTCCACCACTAACAGG + Intergenic
1056118732 9:83466012-83466034 CGTTCACATCCACCAACAGCTGG + Intronic
1057221082 9:93258247-93258269 GGGTGTCAGCCACCCCCAGGAGG + Intronic
1058735483 9:107890240-107890262 AGGACTCATCTACCAGCAGCAGG - Intergenic
1059443723 9:114325315-114325337 GGCTCTCATCCACCACCCCTGGG - Intronic
1059444924 9:114332092-114332114 GGCTCTCATCCACCACCCCTGGG - Intronic
1059490510 9:114662613-114662635 GAGTCTCATTCACCTGCAGCTGG + Intergenic
1059548008 9:115198315-115198337 AGGGCTCATACACCAGCAGCCGG + Intronic
1061096614 9:128460898-128460920 GGGTCACTTCCACACCCAGCTGG - Intronic
1185557327 X:1031725-1031747 GGGCCTGGTCCACCAGCAGCAGG + Intergenic
1186720716 X:12300768-12300790 GGGCCACCTCCACCACCACCTGG - Intronic
1188708200 X:33361308-33361330 AGATCTCATCCACCACGATCAGG + Intergenic
1189037610 X:37508335-37508357 GAGACTCATTCACCACCAGTAGG + Intronic
1195903091 X:109818678-109818700 GTCTCTCATCAGCCACCAGCTGG + Intergenic