ID: 1105424324

View in Genome Browser
Species Human (GRCh38)
Location 13:20282283-20282305
Sequence GGCTGCACACTCTATGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 29, 2: 56, 3: 75, 4: 257}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105424322_1105424324 -4 Left 1105424322 13:20282264-20282286 CCTCAAGGAGCGCATGTGGGGCT 0: 1
1: 0
2: 1
3: 9
4: 91
Right 1105424324 13:20282283-20282305 GGCTGCACACTCTATGGAGCTGG 0: 1
1: 29
2: 56
3: 75
4: 257
1105424316_1105424324 11 Left 1105424316 13:20282249-20282271 CCATCATGCCGGCTGCCTCAAGG 0: 1
1: 0
2: 2
3: 27
4: 174
Right 1105424324 13:20282283-20282305 GGCTGCACACTCTATGGAGCTGG 0: 1
1: 29
2: 56
3: 75
4: 257
1105424318_1105424324 3 Left 1105424318 13:20282257-20282279 CCGGCTGCCTCAAGGAGCGCATG 0: 1
1: 0
2: 1
3: 12
4: 103
Right 1105424324 13:20282283-20282305 GGCTGCACACTCTATGGAGCTGG 0: 1
1: 29
2: 56
3: 75
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105424324 Original CRISPR GGCTGCACACTCTATGGAGC TGG Intergenic
900183067 1:1320859-1320881 GGCTGCACCCTGTGGGGAGCAGG - Intronic
900295524 1:1947209-1947231 GGCTGCACCCTCTCTGGGCCTGG - Intronic
901691036 1:10973641-10973663 GGTCGAACACTCTATGGAGCTGG + Intronic
901865666 1:12105171-12105193 AGTTGCAGACTGTATGGAGCCGG + Intronic
901936435 1:12630283-12630305 GGCTGCATGTTCCATGGAGCTGG + Intergenic
902644904 1:17791240-17791262 GGCTGTACACTCCGTGGAGCTGG - Intronic
903082207 1:20819998-20820020 GGCCGTACACTGCATGGAGCCGG + Intronic
903189569 1:21649210-21649232 GGCTGCCCTCTCTTTGGAGGAGG - Intronic
903672273 1:25043432-25043454 GGCTGCATTCTCCATGGAGCTGG - Intergenic
904551650 1:31324375-31324397 GGCTGCATGTTCTATGGAGCTGG + Intronic
904601512 1:31675184-31675206 GGCTGCTCAGGCTATGAAGCTGG - Intronic
905001147 1:34671165-34671187 GGCTGCACACTCCGTGAGGCAGG + Intergenic
905684469 1:39898902-39898924 GGCTGCAAAATGTGTGGAGCAGG - Intronic
905899990 1:41575060-41575082 GACTGCACACTGTATGCACCAGG - Intronic
907369783 1:53993188-53993210 GGCTGCACACTCTGTGAAGCCGG - Intergenic
907603521 1:55793800-55793822 GGATGCACACTCTGTGGAGCTGG + Intergenic
907614675 1:55912368-55912390 GGCTGCATGCTGCATGGAGCCGG + Intergenic
907761655 1:57367680-57367702 GGTTCCACACTCCGTGGAGCTGG + Intronic
909054764 1:70807506-70807528 GGCTGCATGCTCCATGGAGCTGG - Intergenic
909282219 1:73770411-73770433 GGCTGCATGCTCCACGGAGCTGG + Intergenic
910602281 1:89044189-89044211 GGTTGCATGCTCCATGGAGCCGG - Intergenic
910768792 1:90809933-90809955 GGCTGAACATTATATGGAGAAGG - Intergenic
911227560 1:95323750-95323772 GGCAGCACACTCTTTGGATGAGG - Intergenic
912881954 1:113424162-113424184 AGCTGCACACTCCTTGGAGCTGG - Intronic
913491626 1:119385213-119385235 GTCTGGAAACTCTAGGGAGCAGG - Intronic
914392901 1:147237585-147237607 GGCTGCCAGCTCCATGGAGCTGG - Intronic
915079686 1:153343557-153343579 GGCAGCACACACTTTGGAGGAGG - Intronic
915390937 1:155543394-155543416 TGCTGCACCCTCTAAGTAGCTGG - Intronic
916648995 1:166817230-166817252 GGCTGTACACTCCATAGAACTGG - Intergenic
917848937 1:179043459-179043481 GGCTGCACACTCCACGGAGCTGG - Intronic
919513554 1:198494700-198494722 GGCTGCAGGCTCCATGGAGCCGG - Intergenic
921767051 1:218983994-218984016 GGCTGCATACTCAATGGAGCTGG - Intergenic
922852312 1:228743556-228743578 GGCTGAACACTCGATGTAGGAGG - Exonic
923918090 1:238530756-238530778 GGCTACTCACTCTGTGGAGATGG - Intergenic
924672885 1:246147499-246147521 GGCTGCACACTCCATGGAGGCGG + Intronic
924672911 1:246147601-246147623 GGCTTCCTGCTCTATGGAGCAGG + Intronic
924679784 1:246220270-246220292 GCCTGCACACTCCACAGAGCAGG + Intronic
1064674556 10:17748225-17748247 GGCTGGACACTCTATGGCCCAGG + Intergenic
1065201582 10:23317486-23317508 GGCTGTACACTCTACTAAGCTGG - Exonic
1066695160 10:38070722-38070744 GCCTGCACGCTCTCTTGAGCAGG + Intergenic
1067170287 10:43900352-43900374 GCCTGCTCACTCCATGAAGCGGG + Intergenic
1067305351 10:45059081-45059103 GGCTGCGCATTCTAGAGAGCAGG + Intergenic
1068300503 10:55132100-55132122 GGCTACACACTCCATGGAGCTGG - Intronic
1068474304 10:57506581-57506603 GGCTGCACGCTCCATGGAGCTGG + Intergenic
1069731905 10:70622555-70622577 GGCTGCACACTCCATAAAGCTGG + Intergenic
1070096333 10:73340959-73340981 GCCTACACGCTCCATGGAGCTGG - Intronic
1070401517 10:76056911-76056933 GGCTGCTTGCTCTATGGAGCTGG - Intronic
1070684843 10:78472694-78472716 AGCTGCACACTCATTAGAGCGGG - Intergenic
1071140226 10:82501101-82501123 TGTTGCAAACTATATGGAGCTGG + Intronic
1072470351 10:95707304-95707326 GGCCTCATGCTCTATGGAGCAGG - Intergenic
1072871459 10:99124866-99124888 GGCTGCACACTCCATGGAGCTGG - Intronic
1074028670 10:109663339-109663361 GGCCTCCCACTCCATGGAGCAGG + Intergenic
1074991660 10:118713412-118713434 GGCTGCATGCTCCATGGAGCCGG - Intronic
1075263807 10:120984088-120984110 GGCAGGACACACTATGGGGCAGG - Intergenic
1076313383 10:129523738-129523760 CTCTGCTCTCTCTATGGAGCTGG - Intronic
1076655352 10:132019937-132019959 GGCTGCACACTCCACAGAGCCGG - Intergenic
1077476686 11:2793806-2793828 GGCTGTACATTCTAAGGAGCAGG - Intronic
1077894592 11:6444116-6444138 GGCTGTATACTCCAGGGAGCAGG + Intergenic
1077912596 11:6586589-6586611 GGCTGCATGCTCCATGGAGCCGG + Intronic
1078042911 11:7884616-7884638 GGCTGCATGCTCCATGGAGCTGG - Intergenic
1078315327 11:10289410-10289432 GGCTGCACACTCCACGGACCTGG - Intronic
1079733141 11:23961765-23961787 GGCTGCACACTCCATGGAGCTGG + Intergenic
1085212313 11:74791883-74791905 GGCTGTACGCTCCACGGAGCCGG - Intronic
1087036095 11:93758185-93758207 GGCTACACACTCTATGGAGCGGG + Intronic
1088704413 11:112448406-112448428 GGCTGCACACTCCATGGAGCTGG - Intergenic
1089823011 11:121246054-121246076 GGCTGTACACTCCATAGAGCTGG + Intergenic
1090571999 11:128057586-128057608 AGCTCCACTCTGTATGGAGCAGG - Intergenic
1090611337 11:128473765-128473787 AGCTGCTCACTCTCTGCAGCAGG + Intronic
1093183165 12:15989210-15989232 GGCTGCACACTCCGTGGAGCTGG - Intronic
1093525852 12:20102665-20102687 GGCTGCATGCCCTGTGGAGCTGG - Intergenic
1094427145 12:30327802-30327824 GGCTGCACACTCCATGGAGCTGG + Intergenic
1095252586 12:39996593-39996615 GGCTACACACTGCATGGGGCGGG - Intronic
1095767446 12:45912690-45912712 GACTTCACACACTTTGGAGCAGG + Intergenic
1099049884 12:77768806-77768828 GGTTGCACACTCCATGGAGCTGG - Intergenic
1099370912 12:81828944-81828966 GGCTGCTCTGTCTATGGAGTAGG - Intergenic
1099683462 12:85857187-85857209 AGCTGTGCACTCCATGGAGCTGG - Intergenic
1100388346 12:94124244-94124266 GGCTGAACATTCTCTGGAGATGG + Intergenic
1100847730 12:98678360-98678382 GGCTGCATGCTCTGTGGAGCTGG + Intronic
1103177413 12:118876772-118876794 GGCTGCACACTGACTGGGGCTGG + Intergenic
1104729447 12:131097016-131097038 TGCTGGACAGTCTATGGATCTGG + Intronic
1105041704 12:132966472-132966494 GGCTACATGCTCCATGGAGCTGG + Intergenic
1105419886 13:20242618-20242640 GGCTGAACACTCTATGATGCTGG - Intergenic
1105424324 13:20282283-20282305 GGCTGCACACTCTATGGAGCTGG + Intergenic
1107731674 13:43355485-43355507 ACATGCACACTCTATAGAGCTGG + Intronic
1109030157 13:57180136-57180158 GGCTGCATGCTCCATGGAGTTGG - Intergenic
1110264121 13:73518969-73518991 GGCTGCTCTGTCTATGGAGTAGG - Intergenic
1110939363 13:81330403-81330425 GGCTGCACACTCCATGACACAGG + Intergenic
1111202959 13:84962578-84962600 GGCTGCATGCTCTGAGGAGCCGG - Intergenic
1111800627 13:92975404-92975426 GGTTGCACACTCCATGGAGCTGG - Intergenic
1112741030 13:102472675-102472697 GGCTGCATGCTCTGTGGAGCTGG - Intergenic
1113447355 13:110379616-110379638 GGGTGCACAGACCATGGAGCTGG + Intronic
1115310712 14:31975213-31975235 GGCTGTACACTCTGTGGAGCCGG - Intergenic
1115484839 14:33900856-33900878 GGCTGTGCACTCCATGGAGCTGG + Intergenic
1116130725 14:40854028-40854050 GGCTGCACACTACTTGGAGCTGG + Intergenic
1116159861 14:41254119-41254141 ACCTGTGCACTCTATGGAGCTGG - Intergenic
1116257103 14:42570891-42570913 GGCTACACATTCCATGGAGCTGG + Intergenic
1117285611 14:54283099-54283121 GGCTGGGCCCTCCATGGAGCTGG - Intergenic
1118192743 14:63594989-63595011 GTCTGCAGGCTCTTTGGAGCTGG - Intergenic
1118323999 14:64769325-64769347 AGGTGCACACACTTTGGAGCTGG - Intronic
1119618005 14:76111579-76111601 GGCTGTGCACTCCATGGAGCTGG + Intergenic
1120745401 14:88147097-88147119 GGCCTCCCACTCCATGGAGCAGG + Intergenic
1121209507 14:92197558-92197580 GGCTGAACACTCAATGATGCTGG - Intergenic
1121824768 14:97001081-97001103 GGCTGCACGTTCCATGGAGCAGG - Intergenic
1123893374 15:24803329-24803351 GGCTGCATGCTCCACGGAGCTGG - Intergenic
1124650408 15:31469679-31469701 GGCTGCACACTCCATGGAGCTGG - Intergenic
1125771623 15:42171322-42171344 GGCTGCACACACTCATGAGCTGG - Intronic
1126797771 15:52274188-52274210 GACTGCACACTCCATGAAGGCGG - Intronic
1128790797 15:70432114-70432136 GGCTGCACACTCCATGGAGCTGG - Intergenic
1129331620 15:74830751-74830773 GGCTGGACACGCAAGGGAGCTGG - Exonic
1129796628 15:78382346-78382368 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1130015345 15:80181630-80181652 AGCAGCACACTCTTTAGAGCTGG + Intronic
1130029183 15:80296245-80296267 GGCTGCACACTCCATGGAGCTGG - Intergenic
1130183011 15:81651101-81651123 GACTACACACTCCGTGGAGCTGG + Intergenic
1131825547 15:96320696-96320718 CGCAGCACACTCCATGGAGATGG - Intergenic
1132039654 15:98514228-98514250 GACTGCACTTTCCATGGAGCAGG - Intronic
1132305202 15:100807230-100807252 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1134078575 16:11309157-11309179 GGCTGCACATTCTCTGGAGGTGG - Intronic
1135114359 16:19712741-19712763 GGCCGGACACTGTCTGGAGCAGG + Intronic
1135986678 16:27189386-27189408 GGCTGTGCACTCCACGGAGCTGG + Intergenic
1136253803 16:29024789-29024811 GGCTGCCCAACCCATGGAGCTGG - Intergenic
1137238422 16:46633976-46633998 GGCTGCACACTCCATGGAGCTGG - Intergenic
1137291691 16:47055819-47055841 GGCTGCACACTCCATGGAGCCGG - Intergenic
1137588496 16:49679262-49679284 GGCTGCGCCCTCCGTGGAGCTGG + Intronic
1139354581 16:66359995-66360017 GGCTGCACCATCTGTGGGGCAGG - Intergenic
1139390114 16:66601963-66601985 GGCTGCACACTCCATGGAGCAGG - Intergenic
1140923899 16:79564906-79564928 GGCTGCACACTCTCTGCCTCTGG + Intergenic
1141601181 16:85127235-85127257 GGCTGCCCGCTCTATGCAGGGGG + Intergenic
1143975306 17:10825066-10825088 GGCTCCACCCTCCATGCAGCCGG - Exonic
1144632168 17:16879807-16879829 GGCTGCCCACACTGTGGAGAAGG - Intergenic
1144714353 17:17423975-17423997 GACTGCACACTCCATGGAGCTGG + Intergenic
1145208839 17:20998376-20998398 GGCTGCCCACACTGTGGAGAGGG + Intergenic
1146086789 17:29837827-29837849 GGCTGCGCACTCCATGGAGCTGG + Intronic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147628601 17:41915806-41915828 GGCTGCACTCTCTTTGGAAGGGG - Intronic
1148546368 17:48522271-48522293 GGCTGAACTCTCTATGAACCGGG + Intergenic
1149085299 17:52709658-52709680 GGCTGCACACTACATGGAGCGGG + Intergenic
1149159790 17:53678159-53678181 GGCTGTGCACTCCATAGAGCCGG + Intergenic
1149160588 17:53687540-53687562 GGCTGCACACTCCATGGAGCTGG - Intergenic
1149330701 17:55577960-55577982 GGCTGCACACTCCGTGGAGCTGG - Intergenic
1149454618 17:56777731-56777753 GGCTGCATCCTCCATGGAGATGG + Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1149934569 17:60792222-60792244 GGCTGCATGCTCCACGGAGCCGG + Intronic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1151895064 17:76974644-76974666 GGCTGTACACTCTACAGAGCAGG + Intergenic
1155120861 18:22817001-22817023 GGCTGCACACTCCATGGAGCGGG - Intronic
1155830975 18:30514264-30514286 GGCTGCACACTCCATGGAGCAGG - Intergenic
1156298984 18:35818473-35818495 GGCTGCACGCTCCGTGGAGCTGG - Intergenic
1157043006 18:44061662-44061684 GGCTGCTCGCTCCAAGGAGCCGG - Intergenic
1157616109 18:48988731-48988753 GGGTGCACCCTGTATGAAGCTGG - Intergenic
1158045133 18:53146381-53146403 GGCTGCATCCTCTATGGAGCAGG + Intronic
1158632879 18:59131773-59131795 GGCTGCACACCCCATGGAGCTGG + Intergenic
1159186557 18:64983540-64983562 GGCTGCACCCTCCATGAAGCTGG + Intergenic
1159519255 18:69496390-69496412 GGCTGCACCCTCCATAGACCTGG - Intronic
1160147605 18:76377635-76377657 GGCTGCAAACTCCAGGCAGCTGG - Intronic
1160474265 18:79168060-79168082 GGCTGCATGCTCCATGGAGCTGG - Intronic
1162854943 19:13460944-13460966 GACTGCACACTCTATGCACGTGG + Intronic
1163145443 19:15376798-15376820 GGCTCCACAGTCTCTGTAGCAGG - Intronic
1165027105 19:32969949-32969971 GGCTGCACACTTCATGGAGCCGG - Intronic
1165522084 19:36322475-36322497 GGCTCCACACACTATAGCGCAGG + Intergenic
1166179291 19:41095666-41095688 GGCTGCACTCTCTAGGGAGGAGG - Intronic
1167013016 19:46821513-46821535 GGCTACACACTCCATGGAGCCGG + Intergenic
1167234918 19:48308628-48308650 GGCTGCACACTCCATGGAGCCGG + Intronic
1168303266 19:55419264-55419286 GGCTGCACGTTTCATGGAGCCGG + Intergenic
925711002 2:6740055-6740077 GAAAGCACACTCTATGGAGGAGG - Intergenic
925894915 2:8463563-8463585 AGCTGCACCCACAATGGAGCAGG - Intergenic
926078818 2:9966782-9966804 GGCTGCAGACTCTAGGCAGTTGG + Intronic
926859428 2:17292417-17292439 GGCTGCACACTCCATGGAGCTGG - Intergenic
927642844 2:24856435-24856457 GGCTGGACACTCTAAGAATCTGG - Intronic
927743328 2:25591346-25591368 GGCTGCATGCTCCATAGAGCTGG - Intronic
928470402 2:31569150-31569172 GGCTGCGCACTCCACAGAGCTGG - Intronic
928723801 2:34148419-34148441 GGCTATACACTCCACGGAGCAGG - Intergenic
930800429 2:55437980-55438002 GACTGCACATTCCATGGAGCTGG + Intergenic
931125943 2:59276268-59276290 TGCTGCACACTCTATGCAAGTGG + Intergenic
931544533 2:63367757-63367779 GGCTGGGCAGTCTATGGATCAGG + Intronic
931890046 2:66661753-66661775 GGCTGCACTCTCACTGTAGCAGG + Intergenic
932113445 2:69022793-69022815 GGCAGCACACACCTTGGAGCTGG + Intronic
932414079 2:71563439-71563461 AGCTGCACACTCTGGAGAGCAGG - Intronic
932501742 2:72188174-72188196 GGCTGCAGACTCCATGGAGCTGG - Intronic
933420720 2:82042724-82042746 GGCTGTGCACTCCCTGGAGCTGG + Intergenic
936290283 2:111217497-111217519 GGCCTCCCACTTTATGGAGCAGG - Intergenic
938195072 2:129319553-129319575 GTCAGCACACTCCATGGAGCTGG - Intergenic
938722196 2:134076715-134076737 GGCTGCATGCTCCATGGAGCCGG - Intergenic
939605814 2:144253958-144253980 GGCTGCACACAGCAGGGAGCAGG - Intronic
940396388 2:153196602-153196624 GCCTGCATGCTCCATGGAGCAGG - Intergenic
940612343 2:156006981-156007003 GGTTGCATGCTCCATGGAGCCGG - Intergenic
941151288 2:161918827-161918849 AGCTGCATGCTCTGTGGAGCAGG + Intronic
942114490 2:172713835-172713857 GGCTGTGCGCTCCATGGAGCCGG - Intergenic
943189886 2:184663084-184663106 GGCTGCATGCTCAATGGACCTGG + Intronic
943190876 2:184679384-184679406 GGATGCATGCTCCATGGAGCTGG + Intronic
943427132 2:187750574-187750596 GGCTGGATGCTCCATGGAGCCGG - Intergenic
943526158 2:189020385-189020407 GGCTGCACACTCCATGGAGCTGG + Intergenic
943961062 2:194264646-194264668 GGCTACACACTCCATGGAGCAGG + Intergenic
944483693 2:200181957-200181979 GACTGCACGCTCAGTGGAGCTGG + Intergenic
944586456 2:201177983-201178005 GGGTGCACACTCCACGGAGCTGG + Intergenic
945330246 2:208530490-208530512 GGCTGCACACTCTGTGGAGCCGG - Intronic
945770528 2:214035888-214035910 GGCTGTGCACTCCATGGAGCTGG - Intronic
946495458 2:220191917-220191939 GGCCGTGCACTCCATGGAGCTGG + Intergenic
947327429 2:228993133-228993155 GGCTTCTCACTCCATGTAGCAGG - Intronic
947707733 2:232290197-232290219 GGCTGCACTCTCTCTCCAGCTGG + Intronic
1168845062 20:938841-938863 GGCTGCACAGCCTTTGTAGCAGG - Intergenic
1168983537 20:2027435-2027457 GGCTGCACACTCCATGGAGCTGG - Intergenic
1170500888 20:16974629-16974651 GCCTGTACATTCCATGGAGCGGG + Intergenic
1172439013 20:34952336-34952358 GGCTGAACATTCTGGGGAGCTGG + Intronic
1172501277 20:35429528-35429550 GGCTACGAACTCAATGGAGCTGG - Intergenic
1172676537 20:36676841-36676863 GGCTGCACACGCCATGGAGCTGG + Intronic
1173524620 20:43722043-43722065 AGCTGCACACTCCATGGATCTGG - Intergenic
1174668648 20:52284731-52284753 GGCTGCACAGTCTCTGGACCTGG + Intergenic
1175001494 20:55634001-55634023 GACTGCATACTCTACAGAGCAGG - Intergenic
1175064292 20:56272311-56272333 TGCTGCACACTCCATGAAGCTGG + Intergenic
1176085232 20:63292834-63292856 GGCTGCCCACTGTGGGGAGCAGG - Intergenic
1176104459 20:63379389-63379411 GGCTGTGCGCTCTGTGGAGCTGG + Intergenic
1177736101 21:25092477-25092499 GGCTGCACACTCCATGGAGATGG - Intergenic
1178632158 21:34271401-34271423 GGCTGCACACTCTCCTGAGAAGG - Intergenic
1184054536 22:42035498-42035520 GGCTGCATGCTCCATGGAGAAGG - Intronic
1184173747 22:42774478-42774500 GGCTACACGTTCCATGGAGCTGG + Intergenic
1184665594 22:45987315-45987337 GGCCGCATACTCCATGGAGCAGG + Intergenic
1185024961 22:48403593-48403615 GATTGCACACCCCATGGAGCAGG + Intergenic
951509029 3:23480514-23480536 GGCTGCACCCTCCATGGAACCGG - Intronic
951509777 3:23487447-23487469 GGCTGCATGCTCTGTGAAGCTGG - Intronic
952015973 3:28958516-28958538 GGCTGTACAAGTTATGGAGCCGG + Intergenic
952016030 3:28958777-28958799 GGCTGAAGACTCCACGGAGCAGG + Intergenic
952054191 3:29424514-29424536 GGCTGGACACATTATGGAGTTGG + Intronic
952269552 3:31817783-31817805 GGCTGCACACTCCATGGAGCTGG - Intronic
953163661 3:40445169-40445191 GGTTGTACACTCCATGGAACAGG + Intergenic
954099477 3:48358205-48358227 GGCCTCCCACTCCATGGAGCAGG - Intergenic
955241625 3:57183117-57183139 TGCTGCACACTCCATGGAGCCGG - Intergenic
955446624 3:59017917-59017939 GGCTGCACTCTGTTTGTAGCTGG - Intronic
956990136 3:74752471-74752493 GGCTACACATTCTGTGGAGTCGG - Intergenic
957613917 3:82505205-82505227 GGCTGCATGCTCCACGGAGCTGG + Intergenic
957653255 3:83035831-83035853 GGCCCCACACTCTACAGAGCTGG - Intergenic
958418605 3:93906581-93906603 GGCTGCACGTGCCATGGAGCTGG + Intronic
959389856 3:105759879-105759901 GGCTGTGTGCTCTATGGAGCAGG - Intronic
960634413 3:119768818-119768840 GGCTGCACCCTCCATGGAGCTGG - Intergenic
960690441 3:120341714-120341736 GGCTGCACATTCCATGGAGCTGG + Intronic
960845978 3:122005077-122005099 TGCAGCACATTCTATGAAGCTGG + Intronic
961493460 3:127273919-127273941 GGATGCACACTCCATGGAGCCGG + Intergenic
962105419 3:132383727-132383749 GGCTGCATGCTCCATGGAGCCGG - Intergenic
962716539 3:138131032-138131054 GGCAGCAGACTCTACGGAACAGG + Exonic
962786093 3:138769138-138769160 GGCTGCATGCTCTGTGGAGCTGG - Intronic
962824689 3:139089260-139089282 GGCTGCACACTCCATGGAGCTGG - Intronic
963346155 3:144098823-144098845 GGCTGCTGGCTCTATGGAGCTGG + Intergenic
964075337 3:152685187-152685209 GGCTGTGCTCTCTATGGAGCTGG - Intergenic
965118748 3:164522693-164522715 GGCAGCACACTCCTTGAAGCCGG - Intergenic
965118898 3:164524478-164524500 GGCTGCACATTTACTGGAGCTGG - Intergenic
965205314 3:165713729-165713751 GGTTGCACACTCCATGGAGCCGG - Intergenic
965272401 3:166635635-166635657 GGCTGCAAAATATTTGGAGCAGG + Intergenic
965541941 3:169879828-169879850 GACTGCACAATCCATGGAGCTGG + Intergenic
965813538 3:172614873-172614895 GGCTGCACACTCCATGGAGCTGG - Intergenic
966491314 3:180531447-180531469 GGCTGCCCACTCCATGGAGCTGG + Intergenic
966840022 3:184081036-184081058 GGCTGCGCACTCCACTGAGCAGG + Intergenic
967480405 3:189966243-189966265 GGCTGCCCACTCCCTGGTGCTGG + Intronic
967650013 3:191974081-191974103 AGCTGCACACTCCATGAAGCTGG - Intergenic
968538853 4:1151979-1152001 GGCTGCATGCTCCATGGAACTGG - Intergenic
968967187 4:3775006-3775028 GGCAGCACACTCTAGGAAACGGG - Intergenic
969194041 4:5546841-5546863 GGAGGCATACTCCATGGAGCTGG + Intronic
972128436 4:35800690-35800712 GGCTGCATTATCCATGGAGCAGG + Intergenic
972158981 4:36199104-36199126 GGCTGCATACTCTACAGAGATGG - Intronic
972203734 4:36747331-36747353 GGCCACACACTCCATGGAGCCGG + Intergenic
972931194 4:44072742-44072764 GGCTACACATTCTGTGGAGCTGG - Intergenic
974514879 4:62896850-62896872 TGCTGCACACTTTGTGGAGCTGG + Intergenic
974619720 4:64340143-64340165 GACTGCATGCTCCATGGAGCTGG + Intronic
975537783 4:75470319-75470341 GGCTGCAGACTGAATGAAGCAGG + Intergenic
976129546 4:81870424-81870446 GGCCGTTCACTCCATGGAGCTGG + Intronic
976922765 4:90458239-90458261 GGCGGTGCACTCCATGGAGCAGG - Intronic
977674737 4:99734504-99734526 GGCTGCTCTGTCTATGGAGTAGG - Intergenic
978663546 4:111155145-111155167 GGCTGCGCACTCCATGGAGCTGG - Intergenic
978964697 4:114726073-114726095 GGCTGCACACTCCATGGAGCTGG - Intergenic
980282151 4:130736478-130736500 GGCTGTATGCTCTATGGATCTGG + Intergenic
980740629 4:136946326-136946348 GGCTGCACACTCCACGGAGCTGG + Intergenic
980750170 4:137077387-137077409 TCCTGCCCACTCTATGGAGTGGG + Intergenic
982158173 4:152541028-152541050 GCCTGCACACTCCATGCAGCAGG - Intergenic
983914937 4:173281836-173281858 GGCTCCACATTCTGTGGAGGAGG - Intronic
984526873 4:180867449-180867471 GGCTGCACGCTCCACGGAGGTGG - Intergenic
985916023 5:2919792-2919814 GGCTGCATACTCTGTGGAGCTGG + Intergenic
987875291 5:23674350-23674372 GGCTGCTTACTCCACGGAGCTGG + Intergenic
988073857 5:26326567-26326589 GGCTGCATGCTCCATGGAGCGGG - Intergenic
989781628 5:45272498-45272520 GGCTGGAAACTCAATGTAGCAGG - Intronic
991230750 5:64330784-64330806 GGCTGCACATTCCACAGAGCTGG + Intronic
991359458 5:65803841-65803863 GGCTGTGCGCTCCATGGAGCTGG - Intronic
992029794 5:72709515-72709537 GGCTGTACACTCCATGGAGCTGG - Intergenic
993166399 5:84359798-84359820 TGCAGCACAGTCTATGGGGCAGG + Intronic
994245532 5:97471703-97471725 GGCTGCATGCTCCATGGAGCTGG - Intergenic
998792168 5:145777617-145777639 GGCTGCACACTCCATGAAGCTGG + Intronic
999217598 5:149948280-149948302 AGCTGCACACTCTTTGGACCTGG - Intergenic
1001599874 5:172921930-172921952 GCCTGCACCCTCAATTGAGCCGG + Intronic
1002076678 5:176712613-176712635 GGCAGCACAGCCGATGGAGCAGG + Intergenic
1002643493 5:180641517-180641539 GGCTGCAGACTGGAGGGAGCTGG + Intronic
1002693834 5:181070789-181070811 AGCTGCACGCTCCAGGGAGCTGG - Intergenic
1004520667 6:16358613-16358635 TGCTGCATACTCCATGGAGCTGG + Intronic
1004696891 6:18042557-18042579 GGCAGCACACTCCATGGAGCTGG + Intergenic
1005021622 6:21423887-21423909 GGCTGCACACTCCATGGAGCCGG - Intergenic
1006500747 6:34457572-34457594 GGCTGCACACTCCATGGAGCTGG + Intergenic
1006500815 6:34457848-34457870 GGCCTCCCACTCCATGGAGCAGG + Intergenic
1006867794 6:37222833-37222855 GGTTACACACTCCATGGAGCCGG - Intronic
1007649821 6:43412590-43412612 GGCCCCCCACTCCATGGAGCAGG + Intergenic
1008231482 6:48989613-48989635 TGCTGCATGCTCCATGGAGCTGG + Intergenic
1010887727 6:81264017-81264039 GGCTGCATGCTCTACAGAGCTGG - Intergenic
1011524648 6:88251284-88251306 CTCTCCACACTCTATGGAGTGGG - Intergenic
1012052423 6:94361911-94361933 TGCTGCACACTCCACGGAGCAGG - Intergenic
1012231258 6:96762954-96762976 GCCTGCAAACTCCATGGAGTGGG - Intergenic
1012749634 6:103140827-103140849 GGCTGCACACTCCACAGAGCTGG - Intergenic
1012889806 6:104885469-104885491 AGCTGCATGCTTTATGGAGCCGG + Intergenic
1014227280 6:118862308-118862330 GGCTGTACGCTCCATGGAGCTGG - Intronic
1015434616 6:133172115-133172137 GGCTGAGCACTACATGGAGCTGG + Intergenic
1015455806 6:133424870-133424892 GGCTGCACACTCCATGGAGCGGG - Intronic
1016915174 6:149237950-149237972 GGGTGCACACACTGTGGGGCTGG - Intronic
1016957774 6:149643081-149643103 GGCAGCTCACTCTGTGGAGCTGG - Intronic
1017073327 6:150596182-150596204 GTCTTCAAATTCTATGGAGCCGG - Intergenic
1017993830 6:159513619-159513641 GGCTGCACGCTCCATGGGGCTGG + Intergenic
1018660042 6:166077156-166077178 GGCTGCACACTCTGTAGAGCTGG - Intergenic
1018950863 6:168378031-168378053 GACGGCACACTCTGTGGAGAAGG - Intergenic
1019296247 7:276833-276855 GGCTGCACACCCCAGGTAGCTGG - Intergenic
1019643989 7:2119434-2119456 GGGCGCACACTCTCTGTAGCTGG + Intronic
1021561568 7:21972718-21972740 GGCTGCATACTCCATGGAGCCGG - Intergenic
1023622919 7:42091158-42091180 GGCCTCACAAACTATGGAGCTGG + Intronic
1023790561 7:43750068-43750090 GGCCTCCCACTCTAGGGAGCAGG - Intergenic
1023790629 7:43750343-43750365 GGCTGCACACTCCATAGAGCTGG - Intergenic
1024254642 7:47531739-47531761 GGCTGCACTCTCCATGGAGCCGG + Intronic
1024786354 7:52911681-52911703 GGCTGTGCACTCCAGGGAGCTGG - Intergenic
1024997672 7:55285905-55285927 TGATACACACTCTTTGGAGCTGG - Intergenic
1027128239 7:75572622-75572644 GGCTGCACACTCCATGGAACAGG + Intronic
1027575064 7:79921778-79921800 GGCTGCCCAATCCATGGAGTCGG + Intergenic
1029899188 7:104021983-104022005 GGCCTCCCACTGTATGGAGCAGG + Intergenic
1030514228 7:110520120-110520142 GGCCGCATGCTCCATGGAGCTGG - Intergenic
1030721819 7:112880909-112880931 AGCTACACACTCCATGAAGCTGG + Intronic
1032607718 7:133374879-133374901 CGCTGCACACTCTGTGGTCCTGG + Exonic
1035239089 7:157518291-157518313 GGCTGCACAGTGCATGGCGCTGG - Intergenic
1035434698 7:158850467-158850489 GGCTGCACACTGCGTGGAGCTGG - Intergenic
1037477873 8:19275489-19275511 GGCTGCACTGGCTCTGGAGCAGG + Intergenic
1038793107 8:30686181-30686203 GGCTGTAAACTCTATGGTGTAGG - Intronic
1039210264 8:35205080-35205102 GGCTGAACACTCCCAGGAGCTGG - Intergenic
1041357430 8:57014854-57014876 GGCTGCACACTCCGTGGAGCTGG - Intergenic
1042031896 8:64485366-64485388 GGATGCACAATCTATGGATATGG - Intergenic
1042196944 8:66238761-66238783 GGCTGCACATTCCACAGAGCTGG - Intergenic
1042395919 8:68292362-68292384 GGCTGGACACTCCATGGAGCCGG + Intergenic
1043087294 8:75850056-75850078 GGCTGCACACTCTGTGGCACAGG - Intergenic
1043928808 8:86067960-86067982 GCCTTTACACTCTATGGGGCTGG + Intronic
1044259349 8:90098837-90098859 GGCTGCACGCACCATGGAGCCGG - Intergenic
1044525114 8:93242321-93242343 GGCTGCATGCTCCATGGAGCTGG - Intergenic
1044962200 8:97542478-97542500 GGCTGCACACTCCATGGAGCCGG + Intergenic
1045226797 8:100255460-100255482 GGCAAAACAATCTATGGAGCAGG + Intronic
1047104805 8:121720426-121720448 GGCCTCCCACTCCATGGAGCAGG - Intergenic
1047944771 8:129864594-129864616 GTCTGCACACTTTATTGGGCTGG - Intronic
1048421871 8:134284816-134284838 AGCTGCATGCTCCATGGAGCCGG - Intergenic
1048548079 8:135405301-135405323 GGCTGCACACTCCATGGAGCTGG - Intergenic
1049736003 8:144205629-144205651 GAATGCGCACTCTATGGACCTGG - Intronic
1049823849 8:144654605-144654627 GGCTGCACACTCCATGGAGCTGG + Intergenic
1049826979 8:144675114-144675136 GGCTGCATGGTCCATGGAGCTGG - Intergenic
1050130360 9:2406337-2406359 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1050182211 9:2933922-2933944 GGCTGCAAGCTCCACGGAGCTGG + Intergenic
1050947846 9:11549291-11549313 GGCTGCACGCTCCATGGAGCTGG + Intergenic
1052437017 9:28443354-28443376 GGCTGCACACTCTGTTGAGCTGG + Intronic
1052707376 9:32010340-32010362 GGCTGCACACTCCACAGAGCTGG + Intergenic
1053077909 9:35150730-35150752 GGCTACACACTCCATGGAGCCGG + Intergenic
1053614043 9:39745102-39745124 GGCGGCGCACTTTGTGGAGCCGG - Intergenic
1053617232 9:39781206-39781228 GCCTGCATACTCCATGAAGCTGG + Intergenic
1053649864 9:40156571-40156593 GGTAGCACATTCTCTGGAGCTGG - Intergenic
1053755883 9:41307371-41307393 GGTAGCACATTCTCTGGAGCTGG + Intergenic
1053875415 9:42540571-42540593 GTCTGCATACTCCATGAAGCTGG + Intergenic
1053897228 9:42754064-42754086 GCCTGCATACTCCATGAAGCTGG - Intergenic
1054236285 9:62561153-62561175 GTCTGCATACTCCATGAAGCTGG - Intergenic
1054239473 9:62597291-62597313 GGCGGCGCACTTTGTGGAGCCGG + Intergenic
1054266934 9:62926231-62926253 GCCTGCATACTCCATGAAGCTGG - Intergenic
1054330372 9:63748333-63748355 GGTAGCACATTCTCTGGAGCTGG - Intergenic
1054534717 9:66219632-66219654 GGTAGCACATTCTCTGGAGCTGG + Intergenic
1054550427 9:66595685-66595707 GCCTGCATACTCCATGAAGCTGG - Intergenic
1054553605 9:66631818-66631840 GGCGGCGCACTTTGTGGAGCCGG + Intergenic
1055572502 9:77631860-77631882 GGCTGCATGTTCCATGGAGCTGG + Intronic
1057468378 9:95337029-95337051 GGCTGCATGCTCCGTGGAGCTGG + Intergenic
1057548356 9:96034652-96034674 GGCTGCACACTCCATGAAGCTGG + Intergenic
1057548418 9:96034901-96034923 GGCCACCCACTCCATGGAGCAGG + Intergenic
1059104657 9:111501241-111501263 GGCTGCATCCTCTGTGGAGCTGG + Intergenic
1059401094 9:114071068-114071090 GGCTGCACACCCCATTGAGCTGG + Intronic
1061282717 9:129606784-129606806 GGCTGCAAAGTGTATGGACCAGG + Intergenic
1062209515 9:135356114-135356136 GGCTGGACACTCTATCGGGATGG + Intergenic
1062329004 9:136028591-136028613 GGCTGCACGCTCCATGGAGCTGG + Intronic
1062618702 9:137409709-137409731 CGCTGCACACTCTCTGTAACTGG + Intronic
1202797750 9_KI270719v1_random:141222-141244 GGTAGCACATTCTCTGGAGCTGG - Intergenic
1187319686 X:18228213-18228235 GGCTGCAGACTCTGTTGAACTGG - Intergenic
1188207632 X:27380266-27380288 GGCTGCACACTCCACAGAGTTGG + Intergenic
1188434752 X:30148028-30148050 GGCTCTGCACTCCATGGAGCTGG + Intergenic
1188727908 X:33607532-33607554 GGCTGCATGCTCCATGGAGCTGG - Intergenic
1189083453 X:37997218-37997240 GGCTGCACACTTTGTGGAGCTGG + Intronic
1189083481 X:37997341-37997363 GGCCTCCCACTCCATGGAGCAGG + Intronic
1189360022 X:40343327-40343349 AGCTGTACACTCCATGGAGCCGG + Intergenic
1189416136 X:40815428-40815450 GGCTCCACACTTAGTGGAGCTGG + Intergenic
1189856582 X:45229971-45229993 GGCCGCATGCTCCATGGAGCTGG - Intergenic
1190445033 X:50515303-50515325 GGCTGCACACTCCCTGGAGCTGG - Intergenic
1190620819 X:52285110-52285132 GGCTGCACACTGCATGAAACTGG - Intergenic
1190621038 X:52287517-52287539 GGCTGTGCACTCCCTGGAGCTGG + Intergenic
1191221095 X:57989436-57989458 GGCATCTCACTCCATGGAGCAGG + Intergenic
1192267085 X:69546504-69546526 GGCTGCATGCTCCATGAAGCTGG + Intergenic
1193108685 X:77705398-77705420 GGCTGCACGGTCTATAGAGTTGG - Intronic
1193468855 X:81875949-81875971 GGCTGCATGCTCCAGGGAGCTGG - Intergenic
1193580789 X:83260222-83260244 GACTGCACACTCGCTGCAGCAGG - Intergenic
1194380129 X:93181183-93181205 GGCTGCACACCCCATGAAGCTGG + Intergenic
1195454366 X:105051431-105051453 GGCTTCCCACTCCATGGACCAGG - Intronic
1195454430 X:105051689-105051711 AGCTGCACACTCCATGCAGCCGG - Intronic
1196883846 X:120224176-120224198 GGCTGCACATTCCATGGAGCTGG - Intergenic
1197342084 X:125287035-125287057 GACTGCACACTCCATGGAGCTGG + Intergenic
1197796152 X:130300107-130300129 GGCTGCCCACTCCATGGAGCAGG - Intergenic
1197951950 X:131907825-131907847 TGCTGCACACTCCGTGGAGCCGG + Intergenic
1199103627 X:143837149-143837171 GACTGTACACTCCATGGAGCAGG + Intergenic
1199360111 X:146907548-146907570 GGCCCCTCACTCCATGGAGCAGG - Intergenic
1199689778 X:150299881-150299903 GGCTGCAGACTCTCTGTTGCAGG + Intergenic
1199861220 X:151801674-151801696 GGCCTCCCACTCCATGGAGCAGG - Intergenic
1199861238 X:151801776-151801798 GGCTGCACACTGTGTGGAGCTGG - Intergenic
1201983210 Y:19930438-19930460 GGCTGCATGCTCTGTGGAGCTGG + Intergenic