ID: 1105424831

View in Genome Browser
Species Human (GRCh38)
Location 13:20285190-20285212
Sequence GTCCACTCAAGTCCAGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 365}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105424831_1105424844 30 Left 1105424831 13:20285190-20285212 CCTCCTCCTGGACTTGAGTGGAC 0: 1
1: 0
2: 2
3: 15
4: 365
Right 1105424844 13:20285243-20285265 CCTCTCTTAGCACAACCATGAGG 0: 2
1: 0
2: 9
3: 21
4: 107
1105424831_1105424835 3 Left 1105424831 13:20285190-20285212 CCTCCTCCTGGACTTGAGTGGAC 0: 1
1: 0
2: 2
3: 15
4: 365
Right 1105424835 13:20285216-20285238 TCAGTTCTCCTTTCCAACCTAGG 0: 1
1: 1
2: 8
3: 32
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105424831 Original CRISPR GTCCACTCAAGTCCAGGAGG AGG (reversed) Intergenic
900167917 1:1251438-1251460 AATCACTCGAGTCCAGGAGGTGG - Intergenic
900212655 1:1463823-1463845 GATCACTTGAGTCCAGGAGGCGG + Intronic
900218023 1:1492097-1492119 GGTCACTTGAGTCCAGGAGGCGG + Intronic
900225340 1:1530445-1530467 GATCACTTGAGTCCAGGAGGTGG + Intronic
900331136 1:2135166-2135188 GGCCACTCCCGTCCAGGTGGTGG - Intronic
900894341 1:5472944-5472966 GTCCACTCAAGTCCTGGAGTGGG + Intergenic
901545592 1:9954294-9954316 GGTCACTAAAGCCCAGGAGGTGG - Intronic
902367668 1:15987856-15987878 AATCACTCAAATCCAGGAGGCGG + Intergenic
902613876 1:17613188-17613210 GTCCCCTCAAGCCCTGGATGGGG + Intronic
903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG + Intronic
904155111 1:28476625-28476647 GATCACTTAAGTCCAGGAGTTGG - Intronic
904818853 1:33227274-33227296 GCCCACTCAATTCCAGGGGATGG - Intergenic
905701637 1:40020634-40020656 GACCACTTGAGCCCAGGAGGTGG + Intergenic
906331914 1:44892491-44892513 GATCACTTAAGCCCAGGAGGTGG + Intronic
906723901 1:48029551-48029573 GATCACTCAAGCCCAGGAGTTGG + Intergenic
907149645 1:52271924-52271946 AATCACTCAAGCCCAGGAGGCGG - Intronic
907686941 1:56621238-56621260 GATCCCTCAAGCCCAGGAGGTGG + Intronic
907894265 1:58669739-58669761 GATCACTTAAGCCCAGGAGGTGG + Intronic
908475698 1:64485665-64485687 GATCACTTGAGTCCAGGAGGTGG - Intronic
910932927 1:92460484-92460506 GATCACTCAAACCCAGGAGGTGG - Intergenic
911631165 1:100185251-100185273 GACCACTTGAGCCCAGGAGGTGG - Intergenic
911729445 1:101277877-101277899 GATCACTTAAGCCCAGGAGGTGG - Intergenic
912342523 1:108930963-108930985 GACCACTTGAGCCCAGGAGGTGG + Exonic
912929428 1:113943899-113943921 GACTGCTCAAGTCCAGGAGTTGG - Intronic
914081268 1:144413321-144413343 GACCACTTGAGCCCAGGAGGTGG - Intergenic
914387819 1:147188801-147188823 GACTACTCAGGTTCAGGAGGTGG + Intronic
917212597 1:172645528-172645550 GTTCAGTGAAGTCCAGGAGTAGG + Intergenic
917569210 1:176247006-176247028 GACCACTCAAGCCTGGGAGGTGG - Intergenic
919980055 1:202637444-202637466 GTCCACATAAGTCCAGAAGCTGG + Intronic
920143084 1:203834356-203834378 GATCACTTGAGTCCAGGAGGTGG - Intronic
920431441 1:205921607-205921629 CTCCACTCATGTCCAGGATGAGG + Exonic
921698822 1:218244282-218244304 GATCACTCGAGCCCAGGAGGCGG - Intergenic
922101938 1:222484181-222484203 ATGCACTGAACTCCAGGAGGAGG + Intergenic
922263018 1:223959303-223959325 ATGCACTGAACTCCAGGAGGAGG + Intergenic
922809177 1:228406522-228406544 GTCCACCAACCTCCAGGAGGAGG - Exonic
923476222 1:234333590-234333612 GATCACTGGAGTCCAGGAGGTGG + Intergenic
924344856 1:243064304-243064326 ATGCACTGAACTCCAGGAGGAGG + Intergenic
924610515 1:245569703-245569725 GATCACTTGAGTCCAGGAGGTGG + Intronic
924702488 1:246468072-246468094 GATCACTTAAGCCCAGGAGGTGG + Intronic
924774383 1:247105604-247105626 GTCAACTCGAAGCCAGGAGGGGG + Intergenic
1063300906 10:4848162-4848184 GATCACTTAAGCCCAGGAGGCGG - Intergenic
1064717929 10:18196401-18196423 GATCACTTGAGTCCAGGAGGTGG - Intronic
1065344918 10:24739332-24739354 GATCGCCCAAGTCCAGGAGGTGG + Intergenic
1065748946 10:28867896-28867918 GATCACTTAAGCCCAGGAGGTGG - Intronic
1065875551 10:29994513-29994535 GTTCACTTAAGGCCAGGAGTTGG - Intergenic
1066123970 10:32320806-32320828 GTTCACTTGAGTCCAGGAGTTGG - Intronic
1066141359 10:32506628-32506650 GATCACTCAAGGCCAGGAGCTGG + Intronic
1066357624 10:34700354-34700376 GCCCACTCTACTCCAGGATGTGG + Intronic
1066430499 10:35346711-35346733 GATCACTTAAGCCCAGGAGGCGG - Intronic
1066665825 10:37781596-37781618 GTACACTGAAGTCCCCGAGGAGG - Intronic
1066981810 10:42423563-42423585 GTTCACTTGAGCCCAGGAGGTGG - Intergenic
1067386742 10:45823690-45823712 GTTCACTTGAGCCCAGGAGGTGG - Intergenic
1067566072 10:47338692-47338714 GTGAACTTGAGTCCAGGAGGTGG + Intergenic
1067828954 10:49598901-49598923 GACCCCTTAAGCCCAGGAGGTGG - Intergenic
1067876511 10:50012385-50012407 GTTCACTTGAGCCCAGGAGGTGG + Intergenic
1069842704 10:71349678-71349700 GTGGACTCATGTCCTGGAGGAGG - Intronic
1070124206 10:73607208-73607230 GATCACTTGAGTCCAGGAGGTGG + Intronic
1071122696 10:82298055-82298077 GATCACTTGAGTCCAGGAGGTGG + Intronic
1071128369 10:82362609-82362631 GATCACTTAAGTCCAGGAGTTGG - Intronic
1073556260 10:104455245-104455267 GTGTTCTCAAGTCTAGGAGGAGG - Intergenic
1074692148 10:116016009-116016031 ATCTTCTCAGGTCCAGGAGGAGG - Intergenic
1077078351 11:711430-711452 GATCACTTGAGTCCAGGAGGCGG - Intronic
1077119104 11:898681-898703 GTCCAGTCCAGGCCAGGTGGGGG + Intronic
1077415752 11:2423538-2423560 CTCAGCTCAAGTGCAGGAGGCGG + Intergenic
1077506706 11:2932919-2932941 GACCACTCACGTGCTGGAGGCGG + Intergenic
1078192664 11:9104634-9104656 GTCCACCCCAGGCCAGGAGGGGG - Intronic
1079441592 11:20520296-20520318 GATCACTCGAGCCCAGGAGGTGG + Intergenic
1080062495 11:27971739-27971761 GCCCACTCTAGTCCAAGAGCTGG - Intergenic
1081834378 11:46142256-46142278 GATCACTCAAGCCCAGGAGATGG - Intergenic
1083633402 11:64107346-64107368 AACCATTCAAGGCCAGGAGGGGG - Intronic
1084023355 11:66431885-66431907 CTTCCCTCAAGTCCAGGCGGAGG + Intergenic
1087032975 11:93724678-93724700 GACCACTTGAGCCCAGGAGGTGG + Intronic
1094016110 12:25866277-25866299 GATCACTTAAGCCCAGGAGGTGG + Intergenic
1094641700 12:32282305-32282327 GATCACTTGAGTCCAGGAGGTGG - Intronic
1095743335 12:45630694-45630716 GATCACTTAAGCCCAGGAGGTGG + Intergenic
1096817006 12:54208089-54208111 CTTCACTTAGGTCCAGGAGGCGG - Intergenic
1097178217 12:57155862-57155884 GGCCGCTTAAGCCCAGGAGGTGG + Intronic
1097555580 12:61133499-61133521 GACAACTCAAAGCCAGGAGGGGG - Intergenic
1100519463 12:95359343-95359365 GATCACTTAAGCCCAGGAGGCGG + Intergenic
1100812787 12:98356337-98356359 GACAACTCAATTCCAGGATGTGG + Intergenic
1101110871 12:101484447-101484469 GATCACTTGAGTCCAGGAGGTGG + Intronic
1101123687 12:101609376-101609398 GATCACTTAAGCCCAGGAGGTGG - Intronic
1101499565 12:105289775-105289797 GACCACTTGAGTCCAGGAGTTGG + Intronic
1101774778 12:107783585-107783607 GATCACTTAAGCCCAGGAGGTGG - Intergenic
1101948605 12:109157042-109157064 GTCCCAGCAAGTCCAGGACGTGG + Intronic
1101981382 12:109410226-109410248 GATCACTCGAGCCCAGGAGGTGG - Intronic
1102243831 12:111342392-111342414 GGTCACTTAAGCCCAGGAGGCGG + Intronic
1103505526 12:121440398-121440420 GTCCAGCCCAGTCCAGGGGGAGG + Intronic
1104571051 12:129926400-129926422 GATCACTTGAGTCCAGGAGGTGG + Intergenic
1105424831 13:20285190-20285212 GTCCACTCAAGTCCAGGAGGAGG - Intergenic
1108927335 13:55769365-55769387 GGCCAATGAAGTCCAGGTGGAGG + Intergenic
1109098284 13:58145250-58145272 ATCCTCTGAAATCCAGGAGGAGG - Intergenic
1109219787 13:59629469-59629491 GCCCACTCAACTGCAGGATGAGG - Intergenic
1109868031 13:68291786-68291808 GATCACTTGAGTCCAGGAGGTGG + Intergenic
1111391629 13:87603970-87603992 GTTCGCTTAAGCCCAGGAGGCGG + Intergenic
1112146080 13:96701873-96701895 GATCACTCAAACCCAGGAGGTGG + Intronic
1113059441 13:106306448-106306470 GACCACCCAAGTCCAGAGGGAGG + Intergenic
1113367186 13:109687337-109687359 GACCACTTAAGCCCAAGAGGCGG + Intergenic
1113418124 13:110147097-110147119 GACCACTTGAGCCCAGGAGGTGG + Intergenic
1117763378 14:59056353-59056375 GATCACTTGAGTCCAGGAGGCGG + Intergenic
1118211490 14:63769810-63769832 GATCACTTAAGCCCAGGAGGTGG + Intergenic
1119337259 14:73844367-73844389 GATCACTTGAGTCCAGGAGGTGG - Intergenic
1121319036 14:92980401-92980423 GTCCACTCCAAGCCAGGTGGAGG + Intronic
1122691884 14:103535445-103535467 GTCCACTCATGTCCAAGAGGCGG + Exonic
1122981819 14:105195472-105195494 GTCCAAGGAAGTCCAGAAGGAGG + Intergenic
1124469918 15:29975105-29975127 GATCACTTAAGCCCAGGAGGTGG + Intergenic
1124495669 15:30185489-30185511 GTCCACATAAGTCCAGAAGCTGG + Intergenic
1124747904 15:32353157-32353179 GTCCACATAAGTCCAGAAGCTGG - Intergenic
1125459133 15:39891750-39891772 GACCACTTAAGCCCAGGAGTTGG + Intronic
1127594482 15:60465276-60465298 GATCACTTAAGCCCAGGAGGTGG - Intronic
1128079471 15:64847690-64847712 GTCTACCCAAGTCCAAGAGAAGG + Intronic
1128487041 15:68103012-68103034 GATCACTTGAGTCCAGGAGGCGG - Intronic
1128509541 15:68304887-68304909 GGGCACTCAGGCCCAGGAGGTGG - Intronic
1128961773 15:72013891-72013913 GACCACTTGAGCCCAGGAGGCGG - Intronic
1129556935 15:76520303-76520325 GGTCACTTAAGCCCAGGAGGTGG - Intronic
1129725558 15:77899838-77899860 GTCCACTCATGTCCATGACATGG + Intergenic
1130534325 15:84772461-84772483 GATCACTTGAGTCCAGGAGGTGG + Intronic
1131313302 15:91310299-91310321 AATCACTCAAATCCAGGAGGAGG - Intergenic
1132085722 15:98906915-98906937 GTCCACACAAGTGCTGGGGGTGG - Intronic
1132680524 16:1139225-1139247 GATCACTTGAGTCCAGGAGGTGG + Intergenic
1133045165 16:3083903-3083925 GTCCACTGAAATCTAGGCGGAGG + Intergenic
1133436737 16:5786310-5786332 GACCTCCCAAGTCCAGGATGGGG + Intergenic
1133503751 16:6390319-6390341 CTCCACTCAAGTTCAGGATTTGG - Intronic
1133818823 16:9218364-9218386 GATCACTCAAGTGCAGGAGTTGG + Intergenic
1134257912 16:12626670-12626692 GGCCACTGAAGTTCAGGAGGAGG - Intergenic
1134586098 16:15412341-15412363 GATCACTCAAGCCCAGGAGGTGG + Intronic
1135314302 16:21431237-21431259 GATCGCTCAAGCCCAGGAGGTGG + Intronic
1135367224 16:21863515-21863537 GATCGCTCAAGCCCAGGAGGTGG + Intronic
1135444589 16:22507645-22507667 GATCGCTCAAGCCCAGGAGGTGG - Intronic
1135985908 16:27184073-27184095 GATCACTTAAGCCCAGGAGGTGG + Intergenic
1136112800 16:28075456-28075478 GATCACTTGAGTCCAGGAGGTGG - Intergenic
1136310972 16:29409945-29409967 GATCGCTCAAGCCCAGGAGGTGG + Intergenic
1136324414 16:29511722-29511744 GATCGCTCAAGCCCAGGAGGTGG + Intergenic
1136439099 16:30251704-30251726 GATCGCTCAAGCCCAGGAGGTGG + Intronic
1136562343 16:31047456-31047478 GATCACTCAAGCCCAGGAAGCGG - Intergenic
1138201009 16:55088432-55088454 GTGGACTCAGGTCCTGGAGGAGG - Intergenic
1141767060 16:86065667-86065689 GATCACTCAAGGCCAGGAGTTGG - Intergenic
1143200832 17:5111996-5112018 CTCCGCTCAAGTCCAGGAACCGG - Exonic
1143635929 17:8163596-8163618 GCCCAAACAAGTCCAGGGGGCGG + Intergenic
1143794769 17:9327760-9327782 GATCACTCAGGCCCAGGAGGTGG - Intronic
1144581163 17:16460383-16460405 GACCAGGCAAGGCCAGGAGGAGG - Intronic
1144824301 17:18097307-18097329 GACCTCTCAAGTCCAGAATGTGG - Intronic
1145903453 17:28502944-28502966 GATCACTTGAGTCCAGGAGGTGG + Intronic
1145913748 17:28558217-28558239 GACCACTTGAGTCCAGGAGTTGG + Intronic
1146036713 17:29413507-29413529 GATCACTTGAGTCCAGGAGGCGG + Intronic
1146978263 17:37135083-37135105 GTCCTCTCAGGTCAGGGAGGAGG - Intronic
1147128411 17:38390006-38390028 GATCACTTAAGGCCAGGAGGCGG - Intronic
1147286688 17:39408102-39408124 ATCCACTGAACTCCCGGAGGTGG + Exonic
1147625050 17:41894778-41894800 GTCCCTGCAAGTCCAAGAGGAGG + Intronic
1147670591 17:42174706-42174728 GTCTTCTCAAGTCCAGGGTGGGG - Intronic
1147693697 17:42335207-42335229 GATCACTCATGTCCAGGAGTTGG - Intronic
1147739790 17:42664944-42664966 GACCACTCGAGGCCAGGAGTTGG - Intronic
1147762575 17:42808960-42808982 GATCACTTAAGCCCAGGAGGTGG + Intronic
1147876624 17:43626284-43626306 GTTCACTTGAGCCCAGGAGGTGG - Intergenic
1147883970 17:43672144-43672166 GGCCATCCAAGTCCTGGAGGAGG + Intergenic
1148068836 17:44894281-44894303 GATCACTTAAGCCCAGGAGGTGG + Intronic
1148429366 17:47629503-47629525 GATCACTTGAGTCCAGGAGGTGG + Intergenic
1148435589 17:47681917-47681939 GGCCACTTAAGCCCAGGAGCTGG - Intronic
1149956060 17:61051682-61051704 GATCACTCAAGTTCAGGAGTTGG - Intronic
1150107296 17:62471795-62471817 GCCCAGTCAAGAGCAGGAGGGGG + Intronic
1150262170 17:63802821-63802843 AGTCACTCAAATCCAGGAGGCGG + Intronic
1151405036 17:73880699-73880721 GATCACTTAAGCCCAGGAGGTGG - Intergenic
1151497973 17:74470733-74470755 GATCACTTGAGTCCAGGAGGTGG - Intronic
1151971807 17:77461217-77461239 AATCACTCAAATCCAGGAGGCGG + Intronic
1152090954 17:78247523-78247545 GATCATTTAAGTCCAGGAGGTGG - Intergenic
1152390390 17:80000809-80000831 CTCCACTCAAGACCCGCAGGGGG - Intronic
1152452759 17:80393062-80393084 GACCACTTGAGTCCAGGAGGTGG - Intronic
1152772815 17:82180560-82180582 GACCACTTGAGCCCAGGAGGTGG - Intronic
1157664859 18:49477345-49477367 GATCGCTTAAGTCCAGGAGGCGG - Intronic
1158562688 18:58528447-58528469 GATCACTTAAGCCCAGGAGGTGG + Intronic
1158583045 18:58702295-58702317 GATCACTCAAGCCCGGGAGGCGG + Intronic
1158712518 18:59849819-59849841 GATCACTCAAGCCCAGGAGTTGG + Intergenic
1158799048 18:60884315-60884337 GATCACTTAAGTCCAGGAGTTGG + Intergenic
1161617274 19:5278561-5278583 GTCCACTTGAACCCAGGAGGCGG - Intronic
1162131312 19:8527697-8527719 GATCACTCAAGCCCAGGAGGGGG - Intronic
1162268028 19:9592103-9592125 GTGCCCTCCAGTCCAGAAGGGGG + Intergenic
1162728827 19:12705672-12705694 GCCCACTCACCTCCAGCAGGGGG + Exonic
1163014513 19:14446091-14446113 GATCACTCAAGCCCAGGAGTTGG - Intronic
1163168085 19:15511370-15511392 GATCACTCAAGCCCAGGACGGGG + Intronic
1163274368 19:16273895-16273917 GATCACTCAAGCCCAGGAGTTGG - Intergenic
1163452726 19:17388284-17388306 GATCACTTAAGCCCAGGAGGTGG - Intergenic
1163540334 19:17905237-17905259 GACCACTTGAGCCCAGGAGGCGG + Intergenic
1164986576 19:32652839-32652861 GATCACTTGAGTCCAGGAGGTGG + Intronic
1165046887 19:33111842-33111864 GTTCACTCACGCCAAGGAGGAGG + Exonic
1165078572 19:33294564-33294586 GACCTCTTGAGTCCAGGAGGTGG + Intergenic
1165190652 19:34060165-34060187 GACCACTTGAGCCCAGGAGGTGG + Intergenic
1165281189 19:34799087-34799109 GATCACTTGAGTCCAGGAGGTGG - Intergenic
1165426070 19:35746107-35746129 CCCCACTCAAATCCAGGAGTCGG - Intronic
1165736556 19:38180381-38180403 GATCACTCAAGCCCAGGAGTTGG - Intronic
1166772111 19:45290011-45290033 GATCACTTGAGTCCAGGAGGCGG + Intronic
1166949002 19:46413838-46413860 TTCCAGCCAAGTCCGGGAGGTGG + Intergenic
1167057680 19:47122788-47122810 GATCACTTGAGTCCAGGAGGTGG + Intronic
1168075013 19:53976265-53976287 GACCACTTGAGCCCAGGAGGTGG + Intronic
1168253514 19:55154818-55154840 GTCGGCACAAGTCCTGGAGGAGG + Exonic
1168663003 19:58182663-58182685 GTCCACTCAAGGTCAGGGAGGGG - Intergenic
925104758 2:1281903-1281925 GTCTCCTCAAGCCCGGGAGGAGG + Intronic
926054054 2:9763474-9763496 CTGCACGCAAGCCCAGGAGGAGG - Intergenic
928253932 2:29705732-29705754 CTCCTCACAATTCCAGGAGGTGG - Intronic
928887650 2:36168661-36168683 GACCACTTGAGTCCAGGAGTTGG + Intergenic
929186490 2:39100830-39100852 GATCACTTAAGCCCAGGAGGGGG + Intronic
929513684 2:42586361-42586383 GACCACTTGAGTCCAGGAGTTGG + Intronic
929732349 2:44509394-44509416 GATCACTTGAGTCCAGGAGGTGG - Intronic
930054790 2:47243788-47243810 GTCCACGCAAGACCAGGTGCCGG + Intergenic
930225089 2:48784072-48784094 GATCACTCAAGTCTAGGAGCTGG - Intergenic
932151776 2:69379622-69379644 GATCACTTGAGTCCAGGAGGTGG - Intronic
932636527 2:73393905-73393927 GTCCACTTGAGCCCAGGAGGTGG - Intronic
936364924 2:111844930-111844952 GACCACTTGAGTCCAGGAGTTGG - Intronic
938107699 2:128544634-128544656 CTCCAGTCATCTCCAGGAGGTGG + Intergenic
938159452 2:128972669-128972691 GTCCACTCAAGGCCAGGGCCAGG - Intergenic
939490593 2:142871622-142871644 GATCACTCGAGCCCAGGAGGTGG + Intergenic
939768696 2:146287791-146287813 ATCCACTTAAGTGTAGGAGGAGG + Intergenic
941393355 2:164943941-164943963 GATCACTTAAGCCCAGGAGGTGG - Intronic
941410829 2:165155484-165155506 GATCACCCAAGCCCAGGAGGTGG - Intronic
946479981 2:220045719-220045741 GATCACTTAAGCCCAGGAGGTGG + Intergenic
946825676 2:223675174-223675196 GTCCAGTAATGTCCAGTAGGTGG + Intergenic
946898941 2:224354287-224354309 GATCACTTGAGTCCAGGAGGTGG + Intergenic
946917826 2:224543896-224543918 GATCACTTAAGCCCAGGAGGTGG + Intronic
947416162 2:229898776-229898798 GACCACTTGAGCCCAGGAGGTGG - Intronic
948986942 2:241531531-241531553 GATCACTCCAGTCCAGGAGCTGG - Intergenic
1168777480 20:460343-460365 GAGCACTTAAGTCCAGGAGTTGG + Intronic
1169097197 20:2912535-2912557 GATCACTTAAGTCCAGGAGGTGG + Intronic
1169207424 20:3748309-3748331 GGCCACTCAGGTCCAGGAGCTGG - Exonic
1169307294 20:4503192-4503214 GTCCACTCAGGTTCAAGAGAAGG + Intergenic
1169444296 20:5658535-5658557 GATCACTTAAGCCCAGGAGGTGG + Intergenic
1169644538 20:7795305-7795327 GACCACTTGAGACCAGGAGGTGG - Intergenic
1169730676 20:8782477-8782499 GACCACTAAAGCCCAGGAGATGG - Intronic
1170219787 20:13929875-13929897 GTTCACTTAAGGCCAGGAGGCGG - Intronic
1170475459 20:16709788-16709810 GATCACTTAAATCCAGGAGGCGG - Intergenic
1171200864 20:23241284-23241306 GATCTCTCAAGCCCAGGAGGTGG - Intergenic
1171308613 20:24127481-24127503 GGCCACCCAGGTCCAAGAGGAGG + Intergenic
1171471124 20:25372278-25372300 GATCACTTAAGGCCAGGAGGTGG - Intronic
1171488723 20:25501718-25501740 GATCACTTGAGTCCAGGAGGTGG - Intronic
1171755603 20:29105435-29105457 GGTCACTCAAGCCCAGGAGTTGG + Intergenic
1173141653 20:40490210-40490232 GTCCACTCAGGGACATGAGGAGG + Intergenic
1173217666 20:41101228-41101250 TTCCACTTATGTCCTGGAGGAGG - Exonic
1173386161 20:42589966-42589988 GTCCACGCAGGTCCCAGAGGAGG - Intronic
1174331771 20:49825553-49825575 AACCACTTGAGTCCAGGAGGCGG + Intronic
1175044753 20:56094251-56094273 GTCCTCTCAAATCTAGGTGGAGG + Intergenic
1176408107 21:6432634-6432656 GATCACTCGAGCCCAGGAGGTGG + Intergenic
1176721028 21:10392980-10393002 GATCACTTAAGCCCAGGAGGTGG - Intergenic
1178859281 21:36275530-36275552 GATCACTTGAGTCCAGGAGGCGG + Intronic
1179475354 21:41639728-41639750 GGGCACTCAAGACCAGGTGGGGG + Intergenic
1179683599 21:43040960-43040982 GATCACTCGAGCCCAGGAGGTGG + Intergenic
1179930698 21:44569072-44569094 CTCCACTCCAGGCCAGGAGAAGG + Intronic
1180302216 22:11045770-11045792 GATCACTTAAGCCCAGGAGGTGG - Intergenic
1182141394 22:27962452-27962474 GTGCTCTGAACTCCAGGAGGAGG - Intergenic
1184884707 22:47335690-47335712 GTGCATTTAAGTCCATGAGGAGG + Intergenic
1184949254 22:47828525-47828547 GATCACTCAAGCCCAGGAGCTGG - Intergenic
949503833 3:4707577-4707599 GTTCACTCCAGTTCAGGGGGAGG + Intronic
949823291 3:8138522-8138544 GACCACTTGAGCCCAGGAGGTGG + Intergenic
950468570 3:13170631-13170653 GGCCGCTCTAGTCCAGTAGGAGG + Intergenic
950646437 3:14379938-14379960 GATCACTCGAGCCCAGGAGGTGG - Intergenic
951780228 3:26354838-26354860 GCCCACTCACTTCCTGGAGGTGG + Intergenic
953058809 3:39409745-39409767 GATCCCTCAAGTCCAGGAGCTGG + Intronic
954321748 3:49836737-49836759 GACCACTTGAGCCCAGGAGGTGG + Intronic
955810862 3:62787206-62787228 GATCACTTGAGTCCAGGAGGCGG + Intronic
957279629 3:78134084-78134106 GATCACTGGAGTCCAGGAGGTGG - Intergenic
958816618 3:98923637-98923659 GATCACCCAGGTCCAGGAGGTGG + Intergenic
959924655 3:111907881-111907903 GATCACTTGAGTCCAGGAGGCGG - Intronic
960335477 3:116412154-116412176 GTCCATTGAAGTCCCTGAGGAGG - Intronic
961871801 3:129993749-129993771 GTCCACTCAGCTCTGGGAGGTGG - Intergenic
962230662 3:133662548-133662570 GTCCACTGAAGGGGAGGAGGAGG - Intergenic
962557726 3:136572503-136572525 GATCACTTAAGCCCAGGAGGTGG + Intronic
963173134 3:142271291-142271313 GATCACTTAAGCCCAGGAGGTGG + Intergenic
964170058 3:153759194-153759216 ATCCACTCAAGACAGGGAGGTGG + Intergenic
965573343 3:170192986-170193008 GCCCACTTGAGCCCAGGAGGTGG - Intergenic
965895875 3:173574969-173574991 GATCACTCAAGCCCAGGAGTTGG - Intronic
966050573 3:175613083-175613105 GTCATCTGAAGTCCTGGAGGAGG - Intronic
966999284 3:185316552-185316574 GTTCACTTAAGCCCGGGAGGTGG + Intronic
967908834 3:194524366-194524388 GATCACTCGAGTCCAGGAGTTGG + Intergenic
967975323 3:195031186-195031208 GCCCAGACAAGTCCAAGAGGAGG + Intergenic
968694241 4:2014121-2014143 GATCACTCAAGGCCAGGAGTTGG - Intronic
969458145 4:7312774-7312796 TTCCACTGCAGTTCAGGAGGAGG + Intronic
972194724 4:36639847-36639869 GTCAACTCAAGTCAAGGCAGAGG + Intergenic
976215485 4:82711617-82711639 GATCACTTAAGCCCAGGAGGTGG + Intronic
978805518 4:112796019-112796041 GACCACTTGAGTCCAGGAGTTGG - Intergenic
978809494 4:112834888-112834910 GACCAGTCAAATCCAGAAGGTGG - Intronic
980886721 4:138770366-138770388 GACCACTTGAGCCCAGGAGGCGG + Intergenic
981379709 4:144058684-144058706 GGCCACTTGAGTCCAGGAGTTGG - Intergenic
982101798 4:151975557-151975579 GTCCACTGAAGTCCAGGCTTAGG + Intergenic
982490927 4:156028732-156028754 GATCACTCAAGGCCAGGAGCTGG + Intergenic
987918788 5:24250906-24250928 GTCCACACATCTCCAGGATGAGG + Intergenic
988031627 5:25770754-25770776 GTACAGTGAAGTCCAGGATGAGG + Intergenic
988252391 5:28776689-28776711 GATGACTCAAGCCCAGGAGGCGG - Intergenic
990449139 5:55918932-55918954 CTGCACTCAAGTCCAGGTGTAGG + Intronic
990876498 5:60492349-60492371 GATCACTTAAGTCCAGGAGTTGG + Intronic
990948949 5:61277501-61277523 GTTCACTCATGTGCAGCAGGAGG - Intergenic
991372669 5:65935945-65935967 GATCACTCAAGCCCAGGAGCTGG - Intronic
991732930 5:69606370-69606392 GATCACTTGAGTCCAGGAGGTGG + Intergenic
991809366 5:70461514-70461536 GATCACTTGAGTCCAGGAGGTGG + Intergenic
991862023 5:71021482-71021504 GATCACTTGAGTCCAGGAGGTGG - Intronic
992555106 5:77895480-77895502 GACCACTTCAGCCCAGGAGGTGG + Intergenic
994701068 5:103136056-103136078 AATCACTCAAATCCAGGAGGTGG - Intronic
995237589 5:109847532-109847554 TTCCTCTCTAGTCAAGGAGGTGG - Intronic
995644614 5:114297229-114297251 GATCACTTAAGTCCAGGAGTTGG + Intergenic
999408655 5:151329964-151329986 GCCTACTCAAGTCCTGCAGGTGG - Intronic
1001558158 5:172650286-172650308 GTCCATTCAAGGGCAGGAGATGG + Intronic
1002373621 5:178773455-178773477 GATCACTTAAGCCCAGGAGGTGG + Intergenic
1004250814 6:14021841-14021863 GATCACTGAAGCCCAGGAGGTGG - Intergenic
1005043142 6:21617277-21617299 GATCACTTAAGCCCAGGAGGTGG + Intergenic
1005888049 6:30112264-30112286 GCCCACTCAAGCCCAAGGGGTGG + Intronic
1005979276 6:30823992-30824014 GATCACTCAAGCCCAGGAGACGG + Intergenic
1006236573 6:32638588-32638610 GACCACTTGAGTCCATGAGGCGG + Intronic
1006676976 6:35771513-35771535 GGCCAGCCCAGTCCAGGAGGAGG + Intergenic
1008497691 6:52149784-52149806 GATCACTTAAGTCCAGGAGATGG + Intergenic
1009547063 6:65033655-65033677 ATCCTCTGAAATCCAGGAGGAGG - Intronic
1009923794 6:70096166-70096188 GATCACTCCAGCCCAGGAGGTGG - Intronic
1012409760 6:98943484-98943506 GATCACTTAAGTCCAGGAGATGG + Intronic
1013235208 6:108192425-108192447 GATCACTTAAGTCCAGGAGGCGG - Intergenic
1014250889 6:119114626-119114648 GATCACTTAAGCCCAGGAGGTGG - Intronic
1014494554 6:122105187-122105209 GTCCCTTCAAGCCCAGGAGTGGG - Intergenic
1015128074 6:129776596-129776618 GATCACTCAAGCCCAGGAGTTGG - Intergenic
1015540155 6:134305731-134305753 GATCACTTGAGTCCAGGAGGTGG - Intronic
1016118270 6:140315286-140315308 GTCCACTCAGATTCAAGAGGAGG - Intergenic
1016460418 6:144275476-144275498 GATCACTCAAACCCAGGAGGTGG + Intergenic
1017159482 6:151351445-151351467 GGCCACTCCGGTGCAGGAGGTGG + Exonic
1017208324 6:151827270-151827292 GATCACTTGAGTCCAGGAGGTGG + Intronic
1017309239 6:152957107-152957129 GTTCACTGAAATCCAGGTGGAGG - Intergenic
1018694311 6:166379405-166379427 GCTCACTCAAGCCCAGGAGTGGG + Intronic
1018725309 6:166607921-166607943 GATCACTTAAGCCCAGGAGGTGG + Intronic
1018941661 6:168312416-168312438 GATCACTTAAGTCCAGGAGTTGG - Intronic
1019178788 6:170174862-170174884 GCCCACCAAAGCCCAGGAGGAGG - Intergenic
1019885009 7:3896352-3896374 GCCCACACAAGGCCAGGAAGAGG - Intronic
1020791179 7:12630198-12630220 GCCCAGTCAAGTTCAGGAGATGG + Intronic
1021694432 7:23262703-23262725 GATCACTTGAGTCCAGGAGGTGG - Intronic
1023364902 7:39453960-39453982 GGCAACTCAAGTCCAGCAAGGGG - Intronic
1023535175 7:41201018-41201040 GCCCACTTCAATCCAGGAGGAGG - Intergenic
1023952180 7:44855323-44855345 GATCACTTAAGTCCAGGAGTTGG - Intergenic
1025004423 7:55343522-55343544 TTCCAAGCAAGGCCAGGAGGCGG + Intergenic
1025167507 7:56725637-56725659 GATCACTTAAGCCCAGGAGGTGG + Intergenic
1025921140 7:65914321-65914343 GACCACTTGAGTCCAGGAGTTGG - Intronic
1026225435 7:68436193-68436215 GATCATTCAAGTCCAGGAGTTGG - Intergenic
1026348228 7:69493548-69493570 GATCACTTGAGTCCAGGAGGTGG - Intergenic
1029476370 7:100787327-100787349 GATCACTCGAGACCAGGAGGTGG + Intronic
1029626552 7:101723498-101723520 CTGCACTCCAGTCCAGGAGATGG + Intergenic
1029731266 7:102439675-102439697 GATCACTTGAGTCCAGGAGGTGG + Intronic
1030027594 7:105339969-105339991 GATCACTTGAGTCCAGGAGGCGG + Intronic
1032890699 7:136192023-136192045 GACCACTTGAGCCCAGGAGGTGG - Intergenic
1034214279 7:149392731-149392753 GTTCACTTGAGCCCAGGAGGTGG + Intergenic
1034777504 7:153843519-153843541 GGCATCTCAGGTCCAGGAGGTGG - Intergenic
1034944017 7:155250384-155250406 GATCACTTAAGCCCAGGAGGTGG + Intergenic
1036461826 8:8960191-8960213 GTCCTCTGAAATCTAGGAGGAGG + Intergenic
1036610008 8:10341489-10341511 GTCATCTCCAGTCCTGGAGGTGG - Intronic
1038172593 8:25150983-25151005 GATCACTCAAGCCCAGGGGGTGG + Intergenic
1039335293 8:36582409-36582431 GTCCACATATGTCCATGAGGTGG + Intergenic
1039630706 8:39108196-39108218 GACCACGTGAGTCCAGGAGGTGG + Intronic
1041055519 8:53981984-53982006 GATCACTTGAGTCCAGGAGGTGG - Intronic
1041188361 8:55326555-55326577 GATCACTTGAGTCCAGGAGGTGG - Intronic
1041246569 8:55894284-55894306 GATCACTTAAGCCCAGGAGGTGG - Intronic
1041327433 8:56683242-56683264 GTTCACTCAAGCCCAGGATGGGG - Intergenic
1041915231 8:63132234-63132256 ATTCACTTAAGTCCAGGAGAGGG - Intergenic
1042834734 8:73069369-73069391 GATCACTTGAGTCCAGGAGGCGG - Intronic
1044008340 8:86963734-86963756 GCCTGCTCAAGTCCAGGAGGAGG + Intronic
1044540469 8:93403541-93403563 GACCACTTAAACCCAGGAGGTGG - Intergenic
1045597565 8:103673438-103673460 ATCCTCTCAAATCTAGGAGGAGG + Intronic
1046545094 8:115639605-115639627 GACCACTTGAGTCCAGGAGTTGG + Intronic
1046642096 8:116743362-116743384 GATCACTCAAGCCCAGGAGTGGG + Intronic
1046998378 8:120548932-120548954 GTCCATTCAGGTCCAGGAAAGGG - Exonic
1048409526 8:134157451-134157473 GATCACTTGAGTCCAGGAGGTGG + Intergenic
1049235462 8:141510297-141510319 GACCACCCAGGGCCAGGAGGTGG - Intergenic
1049389233 8:142359556-142359578 TGCCACACAAGTCCATGAGGAGG + Intronic
1049980635 9:901099-901121 GATCGCTTAAGTCCAGGAGGTGG - Intronic
1050555916 9:6789585-6789607 GATCACTCGAGTCCAGGAGTTGG - Intronic
1053023361 9:34710552-34710574 GATCACTCGAGCCCAGGAGGCGG - Intergenic
1053441596 9:38120805-38120827 GGTCACTCAAGCCCAGGAGTTGG + Intergenic
1055926173 9:81512010-81512032 GACCACTTGAGCCCAGGAGGCGG + Intergenic
1057859865 9:98632462-98632484 GTCTGCTCAGGTCCAGGAGGAGG - Intronic
1057867691 9:98694133-98694155 GTCCACTGCAGCCCAGGAGTGGG - Intronic
1060876172 9:127085163-127085185 GTTCACACAAGCCCAGCAGGTGG + Intronic
1062350172 9:136134690-136134712 GCTCACTGAAGCCCAGGAGGTGG + Intergenic
1187416254 X:19095790-19095812 GATCACTCGAGTCCAGGAGTTGG + Intronic
1188252004 X:27908461-27908483 GATCACTTGAGTCCAGGAGGTGG - Intergenic
1189829143 X:44952861-44952883 GATCACTTAAGCCCAGGAGGTGG - Intronic
1190409584 X:50122886-50122908 GATCGCTCAAGCCCAGGAGGTGG - Intergenic
1190716093 X:53104969-53104991 GACCACTTGAGCCCAGGAGGTGG - Intergenic
1192325884 X:70131610-70131632 GATCACTTGAGTCCAGGAGGCGG + Intergenic
1192405590 X:70882691-70882713 GATCACTCCAGCCCAGGAGGTGG + Intronic
1192783258 X:74315038-74315060 GACCACTTAAGCCCAGGAGTTGG + Intergenic
1193936691 X:87631596-87631618 GACCACTTCAGCCCAGGAGGCGG - Intronic
1194379743 X:93177710-93177732 GCCCACTTGAGTCCAGGAGGAGG - Intergenic
1196672896 X:118388365-118388387 GATCACTTGAGTCCAGGAGGTGG - Intronic
1199818846 X:151424507-151424529 GACCACTTGAGCCCAGGAGGCGG + Intergenic
1200168619 X:154054912-154054934 GACCACTTGAGCCCAGGAGGCGG + Intronic