ID: 1105432009

View in Genome Browser
Species Human (GRCh38)
Location 13:20345196-20345218
Sequence CAGTGTGACCCCTGGGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 206}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105432001_1105432009 12 Left 1105432001 13:20345161-20345183 CCAGCTGTCCTAAGAGGTGGTCT 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1105432009 13:20345196-20345218 CAGTGTGACCCCTGGGATGAGGG 0: 1
1: 0
2: 2
3: 20
4: 206
1105431998_1105432009 30 Left 1105431998 13:20345143-20345165 CCGGGACAGGGATGAGGGCCAGC 0: 1
1: 0
2: 0
3: 34
4: 375
Right 1105432009 13:20345196-20345218 CAGTGTGACCCCTGGGATGAGGG 0: 1
1: 0
2: 2
3: 20
4: 206
1105432004_1105432009 4 Left 1105432004 13:20345169-20345191 CCTAAGAGGTGGTCTAGGTGGCC 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1105432009 13:20345196-20345218 CAGTGTGACCCCTGGGATGAGGG 0: 1
1: 0
2: 2
3: 20
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105432009 Original CRISPR CAGTGTGACCCCTGGGATGA GGG Intergenic
900500910 1:3004116-3004138 CAGCGTGGCCCCTGGGATGCTGG - Intergenic
900549436 1:3246750-3246772 CAGTCTGAGCCCTGGGGTTAGGG - Intronic
900616518 1:3567955-3567977 CTGTGAGACCCTTGGGAAGAAGG - Intronic
901436731 1:9251141-9251163 CAGGGTCATCTCTGGGATGAAGG - Intronic
901510238 1:9714790-9714812 GAGTGTGTGCCCTGGGGTGACGG - Intronic
902820362 1:18939482-18939504 CAGAGTGATCCCTGGGATTCAGG + Intronic
902912232 1:19608275-19608297 CCGTGTGACTGGTGGGATGAAGG + Intronic
903319746 1:22535568-22535590 CTGTGTGCCCCCTGGGCTGGAGG - Intergenic
903979640 1:27176573-27176595 TAGTGAGACCCCTGGGAGTAGGG + Intergenic
905132901 1:35774829-35774851 CAGTGTTTCCCCAGGGACGAAGG - Intergenic
905201512 1:36319958-36319980 CAGGGTCTCCTCTGGGATGATGG - Exonic
905365642 1:37449807-37449829 CAGTTTGTCCCCAGGGAGGAAGG - Intergenic
906057225 1:42926734-42926756 CAGGGTGAAGCCTGGGATGTGGG + Exonic
911093846 1:94039761-94039783 CAGGGGGACCCCAGGAATGATGG + Intronic
916046113 1:161000917-161000939 CAGGGTGTGCCCTGGGATAAGGG + Intronic
916533460 1:165680486-165680508 AAGTGTGCCCACTGGCATGAAGG - Exonic
916661280 1:166924288-166924310 CTGTGTGATCCCTGGGATACTGG - Intronic
917782339 1:178411720-178411742 CCGTGTGACTGGTGGGATGAAGG + Intronic
918180829 1:182085098-182085120 CAGCGTTGCCCCTTGGATGAGGG + Intergenic
919740260 1:200977045-200977067 CAGTGAGACTGCTGGGATGCAGG - Intronic
922222144 1:223616745-223616767 CTGTGAGGCCCCTGGGGTGATGG - Intronic
922749065 1:228062356-228062378 CAGTGTGCCCCATGGTAGGAAGG + Intergenic
922820227 1:228479487-228479509 CAGTGTGAGCCCTGGGAGCCTGG - Intergenic
923945371 1:238880759-238880781 CAGAGCTACCCCTGGGAAGAAGG + Intergenic
924886054 1:248218084-248218106 GAATTTGACCCATGGGATGAGGG - Intergenic
1062939033 10:1408013-1408035 CAGTGTGAGCCCTTGGAAGGTGG - Intronic
1064330972 10:14393640-14393662 CAGTGAGAACCCTTGGTTGAAGG + Intronic
1065454306 10:25891197-25891219 CAGTATGACACCTGGGACAAGGG - Intergenic
1066656199 10:37701528-37701550 CATGGGGACCCCTGGGACGAGGG + Intergenic
1069704085 10:70446646-70446668 CAGTGTCACCCCTGGCATACAGG - Intronic
1071563821 10:86661565-86661587 CACCGTGACCCCTGGGAAGCTGG - Intronic
1072610989 10:97017627-97017649 CAGTGTGACTCATGAGATGGGGG + Intronic
1072693430 10:97586382-97586404 GACTGTGACCCCTGGCCTGATGG + Intronic
1075209305 10:120477691-120477713 CAGTGAGCCCCTTGGGAGGAGGG + Intronic
1075728060 10:124620685-124620707 CAGTGTGGCAGCTTGGATGATGG + Exonic
1075744968 10:124720707-124720729 CTTTGTGACTGCTGGGATGATGG + Intronic
1075788786 10:125068677-125068699 CAGTGTGGTCCCTTGGGTGAGGG + Intronic
1075921767 10:126219237-126219259 ACGTGTGACCTCTGAGATGAGGG + Intronic
1077817370 11:5698687-5698709 CTCTGTGACCCCTGAAATGATGG - Intronic
1080770950 11:35340875-35340897 CAGTGTGCCCCCTGGGATTATGG + Intronic
1083312184 11:61789667-61789689 CAGCATGACCCCTTGGTTGATGG - Intronic
1083622675 11:64056770-64056792 TAGTGCGAACCCTGGGCTGAAGG + Intronic
1083953342 11:65968939-65968961 AAGTGTGGCCTCTGGAATGATGG - Intronic
1084951222 11:72666652-72666674 CAATGTGAGCACAGGGATGAGGG - Intronic
1089557400 11:119321809-119321831 CAGGGCTACCCCTGGGATGCTGG - Intergenic
1093644658 12:21571205-21571227 AAGTGTGCCCCATGGGAGGAGGG - Intronic
1101506530 12:105351942-105351964 CAGTGTGACACATGGGATGAGGG + Intronic
1104687169 12:130793997-130794019 CAGTGTGACCCCTGGGGAGTGGG - Intronic
1105432009 13:20345196-20345218 CAGTGTGACCCCTGGGATGAGGG + Intergenic
1113899282 13:113787791-113787813 GAGGGTGACCCCTGGATTGATGG + Intronic
1114526968 14:23372475-23372497 CAGAGGGACACCTGGGAAGAGGG + Intergenic
1116098419 14:40403103-40403125 CAGTGTCAGCACTGGGTTGAAGG - Intergenic
1116863001 14:50009254-50009276 CAGTGTGACCCTAAGGATGCCGG + Intergenic
1118632495 14:67718514-67718536 CAGTGTTAGCCCTGGGAGGATGG + Intronic
1119494915 14:75069974-75069996 CACGGGGACTCCTGGGATGAGGG + Intronic
1120795949 14:88632921-88632943 CTGTGTAATCCCTGGCATGAGGG + Intronic
1122693583 14:103542560-103542582 CAGTGTGACCCTGGTGATGGGGG - Intergenic
1122961602 14:105096418-105096440 GGGTGTGGCCCCTGGGATGGGGG - Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1125458321 15:39884133-39884155 TAGTGTGACCCCTTGTTTGAAGG - Intronic
1126146108 15:45474398-45474420 CAGTGCTACCACTGGGCTGACGG + Intergenic
1129035136 15:72644515-72644537 CAGACTGACCCCTGGGCTGTAGG - Intergenic
1129214746 15:74092701-74092723 CAGACTGACCCCTGGGCTGTAGG + Intergenic
1129731880 15:77937052-77937074 CAGACTGACCCCTGGGCTGCAGG + Intergenic
1129831434 15:78673638-78673660 CGGTGTGACTTCTGGGAAGAAGG - Intronic
1131249051 15:90819041-90819063 CAGGGTCACCACTGGGAAGAAGG + Intergenic
1132722568 16:1323964-1323986 CAGTGTGACCCTGAGGATGGGGG - Intronic
1132767141 16:1540091-1540113 CAGTGTGCCTCCAGGGATGCTGG + Intronic
1133098668 16:3465661-3465683 CTGTGTGACCCCTGCGGTGGGGG + Intronic
1135170197 16:20177165-20177187 CGATGTGACCCCTGAGGTGATGG + Intergenic
1135382883 16:22008593-22008615 CAGCGGGACCCCCGGGCTGAGGG + Intronic
1135926481 16:26698209-26698231 CAGTGGGACTCCTTGAATGATGG + Intergenic
1136286606 16:29247866-29247888 CAGTGTGACCCATGACAGGAAGG + Intergenic
1137595629 16:49721637-49721659 CAGTGTGGCGCCTGGCACGATGG - Intronic
1138794173 16:59947523-59947545 CAGTGTGGCCACTGGAATCAGGG + Intergenic
1139268679 16:65662559-65662581 CACTGTGACGCCTGAGAGGAAGG + Intergenic
1139513579 16:67440764-67440786 GAGAGTGACCTCTGGGATCACGG + Intronic
1141163913 16:81647816-81647838 CAGGGTGGCCACAGGGATGAGGG - Intronic
1143012528 17:3873739-3873761 CCGTGTGACCCTCTGGATGAAGG - Intronic
1143263535 17:5618523-5618545 CATGGTTACCCCGGGGATGATGG - Intronic
1146262720 17:31432215-31432237 CAGTGAGTCTCCTGGGATGTGGG + Intronic
1147233216 17:39034858-39034880 GAGTGTTACCTCAGGGATGAGGG - Intergenic
1147458213 17:40551872-40551894 TGGGGTGACCCCTGGGAAGAAGG - Intergenic
1147684770 17:42280507-42280529 CAGCCTGACTCCTGGGATGCAGG - Intergenic
1149264032 17:54908197-54908219 TACTGTGACCCCAAGGATGAAGG - Intronic
1149492881 17:57097742-57097764 CAGTGTGAACACTGGAATAATGG + Intronic
1150347247 17:64413713-64413735 CTGAGTGGCCCCTGGGATGCAGG - Intronic
1150655864 17:67039038-67039060 TAGTTTGACCTCTGGGATGGGGG - Intergenic
1151606067 17:75136869-75136891 CAGTGGGACCTCTGGGAATAGGG - Intronic
1152251582 17:79215309-79215331 CAGTGTGACTCTTTGGTTGACGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155672412 18:28388017-28388039 AAGTGGGACCACTGGGCTGAAGG - Intergenic
1157442298 18:47720159-47720181 CAGTGTCACCCCTATCATGAAGG + Intergenic
1162057373 19:8072658-8072680 CACTGTGCCCCCAGGGATGTGGG + Intronic
1163775049 19:19212739-19212761 CAGTGTGTTCCCTGGGATAAGGG - Intronic
1164616218 19:29668238-29668260 CAGTGTGGCCCCAGGGCTGCTGG - Intronic
1164739980 19:30568759-30568781 CAGTGGGACCCCGGTGATGGGGG + Intronic
1166813486 19:45527913-45527935 CAGGGGGACCTCTGGGCTGAGGG + Exonic
1166835447 19:45664890-45664912 CAGTGTGACCGTGGGGGTGAGGG + Intergenic
1167072815 19:47230631-47230653 CAGTGCGGCCCCGGGGAAGAGGG - Intronic
1167854770 19:52228680-52228702 CAGTGTGACTGCTGGGATTTAGG - Exonic
1167870985 19:52370037-52370059 CTGTGTGACCCCTGAGATGCCGG - Intronic
1168129135 19:54306250-54306272 CAGGGTCATCCCTGGGTTGAGGG - Intergenic
925733170 2:6937359-6937381 CAGTGTGGCTCCTGGGCTGTTGG - Intronic
926224558 2:10957759-10957781 CAGTGGGACTCCTGGCAGGAGGG + Intergenic
926635590 2:15175316-15175338 CAGGACAACCCCTGGGATGAGGG + Intronic
928084345 2:28336511-28336533 CTGTGTGACCCCAAGGATGATGG + Intronic
929668567 2:43852275-43852297 CATTGTGACCCCAAGGATAAAGG - Intronic
931091694 2:58893365-58893387 GACTGTGAGCCCTGGGATGGAGG - Intergenic
931814667 2:65889177-65889199 TAATGTGACCCTCGGGATGAGGG - Intergenic
932656741 2:73617074-73617096 AAGTGTGACCCCAGTGATAATGG + Intergenic
933994063 2:87655059-87655081 CTGTGTGACTGGTGGGATGAAGG + Intergenic
934951410 2:98578258-98578280 CAGTGTGACCCTGGTGCTGAGGG + Intronic
935351023 2:102151952-102151974 CTGCCTGACCCCTGGGATGAGGG - Intronic
935943920 2:108269273-108269295 CAATGTGCCCCCTGGGTGGAAGG - Intergenic
936299801 2:111295851-111295873 CTGTGTGACTGGTGGGATGAAGG - Intergenic
936414634 2:112293863-112293885 CAGTGTTACCCTGCGGATGAGGG - Intronic
937028655 2:118720164-118720186 GAGAATGAGCCCTGGGATGACGG + Intergenic
937469396 2:122162383-122162405 CAGGGTGAGCCTCGGGATGAAGG + Intergenic
938610384 2:132941452-132941474 GAGAGTGAGCCCTGGGATGTTGG + Intronic
940230459 2:151445964-151445986 CAGTTAGACCTCTGGGATGTGGG + Intronic
942074888 2:172348506-172348528 CTGTGTGTCCCCTGGCATGGAGG + Intergenic
945985793 2:216352470-216352492 AAATGTCACCCCTGGGAGGAAGG - Intronic
946783964 2:223222599-223222621 AAGTGTTACCCTTGGGATAAGGG - Intergenic
1170520569 20:17180401-17180423 AAGTGGGACCCCTGGGCTTAAGG - Intergenic
1170555519 20:17511978-17512000 CATTGTGACGAGTGGGATGAGGG - Exonic
1170611235 20:17915250-17915272 CAGTGGGACTCTTGGGAGGAAGG + Intergenic
1171217802 20:23364896-23364918 CCGTGAGACCACTGGGGTGAGGG - Exonic
1171542911 20:25978216-25978238 CCCTGTGAGGCCTGGGATGAAGG + Intergenic
1171896225 20:30812781-30812803 CAGTGTGACTCCTGTGTGGATGG - Intergenic
1174263052 20:49311375-49311397 CAGTGTGACTCCAGTGATGATGG + Intergenic
1175233610 20:57492760-57492782 CAGTGGGATGCCTGGGGTGATGG + Intergenic
1175914235 20:62418379-62418401 CAGTGTGGTCCCTGTGAGGAGGG + Intronic
1178473716 21:32918099-32918121 GATTGTGAACCCTGGGCTGATGG - Intergenic
1179197201 21:39175690-39175712 CAGTGAGACCCCAGGGATTCAGG + Intronic
1179490475 21:41737974-41737996 AAGAGTGACCCCTGGGATGCTGG + Intergenic
1179543602 21:42100216-42100238 CAGTGGGAGCCCTGGGCTGTGGG + Intronic
1183030920 22:35103944-35103966 CTGTGTGACCCCTGGGAATAGGG + Intergenic
1183080880 22:35455588-35455610 CAGTCTGAGCCCTGGGATGCTGG + Intergenic
1183417144 22:37689001-37689023 CAGTCTCAGCCCTGGGAGGAAGG + Intronic
1184296772 22:43530029-43530051 CATTGGGCCCCATGGGATGAAGG + Intronic
1184781989 22:46654237-46654259 GCGTGTGACCCCTCGGAGGAAGG + Intronic
950921799 3:16702478-16702500 GAGAGTGACACCTGGGATGGAGG + Intergenic
952493428 3:33894299-33894321 CAGTTTCACCCCAGGGATGCAGG - Intergenic
953880335 3:46688034-46688056 CAGAGTGACACCTGGCATTAAGG - Intronic
954661832 3:52230559-52230581 CAGTGTGACCCCAGGGGTATGGG + Intronic
954671093 3:52291771-52291793 CAGTGTGACAGGTGGGATGGGGG - Exonic
959565151 3:107826079-107826101 CAGTTTGAGGCCTGGGATCACGG + Intergenic
961732173 3:128973737-128973759 CAGTGGGACCCCTGGGACACAGG - Intronic
964640115 3:158900205-158900227 CAGTTAGACCCTGGGGATGATGG + Intergenic
964952135 3:162308458-162308480 CAGTGTGAGGCCTGGGTTTATGG + Intergenic
969577688 4:8046184-8046206 CGCTGTGTCCCCTGGGCTGATGG + Intronic
971485249 4:27153353-27153375 CATTGTTCCCCCAGGGATGAAGG + Intergenic
972141408 4:35964471-35964493 GAATGTGACCCCTTGGCTGAGGG - Intronic
975358938 4:73443550-73443572 CTTTGTGACCCCTTTGATGAGGG + Intronic
976637677 4:87303418-87303440 CAGTGTGACCTCTGGGAAATGGG + Intergenic
979020039 4:115485657-115485679 CAGTGTGACATCTGGGCTGTTGG + Intergenic
981125251 4:141098434-141098456 CAGTGTGACCACTGGTGTGGTGG + Intronic
983219393 4:165030383-165030405 GAGTCTGACCAATGGGATGAAGG - Intergenic
983509085 4:168588193-168588215 CACTGTGAGCCCTGGGAGGATGG + Intronic
985514672 5:335413-335435 CAGGGTGTCCCCTGGGAGAAGGG + Intronic
985574202 5:665967-665989 CACCGTCACCCCTGAGATGATGG + Exonic
985936436 5:3101328-3101350 CAGTGGCCCACCTGGGATGAAGG + Intergenic
986313729 5:6572597-6572619 CTGTGTGAGCCCCGGGATGAAGG + Intergenic
990691381 5:58368025-58368047 CAGTGTGAATAATGGGATGATGG + Intergenic
995852693 5:116562720-116562742 CCGTGTGACTGGTGGGATGAAGG + Intronic
999294049 5:150446929-150446951 CCGTGTGACTGGTGGGATGAAGG - Exonic
999754069 5:154651681-154651703 GCGTGTGACCCCTGGGTTGTGGG + Intergenic
1000444405 5:161302162-161302184 CAGACTGACCCATGTGATGATGG + Intronic
1001678297 5:173536632-173536654 CACTGAGACCCCCGGGATGAGGG - Intergenic
1002600232 5:180350213-180350235 CTGGGTGACCCCTTGGGTGATGG - Intronic
1002824146 6:757503-757525 CTATGTGACCCTTGGGATAAAGG + Intergenic
1002913512 6:1509859-1509881 CAGGGTGAACCCTAGGATGCTGG - Intergenic
1005354831 6:24972388-24972410 TAGTGTGAGTCCTGAGATGAGGG - Intronic
1006247711 6:32754805-32754827 CACTGTGACCCCTTTGATGTGGG - Intergenic
1007654691 6:43445121-43445143 CAGTGGGAACACTGGGATGCTGG - Exonic
1008628220 6:53338304-53338326 CAGTGTGACCCAAGGGAAGTTGG - Intronic
1010465178 6:76159460-76159482 CAGTGTGACATCTGAAATGATGG + Intergenic
1014171116 6:118280285-118280307 CAGTATGACCCGTGGGGTAAAGG - Intronic
1015218769 6:130780624-130780646 CAGTGTGACCTATAGGAAGATGG + Intergenic
1018118079 6:160607445-160607467 CAGTGGGACCCATGGCATAAAGG + Intronic
1018118699 6:160613894-160613916 CAGTGGGACCCATGGCATAAAGG + Intronic
1018119300 6:160619446-160619468 CAGTGGGACCCATGGCATAAAGG + Intronic
1018119903 6:160624992-160625014 CAGTGGGACCCATGGCATAAAGG + Intronic
1018121100 6:160636085-160636107 CAGTGGGACCCATGGCATAAAGG + Intronic
1018121702 6:160641628-160641650 CAGTGGGACCCATGGCATAAAGG + Intronic
1019219418 6:170462617-170462639 CAGAGTGACTGCTGGGTTGAGGG - Intergenic
1019255236 7:45633-45655 GAGTGTGAGCCCTGCGAGGAAGG - Intergenic
1019284926 7:218670-218692 CTGAGTGAGCCCTGGGATGGAGG - Intronic
1019354857 7:573134-573156 CAGTGTGACCCCGGGGTGCAGGG - Intronic
1019431245 7:1000830-1000852 CCGTGTGACCCATGGGGTGGGGG - Intronic
1020073707 7:5243784-5243806 CAGTCTGACCCCTGGAGTCAGGG - Intergenic
1022480306 7:30739242-30739264 CAGTGTGAAGCCTGGGCTGGGGG + Intronic
1023148895 7:37181140-37181162 AACTGTGACCCCTGGAATTATGG - Intronic
1024034029 7:45491798-45491820 CAGCTTCATCCCTGGGATGAAGG - Intergenic
1024608293 7:51040733-51040755 CAGTGGCACCCCAGAGATGAGGG + Intronic
1025607161 7:63047668-63047690 GAGAGTGACCCCTGGGATCCCGG - Intergenic
1026116184 7:67497637-67497659 CTGTGAGACCCCTAGGATGTGGG + Intergenic
1026773613 7:73217542-73217564 CAGGGTGACCTCTGGAATGATGG - Intergenic
1027014472 7:74770936-74770958 CAGGGTGACCTCTGGAATGATGG - Intergenic
1027073561 7:75175021-75175043 CAGGGTGACCTCTGGAATGATGG + Intergenic
1029492838 7:100881740-100881762 CAGGGTGGCCCCAGGGCTGAGGG - Exonic
1029515388 7:101020251-101020273 CAGGCTGGCCCCTGGGATGGGGG - Intronic
1035253132 7:157610243-157610265 CCGTGAGGCCCCTGGGAGGAGGG - Intronic
1035617186 8:1011174-1011196 CACAGTGAGCCCTGGAATGAGGG + Intergenic
1035617192 8:1011208-1011230 CACAGTGAGCCCTGGAATGAGGG + Intergenic
1035617216 8:1011344-1011366 CACAGTGAGCCCTGGAATGAGGG + Intergenic
1035617225 8:1011412-1011434 CACAGTGAGCCCTGGAATGAGGG + Intergenic
1036643434 8:10598060-10598082 CACTGTGACCCCTGGGTGCATGG + Intergenic
1038005213 8:23424170-23424192 CAGTCTGGCCCCAGGGATGGGGG - Intronic
1039903058 8:41766960-41766982 CAGGCTGTCCCCTGGGGTGAGGG + Intronic
1040300836 8:46187216-46187238 CAGTGAGACCACAGGGATGCTGG - Intergenic
1041256666 8:55984679-55984701 CTGTGTGACCACTGGGCTGGGGG - Intronic
1053054848 9:34988222-34988244 CATAGTGACTCCTGGCATGAAGG + Intergenic
1053381958 9:37655956-37655978 CAGTGAAATCCCTGGGATGAGGG - Intronic
1054884172 9:70178007-70178029 CAGTGTAACCCCAGGGCTGTAGG + Intronic
1056311034 9:85341147-85341169 CAGTGTGAGCCCTGGGGTGGAGG + Intergenic
1056703495 9:88931719-88931741 CAGTGAGACTTCTGGAATGATGG - Intergenic
1057547891 9:96031738-96031760 CAGTGGGTCCCCAGGGATGGTGG - Intergenic
1060296879 9:122348892-122348914 GAATGTGAACCCTGGGAGGAAGG + Intergenic
1061513071 9:131072597-131072619 CTTTGTGACCCCTGGGCTGTGGG + Intronic
1062434337 9:136540047-136540069 CTGTGTGACCCTGGGGCTGATGG + Intronic
1203444665 Un_GL000219v1:44384-44406 AAGTGTGACTCCTGTGAGGACGG + Intergenic
1203376931 Un_KI270442v1:384072-384094 AAGTGTGACCCCTGTGTGGATGG + Intergenic
1190080556 X:47354073-47354095 CACTCTGTCACCTGGGATGAAGG + Intergenic
1190370922 X:49739886-49739908 CAGTGTGAACCCTGGGTGAAGGG + Intergenic
1194538628 X:95141926-95141948 TACTGTGCCCCCTGGGGTGATGG - Intergenic
1199782923 X:151080070-151080092 CTGGGTGCCCCCTGGGATGAGGG + Intergenic
1200916515 Y:8576012-8576034 CACTGTGACTCCCAGGATGAAGG + Intergenic