ID: 1105438119

View in Genome Browser
Species Human (GRCh38)
Location 13:20394631-20394653
Sequence GTGTGTGTCCGCGCGCGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 1, 2: 11, 3: 56, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105438119_1105438124 7 Left 1105438119 13:20394631-20394653 CCTGAGCGCGCGCGGACACACAC 0: 1
1: 1
2: 11
3: 56
4: 203
Right 1105438124 13:20394661-20394683 GGCCCTGTGAGGACGCGGCGAGG 0: 1
1: 0
2: 3
3: 25
4: 242
1105438119_1105438127 13 Left 1105438119 13:20394631-20394653 CCTGAGCGCGCGCGGACACACAC 0: 1
1: 1
2: 11
3: 56
4: 203
Right 1105438127 13:20394667-20394689 GTGAGGACGCGGCGAGGAAGAGG 0: 1
1: 0
2: 1
3: 28
4: 311
1105438119_1105438123 2 Left 1105438119 13:20394631-20394653 CCTGAGCGCGCGCGGACACACAC 0: 1
1: 1
2: 11
3: 56
4: 203
Right 1105438123 13:20394656-20394678 CGACAGGCCCTGTGAGGACGCGG 0: 1
1: 0
2: 1
3: 8
4: 152
1105438119_1105438121 -4 Left 1105438119 13:20394631-20394653 CCTGAGCGCGCGCGGACACACAC 0: 1
1: 1
2: 11
3: 56
4: 203
Right 1105438121 13:20394650-20394672 ACACACCGACAGGCCCTGTGAGG 0: 1
1: 0
2: 0
3: 9
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105438119 Original CRISPR GTGTGTGTCCGCGCGCGCTC AGG (reversed) Intergenic
900179942 1:1306653-1306675 GTGGGTGTGCACGCGCGCGCTGG - Intronic
900374809 1:2348736-2348758 GTGTGTGTGCGTGCCCGCGCAGG - Intronic
900374814 1:2348802-2348824 GTGTGTGTGCGTGCCCGCGCAGG - Intronic
900609540 1:3538738-3538760 GTGTGTGTCCGCGCTGTCTGTGG + Intronic
901762661 1:11480662-11480684 GTGTGTGCACGCGCGCGCTGGGG - Intronic
901762663 1:11480664-11480686 GTGTGTGTGCACGCGCGCGCTGG - Intronic
901905022 1:12400951-12400973 GTGTGTGTGTGCGCGCGCGCAGG - Intronic
903822291 1:26111783-26111805 GGGTGTGTCCGCGCGCACCACGG + Intronic
904023728 1:27489241-27489263 GTGTGTGTGTGCGCGCGTACAGG - Intronic
904697529 1:32338599-32338621 GTGTGTGTGCGCGTGTGCCCAGG + Intergenic
904900094 1:33850214-33850236 GTGTGTGTGCGTGCACACTCAGG - Intronic
907118314 1:51989092-51989114 GTGTGTGTGTGCGCGCGCACAGG - Intronic
907645155 1:56235087-56235109 GTGTGTGTGTGCGCGCACTCAGG + Intergenic
907656797 1:56351552-56351574 GTGTGTGTGCTCGTGCGCTGGGG + Intergenic
912556455 1:110519734-110519756 GTGTGTGTGCGCGCGCACGCTGG + Intergenic
915954949 1:160213624-160213646 GTGTGCGTGTGCGCACGCTCTGG + Exonic
916233412 1:162561934-162561956 GTGTGTGTCTGCGGGCGAGCGGG - Intronic
918995795 1:191757542-191757564 GTGTGTGTGTGCGCGCGCGTGGG - Intergenic
919930009 1:202215015-202215037 GTGTGTGCGCGCGCGCGCGTTGG + Intronic
920045259 1:203128505-203128527 GTCTGTGTGTGCGCGCGCGCTGG + Intronic
920524997 1:206659793-206659815 GTGTGTGCGCGCGCACGCACCGG - Intronic
921708023 1:218346039-218346061 GTGTGCGTGTGCGCGCGCTGGGG - Intergenic
922817256 1:228458676-228458698 GTGTGTGTGCGCGCGCGCGCCGG + Exonic
922834811 1:228619959-228619981 GTGTGTGTGTCCGCGCGCGCGGG - Intergenic
922839832 1:228640064-228640086 GTGTGTGTGTCCGCGCGCGCGGG - Intergenic
922840955 1:228644536-228644558 GTGTGTGTGTCCGCGCGCGCGGG - Intergenic
923689039 1:236175490-236175512 GTGTGTGTACACGCGGGTTCTGG + Intronic
924799340 1:247316229-247316251 GTGTGTGTGAGCGCGCGCAGTGG + Intronic
924838422 1:247679514-247679536 GTGTGTGTGTGTGCGCGCTATGG + Intergenic
1063157815 10:3396319-3396341 GTGTGGCTCCCAGCGCGCTCCGG - Intergenic
1063624806 10:7679009-7679031 GTGTGTGCGCGCGCGCGCGGAGG - Intergenic
1063928891 10:11009355-11009377 GTGTGTGTGCGTGCGCGCGTCGG + Intronic
1064306826 10:14174913-14174935 GTGTGTGGACGCGCGCGTACGGG + Intronic
1064799009 10:19047378-19047400 GTGTGTGTCTGCGTGTTCTCAGG + Intergenic
1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG + Intronic
1067650713 10:48152947-48152969 GTGTGTGTGCGCGCGCGTGTGGG - Intergenic
1068660916 10:59622577-59622599 GTGTGTGTGTGCGCGCGCGCGGG - Intergenic
1068950132 10:62768489-62768511 GTGTGTGTGCGTGCGTGCGCTGG - Intergenic
1069653691 10:70071087-70071109 GTGTGTGTGCGCGTGTGCACAGG + Intronic
1071941455 10:90595871-90595893 GTGTTTGTCCGGGCCCTCTCTGG - Intergenic
1072542375 10:96407809-96407831 GTGTGTGTGCGCGCACGCGTGGG + Intronic
1073250472 10:102117897-102117919 GTGTGGGTCTGTGTGCGCTCTGG + Intronic
1073326219 10:102645196-102645218 GTGTGTGCGCGCGCGCGCGTAGG - Intronic
1073463755 10:103681757-103681779 GTGTGTGCGCGCGCGCGCGCGGG - Intronic
1074046400 10:109843505-109843527 GTGTGTGTGCGCGTGCACTTAGG - Intergenic
1076568821 10:131417916-131417938 GTGTGTGTGTGCGCGTGCACAGG - Intergenic
1076670959 10:132120921-132120943 GTGTGTGGCCGCTCGAGCTGCGG + Intronic
1077186772 11:1238996-1239018 GTGTGTGTCCTGGCGGACTCCGG + Exonic
1077223817 11:1429307-1429329 GTGTGTGTGCGTGTGCGCACAGG + Intronic
1077353607 11:2104465-2104487 GTGTGTGTGTGTGCGCACTCCGG - Intergenic
1077976217 11:7251693-7251715 GTGTGAGTGAGTGCGCGCTCCGG - Intronic
1079798163 11:24833699-24833721 GTGTGTGTGCGCGCGCGCGGTGG - Intronic
1083574313 11:63778464-63778486 GTGTGTGTGTGCGCGCGCGCGGG + Intergenic
1084285103 11:68125903-68125925 GTGTGTGCGCGCGCGCGTTATGG - Intergenic
1089702086 11:120251307-120251329 GTGTGTGTGTGCGCACGCACAGG - Intronic
1089777599 11:120849152-120849174 GTGTGTGTGTGCGCGCGTTGGGG - Intronic
1090768246 11:129895575-129895597 GTCTGGGTGCGCGCACGCTCTGG + Intronic
1091023852 11:132124617-132124639 GTGTGTGCGCGCGCACGCGCAGG + Intronic
1092105934 12:5921824-5921846 GTGTGTGTTAGAGCGCACTCGGG - Intronic
1093547839 12:20369205-20369227 GTGTGTGCGCGCGCGCGCGTGGG + Intergenic
1095692849 12:45110224-45110246 GTGTGTGTGTGTGCGCGCACGGG - Intergenic
1096073746 12:48789437-48789459 GTGGGTTTGCGGGCGCGCTCGGG - Intergenic
1096481107 12:51941569-51941591 GTGTGTGCGCGCGCGCGCGTGGG - Intergenic
1097019152 12:56007709-56007731 AGGTGTCTCCGCGCGCGCGCAGG - Exonic
1097195520 12:57240558-57240580 GTGTGTGTGTGCGCGCGCCGGGG - Intronic
1097698412 12:62796760-62796782 GTGTGTGTGTGCGCGCACACGGG - Intronic
1098392512 12:69984516-69984538 GTGTGTGTGTGTGCGCGCACGGG - Intergenic
1100613342 12:96210548-96210570 GTGTGCGTGCGCCCGCGCGCAGG - Intronic
1101640575 12:106583586-106583608 GTGTGCGTGCGCGCGCGCGAAGG + Intronic
1101641255 12:106586971-106586993 GTGTGTGTGTGCGCGCGCGCGGG + Intronic
1101966403 12:109285265-109285287 GTGTGTGTGTGCGCGCACTGCGG + Intronic
1102530843 12:113545517-113545539 GTGTGTGTGCACGCGTGCTCTGG + Intergenic
1103923439 12:124411251-124411273 GTGTGTGTATGCGCGCACACGGG - Intronic
1103971734 12:124676888-124676910 GTGTGTGTGCGTGCGTGCGCGGG + Intergenic
1104424489 12:128663921-128663943 GTGAGTGTCCGCGTGCGTGCAGG - Intronic
1105438119 13:20394631-20394653 GTGTGTGTCCGCGCGCGCTCAGG - Intergenic
1107459236 13:40585330-40585352 GTGTGTGTGCGCGCGCGCAGAGG - Intronic
1112507038 13:99981591-99981613 GAGTGTGTGCGTGCGCGCGCGGG + Intergenic
1112508764 13:99990827-99990849 GTGTGTGTGCGCGCGCGCAAAGG - Intergenic
1116344889 14:43780259-43780281 GTGTGTGTGCGTGCACGCACAGG - Intergenic
1117434870 14:55706292-55706314 GTGTGTGTGCGCATGCACTCAGG + Intergenic
1118323157 14:64765036-64765058 GTGTGTGCGCGCGCGCGCGCGGG + Intronic
1120497411 14:85254069-85254091 GTGTGTGTGTGCGCGCGTTGTGG - Intergenic
1120850014 14:89161589-89161611 GTGTGTGTGCGTGCGTGCACAGG + Exonic
1122666716 14:103334835-103334857 TTGTGAGTCATCGCGCGCTCTGG + Intronic
1123919243 15:25058940-25058962 GTGTGTGTGCGCGGTCGGTCTGG + Intergenic
1125917604 15:43503153-43503175 GTGTGTGTGCGCGCATGCGCGGG + Intronic
1126348119 15:47717785-47717807 GTGTGTGTGTGCGCGCGGTGGGG + Intronic
1128020544 15:64386654-64386676 GTGTGTCTCCGTGTGCGCTCGGG + Intronic
1128582788 15:68820623-68820645 GTGTGTGTGTGTGCGCGCTGGGG - Intronic
1128791140 15:70434715-70434737 GTGTGCGCGCGCGCGCGCGCGGG - Intergenic
1131694237 15:94857650-94857672 GTGTGTGTGCGCGCGCACATGGG + Intergenic
1131713750 15:95085567-95085589 GTGTGTGTGTGCGCGTGCGCAGG + Intergenic
1134107913 16:11497215-11497237 ATGTGTGTACACGTGCGCTCAGG + Intronic
1135037738 16:19092171-19092193 GTGTGTGTGCGCGCGCGCATTGG + Intergenic
1138116082 16:54361816-54361838 GTGTGTGTGCGTGCACGCTCAGG + Intergenic
1138654202 16:58481460-58481482 GTGTGTGTGCGCGCGCATGCAGG + Intronic
1141054684 16:80804229-80804251 GTGCGTGTGCGCGCGGGGTCCGG + Exonic
1141147883 16:81544434-81544456 GTGTGTGTGTGCGCGCACACAGG + Intronic
1141526611 16:84615867-84615889 GTGTGTGTGTGCGCGCACGCGGG + Intronic
1141618060 16:85221303-85221325 GTGTGTGTGTGTGCGCGCTAGGG - Intergenic
1141990212 16:87604985-87605007 GTGTGTGTGCGCGCGCGTGCAGG + Intronic
1143102603 17:4512638-4512660 GTGTGTGCGTGCGCGCGCACGGG + Intronic
1144172837 17:12676232-12676254 GTGTGTGTGCGTGCGCGCGCAGG - Intronic
1144757146 17:17686601-17686623 GTGTGTGTGCACGCGCGCGCCGG + Intronic
1144757148 17:17686603-17686625 GTGTGTGCACGCGCGCGCCGGGG + Intronic
1146022854 17:29293656-29293678 GTGTGTGTCCCCTCCGGCTCTGG - Intronic
1146062053 17:29612816-29612838 GTGCGTCTCCGCGGGCGCGCGGG + Intronic
1147139487 17:38453453-38453475 GTGTGTGTGCGCGCGCGCGCTGG + Intronic
1147168667 17:38605879-38605901 GTGTGGGTGAGCGCGCGCGCGGG + Exonic
1147168670 17:38605943-38605965 GTGTGTGTCTGCGCGCGCGCGGG + Intergenic
1148563406 17:48619262-48619284 GTGTGTGTGCGCGCGCGCGCAGG + Intronic
1149038520 17:52159602-52159624 GTGTGTGTGTGTGCGCGCGCGGG - Intronic
1151138035 17:71966426-71966448 GTGTGTGTGCACGCGCACGCAGG - Intergenic
1152549128 17:81020679-81020701 GTGTGTGCTCGCGGGCACTCAGG + Intergenic
1152828137 17:82480280-82480302 GTGTGTGTGTGTGCGCGCGCTGG - Intronic
1153646716 18:7202537-7202559 GTGTGTGTGTGCGTGCGCGCGGG - Intergenic
1153807664 18:8723500-8723522 GTGTGTGTCCCCTCGGCCTCAGG + Intronic
1154954287 18:21240562-21240584 GTGTGTGCGCGCGCGCGCGCGGG - Intergenic
1156000353 18:32378052-32378074 GTGTGTGCGCGCGGGCGCTTTGG + Intronic
1157263888 18:46200084-46200106 GTGTGTGTGCGCGCGCGTGCTGG + Intronic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1157427308 18:47594986-47595008 GTGTGTGTGCGCGCACACGCGGG - Intergenic
1160863931 19:1249109-1249131 GGCTGCGCCCGCGCGCGCTCGGG - Intronic
1160962648 19:1730380-1730402 GTGTGTGTGCGTGCGCGCGTTGG - Intergenic
1161264778 19:3359276-3359298 GTGTGTGTGCGCGCGCGCCGCGG + Intergenic
1161752555 19:6109034-6109056 GTGTGCGCCCGCGAGCGCGCTGG + Intronic
1165390161 19:35534182-35534204 GTGTGTGTGTGCGCGCGCGCGGG - Intronic
1165579701 19:36851322-36851344 GTGTGTGTGTGCGCGCGCGTTGG + Exonic
1166126019 19:40715863-40715885 GTGTGTGTGCGCGCGCGCGTTGG + Intronic
925532254 2:4877115-4877137 GTGTGTGCGCGCGCGCGCCTGGG - Intergenic
925801629 2:7607768-7607790 GTGTGTGTGCACGCGTGCACAGG + Intergenic
926206527 2:10837916-10837938 GTGTGTGTGCGCGCGCACGCAGG + Intronic
926923568 2:17963666-17963688 GTGTGTGTGCGCGCGCATCCAGG + Intronic
927000873 2:18792942-18792964 GTGTGTGCACGCGCGCGCAGTGG - Intergenic
927235518 2:20870908-20870930 GTGTGTGCGCGCGCGCATTCAGG + Intergenic
929313280 2:40450364-40450386 GTGTGTGCACGCGCGCGCGCTGG + Intronic
929667815 2:43846975-43846997 GTGTGTGCACGCGCGCGTGCAGG - Intronic
932588816 2:73050381-73050403 GTGTGTGTGTGCGTGCGCTGTGG - Intronic
933817235 2:86077796-86077818 GTGTGTGCGCGCGCGCGTGCAGG - Intronic
936518908 2:113199429-113199451 GTGTGTGTCCCCACGCACTTAGG + Intronic
938900482 2:135795030-135795052 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
939009591 2:136830115-136830137 GTGTGTGTGTGTGCGCGCACAGG - Intronic
939534749 2:143413957-143413979 GTGTGTGTGTGCGCGCTCTCTGG + Intronic
939857893 2:147382566-147382588 GTGTGTGTCAGCAGGTGCTCTGG - Intergenic
941463239 2:165794774-165794796 GTTTCTGTACGCGGGCGCTCTGG + Intergenic
941892269 2:170594818-170594840 GTGTGTGTGTGTGCGCGCGCTGG - Intronic
942970680 2:181954297-181954319 GTGTGTGTGTGCGCGCGCGCGGG - Intronic
944494908 2:200296897-200296919 GTGTGCGTGCGCGCGCATTCAGG - Intergenic
945033359 2:205684939-205684961 GTGTGTGCGCGCTCGCGCGCTGG - Intronic
945699439 2:213151849-213151871 GCGCGTGTGCGCGCGCGCGCGGG + Intronic
947625290 2:231614816-231614838 GTGCGTGCGCGCGCGCGCGCGGG - Intergenic
1169324144 20:4661546-4661568 GTGTTTGTCGGCGCGCTCTCGGG + Intergenic
1169473023 20:5904561-5904583 GTGTGTGTGTGCACGCGCACAGG + Intergenic
1170533346 20:17315863-17315885 GGGTGTGTCCGCGCGGGCCATGG - Intronic
1171237051 20:23535489-23535511 GTGTGTGTGTGCGCGCGCGCGGG - Intergenic
1172118302 20:32584122-32584144 GTGTGTGTGTGCGCGCGCGGAGG - Intronic
1177999955 21:28149954-28149976 GTGTGTGTGTGTGCGTGCTCAGG + Intergenic
1178021870 21:28417460-28417482 GTGTGTGTGTGCGCGCGCGCAGG + Intergenic
1179133641 21:38660891-38660913 GTGTCCGTGCGCGCGCCCTCGGG + Intronic
1179569250 21:42268381-42268403 GTGTGTGTGCGCGCGCGCGCTGG + Intronic
1180950577 22:19718847-19718869 GTCTGTGACCCCGCGGGCTCCGG + Intronic
1182041637 22:27242813-27242835 GTGTGTGTGCGCGCGTGCGCGGG - Intergenic
1182737661 22:32542646-32542668 GTGTGTGTGCGCGCGCACACAGG + Intronic
1182885271 22:33768423-33768445 GTGTGTGTGAGCGCGCGCGTTGG - Intronic
1183034868 22:35134019-35134041 GTGTGTGTGCGCGTGTGCGCAGG + Intergenic
1185170048 22:49287672-49287694 GTGTGTGTCAGCGAGCTCTTGGG + Intergenic
950105629 3:10386568-10386590 GTGTGTGTGCGCGTGCGCATGGG - Intronic
950282419 3:11719509-11719531 CTGTGCGTCTGCGCGCCCTCGGG - Intronic
954505453 3:51067447-51067469 GTGTGTGTGTGCGCGCGCGTTGG + Intronic
955663260 3:61323981-61324003 GTGTGTGTGTGCGCGCGTTGGGG + Intergenic
957792910 3:84961632-84961654 GTGTGTGCGCGCGCGCGCGCCGG + Intronic
960047441 3:113211695-113211717 GTGTCTGTGCGCGCGCGCGGCGG - Exonic
960747748 3:120908569-120908591 TTGTGTGTTCGCGCGCCCGCGGG + Intronic
960790230 3:121422089-121422111 GTGTGTGTGCGTGCGTGCTAAGG - Exonic
961328205 3:126124098-126124120 GTGTGTGTGTCCGCGCGCCCTGG - Intronic
961539926 3:127592318-127592340 TTGTGTGTCGGCGCGCTCGCAGG - Intronic
963741863 3:149088725-149088747 GTGTGTGTGTGCGCGCGCGCGGG - Intergenic
965796627 3:172447595-172447617 GTGGGTCTCAGCGCGCGCTCAGG - Intronic
966255635 3:177914060-177914082 GTGTGTGTGTGCGCGCGCATGGG - Intergenic
966593007 3:181702020-181702042 GTGTGTGCGCGCGCGCGCATGGG - Intergenic
967118498 3:186362332-186362354 GTGTGTGTACGCGCGCGCGCCGG - Intergenic
967858504 3:194135024-194135046 GTGTGTGTGCGCGCGCCCCGGGG - Intergenic
967858506 3:194135026-194135048 GAGTGTGTGTGCGCGCGCCCCGG - Intergenic
968495697 4:914261-914283 GTGTGTGGCCGTGCACGCTGGGG - Intronic
968495756 4:914519-914541 GTGTGTGGCCGTGCACGCTGGGG - Intronic
968699111 4:2046523-2046545 GGGTGTGTCGGCGTGCGCTGGGG - Intergenic
969674247 4:8606436-8606458 GTGTGTGTCAGCGGGGGGTCAGG + Intronic
970826545 4:20283105-20283127 GTGTGTGCGCGCGCGCACACAGG - Intronic
971809569 4:31406810-31406832 GTGTGTGTCCGCGCGCGTTGGGG - Intergenic
974624406 4:64403468-64403490 GTGTGTGTGTGTGTGCGCTCAGG - Intronic
974686883 4:65242373-65242395 GGGTGTGTGTGCGCACGCTCAGG - Intergenic
976897466 4:90128515-90128537 GTGCGCGCGCGCGCGCGCTCTGG + Intronic
978084897 4:104639461-104639483 GTGTGTGTGTGTGCGCGCTCAGG - Intergenic
978384847 4:108168642-108168664 GTGTGTGTCGGCTCGAGCTCCGG - Intronic
979469021 4:121072685-121072707 GTGTGTGTGTGCGTGCGCGCTGG - Intronic
984260192 4:177435779-177435801 GTGCGTGTGCGTGCACGCTCAGG - Intronic
985073478 4:186191151-186191173 GTGTGTGTCCGCTGGCCCACTGG - Intergenic
987901085 5:24013042-24013064 GTGTGTGTGCGCGCGCGCGCAGG + Intronic
988853935 5:35208166-35208188 GTGTGTGTGTGCGCGCGCGTGGG - Intronic
990662745 5:58036006-58036028 GTGTGTGTGCGCACGCACTATGG - Intergenic
993519454 5:88883219-88883241 GCGTGTGTGCGCGCGCGCGAGGG + Intronic
994959795 5:106584584-106584606 GTGTGTGTGTGCGCGCGCATGGG + Intergenic
997459874 5:134044655-134044677 GTGTGTGTGCGCGCGCGCACAGG + Intergenic
997955275 5:138274311-138274333 GTGAGTGTCAGAGCGCGCACCGG - Intronic
999410731 5:151347561-151347583 GTGTGTGCCCGGGCTGGCTCTGG + Exonic
1000665419 5:163989211-163989233 GTGTGTGTGCGCGCGCGTGTGGG + Intergenic
1002058834 5:176614168-176614190 GTGTGTGTGCGCGCGCGCAGGGG - Intergenic
1002058836 5:176614170-176614192 GTGTGTGTGTGCGCGCGCGCAGG - Intergenic
1002852931 6:1012361-1012383 GTGTGTGTGTGCGCGCGCGTAGG + Intergenic
1003030764 6:2598746-2598768 GTGTGTGTGTGTGCGCGCGCTGG + Intergenic
1003030766 6:2598748-2598770 GTGTGTGTGTGCGCGCGCTGGGG + Intergenic
1004561809 6:16759975-16759997 GTATTTGTGCGCGCGCGCGCCGG - Intronic
1005942621 6:30571924-30571946 GTGTGTGTATGCGCGCGCAGGGG - Intronic
1006389394 6:33749640-33749662 GTGTGTGTGCGCGCGGCCCCGGG + Intergenic
1007885788 6:45228582-45228604 GTGTGTGTGTGCGCGCGCGCGGG - Intronic
1008952052 6:57172281-57172303 CTGTGGGTCCGCGCGGGCTTCGG + Intergenic
1011074987 6:83429914-83429936 GTGTGTGTGTGCGTGCGCTTTGG - Intronic
1013413240 6:109900946-109900968 GTGTGTGTGTGCGCGCAATCTGG - Intergenic
1014109283 6:117602370-117602392 GAGTGTGCCCGCGCGCGCGGGGG - Intronic
1014632355 6:123803245-123803267 GTGTGTGTGCGCGCGCGCTCGGG - Intergenic
1015605153 6:134946772-134946794 GCATGTGTGCGCGCGCGCACAGG + Intronic
1017164516 6:151394778-151394800 GTGTGTGTGTGCGCGCGCTTAGG + Intergenic
1017175081 6:151494720-151494742 GTGTGTGTGCGCGCGCGCATTGG - Intronic
1017447391 6:154519261-154519283 ATGTGTGTGCGCGCGTGCGCAGG - Intergenic
1018329956 6:162716755-162716777 GTGTGCGTGCGCGCGCGCGCAGG - Intronic
1019621719 7:1995700-1995722 ATGTATGTCCCCGCGCGCGCTGG - Intronic
1021107625 7:16656540-16656562 GTGTGTGCGCGCGCGCGCTGGGG - Intronic
1021107627 7:16656542-16656564 GTGTGTGTGCGCGCGCGCGCTGG - Intronic
1022757859 7:33313053-33313075 GTGTGTGTGTGTGCGCGCACAGG + Intronic
1023319419 7:38976616-38976638 GTGTGTGTGCGCGCGCGCTTCGG + Intergenic
1026665604 7:72337393-72337415 GTGTGAGTGCGCGCGCGCCGAGG - Intronic
1027052204 7:75027606-75027628 ATGTGTGTCGGGGCGCGCTGGGG + Intronic
1031877662 7:127160522-127160544 GTGTGTGTGCGCGCGCGTGATGG - Intronic
1032013413 7:128360972-128360994 GTGTGTGCGCGCGCGCGTGCAGG - Intronic
1032712183 7:134470056-134470078 TTGTTTGTCCGCGAGCTCTCGGG + Intergenic
1033415425 7:141157416-141157438 GTGTGTGTGTGCACGCGCGCAGG - Intronic
1033450545 7:141458863-141458885 GTGTGTGTGTGCGTGCGCACAGG - Intronic
1035212801 7:157340988-157341010 GTGTGTGTGTGCGCGCGCGCAGG + Intronic
1035272139 7:157726464-157726486 CTGTGAGTCAGCGCACGCTCGGG - Intronic
1036391603 8:8328763-8328785 GTGTGTGTGCGCACGCGTGCAGG - Intronic
1039256224 8:35721830-35721852 GTGTGGGTCTGCCCTCGCTCTGG + Intronic
1039918353 8:41875941-41875963 GTGTGCGCCCGGGCGCGCGCCGG - Intronic
1044488667 8:92785610-92785632 GTGTGTGTGCGCGCGTGCATAGG - Intergenic
1044661813 8:94598873-94598895 GTGTGTGTGCGCGTGCGCGCGGG + Intergenic
1044840078 8:96329754-96329776 GTGTTTGTCCGTGGGCCCTCAGG + Intronic
1045287780 8:100806878-100806900 GTGTGTGCGCGCGCACGCACAGG + Intergenic
1045583127 8:103500465-103500487 GAGTGTGTCCGGCCGCGGTCAGG - Intergenic
1046209404 8:111048002-111048024 GTGTGTGTGTGCGTGCGCACTGG + Intergenic
1046209406 8:111048004-111048026 GTGTGTGTGCGTGCGCACTGGGG + Intergenic
1047423567 8:124727081-124727103 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
1048244050 8:132774815-132774837 ATGTGTGTACGCGCGTGCTCAGG - Intergenic
1048484255 8:134832340-134832362 GTGTGTGTGCGCGCGCGCGTGGG + Intergenic
1049923022 9:382623-382645 GAGTGTGTCCCCGCGAGGTCTGG - Exonic
1050771853 9:9211502-9211524 GTGTGTGTGCGTGCGCACACTGG - Intronic
1052494958 9:29213613-29213635 GTGTGTAGCTGCGCGCGCGCGGG - Intergenic
1056116989 9:83450202-83450224 GTGTGTGTGTGTGCGCGCACGGG - Intronic
1056652054 9:88473651-88473673 GTGTGTGTGTGCACGCGCTATGG + Intronic
1057718066 9:97511061-97511083 GTGTGTGTGTGTGCGCGCGCGGG - Intronic
1058778159 9:108305853-108305875 GTGTGTGTCGGGGCGGGGTCGGG - Intergenic
1060051758 9:120383157-120383179 GTGTGTGTGTGTGCGCGCCCTGG - Intergenic
1060463867 9:123884982-123885004 GTGTGTGCGCGCGCGCTCGCAGG - Intronic
1060551844 9:124489318-124489340 GTGTGTGTCCGCGGGAGTCCGGG - Intronic
1185677197 X:1858516-1858538 GTGTGTGTCGGCTCGGGCTGAGG - Intergenic
1185723143 X:2397919-2397941 GTGTGTGTGTGCGCGCTCTGAGG - Intronic
1185881587 X:3745954-3745976 GTGTGTGTGCACGCGCGCATGGG - Intergenic
1186490596 X:9969424-9969446 GTGTGTGTGCGCGCGTGCACTGG - Intergenic
1187487990 X:19722548-19722570 GTGTGTGTGCGCGTGCGCACTGG + Intronic
1189336272 X:40172559-40172581 ATGTGTCTGCGCGCGCGCCCTGG + Intronic
1194035534 X:88866236-88866258 GTGTGTGTGCGCGCGCGCAAAGG + Intergenic
1197655139 X:129108644-129108666 GTGTGTGTGCGCGCGCGCGGCGG + Intergenic
1198115493 X:133540946-133540968 GTGTGTGTGTGCGCGCACTGTGG + Intronic