ID: 1105439611

View in Genome Browser
Species Human (GRCh38)
Location 13:20404407-20404429
Sequence CTCATTGTGACTTGTCTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105439611_1105439619 28 Left 1105439611 13:20404407-20404429 CCTCAGAGACAAGTCACAATGAG 0: 1
1: 0
2: 0
3: 17
4: 151
Right 1105439619 13:20404458-20404480 AAGGTGTCCTGGTGACACGATGG 0: 1
1: 0
2: 0
3: 9
4: 97
1105439611_1105439612 -8 Left 1105439611 13:20404407-20404429 CCTCAGAGACAAGTCACAATGAG 0: 1
1: 0
2: 0
3: 17
4: 151
Right 1105439612 13:20404422-20404444 ACAATGAGCTACCAGTTCACTGG 0: 1
1: 0
2: 2
3: 10
4: 122
1105439611_1105439615 17 Left 1105439611 13:20404407-20404429 CCTCAGAGACAAGTCACAATGAG 0: 1
1: 0
2: 0
3: 17
4: 151
Right 1105439615 13:20404447-20404469 ACCCTGTCCTTAAGGTGTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 118
1105439611_1105439614 9 Left 1105439611 13:20404407-20404429 CCTCAGAGACAAGTCACAATGAG 0: 1
1: 0
2: 0
3: 17
4: 151
Right 1105439614 13:20404439-20404461 CACTGGTCACCCTGTCCTTAAGG 0: 1
1: 0
2: 0
3: 6
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105439611 Original CRISPR CTCATTGTGACTTGTCTCTG AGG (reversed) Intronic
900423527 1:2566044-2566066 CTCATTGTGTCTTGACACAGTGG + Intergenic
901638954 1:10683670-10683692 CGCACTCCGACTTGTCTCTGTGG - Intronic
908188696 1:61677742-61677764 CTCTGTGTGATTTGTCACTGAGG - Intergenic
912036598 1:105324527-105324549 CTCTTTGTGACTTGTGTTGGTGG - Intergenic
913241300 1:116832236-116832258 TATATTGTGACTTGTCCCTGTGG - Intergenic
913404453 1:118474037-118474059 CTCATTGTGACTTTACTGTCAGG - Intergenic
915800051 1:158781349-158781371 CTGATTCTCACCTGTCTCTGGGG - Intergenic
916026586 1:160838502-160838524 TTCCTTGGGACTGGTCTCTGAGG + Exonic
919276292 1:195420937-195420959 CTCATTGTCACTTATCTTTTTGG - Intergenic
921467563 1:215507769-215507791 CTCATGGTGCCTTGTTTCTCAGG - Intergenic
922017719 1:221668529-221668551 AACATTTTGACATGTCTCTGAGG + Intergenic
923049516 1:230381001-230381023 CTCATTGTCACTCCTCTCTAGGG - Intronic
1065520143 10:26564432-26564454 CTCATTATGACTCGTGTCTCAGG - Intronic
1066593989 10:37028435-37028457 ATCATTGTGAGTTTTCTCTGTGG + Intergenic
1066669300 10:37820008-37820030 CTCTTTTTGACTTTTCTATGAGG + Intronic
1067184123 10:44012687-44012709 CTCATCTTGACTTCTCTCTTAGG + Intergenic
1071324137 10:84494896-84494918 CTCATTTTCACTTTACTCTGTGG - Intronic
1073941534 10:108704438-108704460 CTGATGCTGACTTTTCTCTGTGG - Intergenic
1077284226 11:1758725-1758747 CTCATTGTGGCCTGACTCCGGGG + Intronic
1079826988 11:25208775-25208797 GTCAGTGTGATTTGGCTCTGGGG - Intergenic
1085894324 11:80619877-80619899 ATCATTGTGAGTTTTCTCTGTGG - Intergenic
1088016697 11:105069857-105069879 CTCCTAGTTACTGGTCTCTGTGG - Intronic
1088019247 11:105099764-105099786 CTCCTAGTTACTGGTCTCTGTGG - Intronic
1088398069 11:109390680-109390702 CTCATTTTCTCTTCTCTCTGAGG - Intergenic
1089347759 11:117801986-117802008 CTCATTGTCACATTTCTCTCTGG + Intronic
1091780788 12:3213460-3213482 CTCATCGTGACCAGTCCCTGGGG + Intronic
1094467074 12:30764596-30764618 CTCCTTGTGACTTGTGTGTATGG - Intergenic
1095630650 12:44373278-44373300 CTAATGGTTACATGTCTCTGAGG + Intronic
1095637204 12:44448683-44448705 CCCACTGTGTCTTGTCCCTGAGG + Intergenic
1097697444 12:62788259-62788281 CTCATTGTGATTTGCCTTTTGGG - Exonic
1098068116 12:66642004-66642026 CACATTGTAACTTGGCACTGAGG - Intronic
1100588701 12:96003811-96003833 ATCATTTTAACTTGTCTCTGTGG - Intronic
1103550942 12:121736925-121736947 CTACCTGGGACTTGTCTCTGTGG + Intronic
1103732836 12:123039325-123039347 CTCATTTTGACTTATCTTTTTGG - Intronic
1103749239 12:123148304-123148326 CTCATTTTGGATTGACTCTGCGG + Intronic
1104103542 12:125637690-125637712 CTTATTGTTACTTGTGTCAGTGG - Intronic
1105439611 13:20404407-20404429 CTCATTGTGACTTGTCTCTGAGG - Intronic
1107617490 13:42185404-42185426 CTCAGTGTGCCATGTCACTGAGG - Intronic
1110539728 13:76694683-76694705 CTCCTTCTGACTTTTCCCTGAGG - Intergenic
1112696794 13:101958736-101958758 CTCAGAGTGACTTTTATCTGAGG - Intronic
1114753716 14:25234692-25234714 GTCATTTGGACTGGTCTCTGTGG + Intergenic
1116788647 14:49315836-49315858 TTCAGTCTGACCTGTCTCTGGGG - Intergenic
1117333989 14:54741111-54741133 TTCACTGTGACTTATCTCAGAGG + Intronic
1117911395 14:60641617-60641639 CTCAGTGTGAATTGTCCATGGGG + Intergenic
1119651142 14:76384174-76384196 CTCTTTGTCATTTGTCTCTTGGG + Intronic
1120854838 14:89203449-89203471 CTCATAGTGCCCTGTGTCTGTGG + Intronic
1121280959 14:92697559-92697581 CTCAATGTGACTTGTCATTAAGG + Intergenic
1125112681 15:36051645-36051667 CTCATTGTGACAAGACTATGAGG + Intergenic
1125863923 15:43025334-43025356 CTCATTTTGACTATTTTCTGTGG - Intronic
1127827430 15:62717368-62717390 GTCTTTGTCACTTGTCTCAGAGG + Intronic
1130039542 15:80394607-80394629 CTGAGTGTGACATGTCTCAGAGG - Intronic
1130083417 15:80755890-80755912 CTCATTGTGACCTGGCTCAGAGG + Intergenic
1132176905 15:99723256-99723278 CTCATTGTTTCTTGGATCTGTGG - Intronic
1132686641 16:1164991-1165013 CTCAGGGTGATTTGTCTCCGTGG + Intronic
1134526783 16:14950546-14950568 CTCATTTGGAATTGTCCCTGTGG - Intronic
1134545623 16:15105802-15105824 CTCATTTGGAATTGTCCCTGTGG + Intronic
1134714360 16:16349023-16349045 CTCATTTGGAATTGTCCCTGTGG - Intergenic
1134722235 16:16392387-16392409 CTCATTTGGAATTGTCCCTGTGG - Intronic
1134945192 16:18319482-18319504 CTCATTTGGAATTGTCCCTGTGG + Intronic
1134952456 16:18359635-18359657 CTCATTTGGAATTGTCCCTGTGG + Intergenic
1138616956 16:58176249-58176271 CTCATTAGGACTTTTATCTGTGG + Intronic
1139092494 16:63665290-63665312 CACATAGTTACTTGTCTCTCAGG + Intergenic
1139101362 16:63771473-63771495 CTTATTGGTACTTCTCTCTGGGG - Intergenic
1139960779 16:70716201-70716223 TTCTTTGTTACTTGTCCCTGTGG + Intronic
1144809286 17:17988469-17988491 CTCCTTGTGCCTTGACTATGGGG - Intronic
1148356081 17:46976941-46976963 CTCCTTGTAAAGTGTCTCTGGGG - Intronic
1148360870 17:47010880-47010902 CTCAGTGACACTTATCTCTGAGG + Intronic
1148875893 17:50686998-50687020 CTCTTTGTGTCTGGTCACTGAGG - Intronic
1150785665 17:68161278-68161300 CTCAGTGACACTTATCTCTGAGG - Intergenic
1151544735 17:74785777-74785799 CTCCTGGTGGCTTGTCTTTGTGG + Intronic
1156051048 18:32934611-32934633 TTCAGTGTGACTGGTCTCTTAGG + Intergenic
1156848073 18:41692530-41692552 CTTATTGTGACTTATCTATGTGG + Intergenic
1159716525 18:71830658-71830680 CTCATTCTCTCTGGTCTCTGAGG - Intergenic
1161011724 19:1962587-1962609 CTCACTGTAACTTGTCTCCCGGG - Intronic
1164041661 19:21497918-21497940 GACATTGTGACATATCTCTGGGG + Intronic
1164255103 19:23521143-23521165 GAGATTGTGACTTATCTCTGGGG - Intergenic
1164294676 19:23899388-23899410 GTCATTTTGAAATGTCTCTGTGG + Intergenic
1166307286 19:41941848-41941870 CTCATTTTGACTTGAGTCTGAGG - Intergenic
1166380941 19:42354925-42354947 CTGAATGAGACATGTCTCTGGGG + Intronic
927313635 2:21657223-21657245 CTCATAGTTATTTGTGTCTGAGG + Intergenic
927338737 2:21955217-21955239 CTCATTGATACTTGGCACTGGGG - Intergenic
928119528 2:28573493-28573515 TCCATTGTGACTAGTTTCTGGGG - Intronic
929955276 2:46453458-46453480 CTCATTGTTACTTTTCTTTAGGG + Intronic
930240914 2:48934894-48934916 TTAACTGTGACTTATCTCTGAGG + Intergenic
930484182 2:51991820-51991842 CTTACTGTGACTTGACTCTACGG + Intergenic
933002705 2:76946066-76946088 CACATTATATCTTGTCTCTGTGG + Intronic
937825466 2:126364296-126364318 ATCATTGTGCCTTTTCTCAGGGG + Intergenic
939006865 2:136798735-136798757 CTGATTGTGACCTTTCTCTGTGG + Intronic
939516117 2:143170257-143170279 CTCACTGTGAATTGTAGCTGAGG - Intronic
940180463 2:150926515-150926537 CTCCTTGTGACTTGTGACTAAGG + Intergenic
945879841 2:215313803-215313825 CTTTTTGCGTCTTGTCTCTGTGG + Intronic
945939895 2:215937929-215937951 TTCATTGTCCCTTGTCTGTGGGG - Intergenic
947592838 2:231395316-231395338 CCCATTCGGACTTGTCTTTGGGG - Intergenic
948253793 2:236551522-236551544 CCCAGTGTGTATTGTCTCTGTGG + Intergenic
1177368103 21:20164888-20164910 TTATTTGTGACTTGTGTCTGTGG - Intergenic
1178013978 21:28320853-28320875 CTGATTGTTATGTGTCTCTGTGG + Intergenic
1179182877 21:39060825-39060847 CATATTGTGACTTATCCCTGTGG - Intergenic
949471787 3:4404178-4404200 CTCATTGTAATTTTTCACTGTGG - Intronic
951736506 3:25871346-25871368 CTGTTTTTAACTTGTCTCTGTGG + Intronic
956331440 3:68114292-68114314 CTAATTGTGACTGGTCTGTGGGG - Intronic
957324164 3:78670965-78670987 ATCATTTTGACTTGTCTCTTTGG - Intronic
960955195 3:123026737-123026759 CTCATGGTAATTTGTCTTTGTGG - Intronic
965012349 3:163110096-163110118 CTCATTGTGACTTGGCGAAGAGG - Intergenic
966326412 3:178760803-178760825 CTATTTGTTACTTGTCTCTAAGG - Intronic
971156964 4:24093578-24093600 TCCATTGAGACTAGTCTCTGGGG - Intergenic
971171856 4:24241864-24241886 CTCATTGTGGCTTCTGTATGTGG + Intergenic
975859596 4:78662558-78662580 ATCATTGTGCATTGTCTCTAGGG + Intergenic
976533070 4:86178348-86178370 CTCATTATTGCTTATCTCTGAGG + Intronic
976851917 4:89557598-89557620 ACCATTGCTACTTGTCTCTGAGG - Intergenic
976902014 4:90190081-90190103 TGCATTGTGATTTGGCTCTGAGG + Intronic
977331589 4:95643629-95643651 ATTGTTGTGACTTATCTCTGTGG + Intergenic
978717371 4:111862052-111862074 GTCATTGTGATTTGTGACTGAGG - Intergenic
981804933 4:148704143-148704165 CTCATGGTGCCTTGTTTCAGTGG + Intergenic
983837209 4:172404300-172404322 CTCATTGGGTTTTGACTCTGGGG - Intronic
984931461 4:184851215-184851237 CTCTTGGTGACTAGTCTCTGTGG - Intergenic
985803172 5:2019449-2019471 CTCCTTGAGCATTGTCTCTGGGG + Intergenic
985882895 5:2653953-2653975 GGCATTTTGACTGGTCTCTGTGG - Intergenic
987138909 5:14926013-14926035 CTCATTGCATCTCGTCTCTGAGG + Intergenic
988310923 5:29556368-29556390 CTCAATGTGCCTTGACTCTTGGG - Intergenic
990773463 5:59277732-59277754 CTCATTGTAACATGGATCTGGGG - Intronic
993955528 5:94227805-94227827 CACACTGTGACCTGTCTCGGGGG + Intronic
994561133 5:101374185-101374207 CTCATTGAGACTTATCTTTCAGG + Intergenic
1000633977 5:163622624-163622646 CCCATTGTGACAGCTCTCTGGGG + Intergenic
1000667706 5:164019437-164019459 CTCAGTGTGATTTCTCTCTGAGG + Intergenic
1002111467 5:176917243-176917265 TTAATTGAGACTGGTCTCTGAGG - Intronic
1003978208 6:11364337-11364359 CTGATTCTGATTTGTCTTTGAGG + Intronic
1007309351 6:40933278-40933300 CGCCTTGGGACTTGTTTCTGAGG + Intergenic
1011117919 6:83915019-83915041 CTTATTTTGTCTTGTTTCTGAGG - Intronic
1011986315 6:93451117-93451139 CCCATTGTTTATTGTCTCTGTGG - Intergenic
1013483121 6:110569105-110569127 CTCATTCTGACTTTTGTCCGAGG + Intergenic
1014702208 6:124704088-124704110 GTCATTGTGACTTGCCTTTTGGG - Intronic
1016319101 6:142822723-142822745 CTCTTTGTGAATCTTCTCTGTGG - Intronic
1016689114 6:146915367-146915389 CTCAAAGTGACCTCTCTCTGAGG - Intergenic
1019014587 6:168870783-168870805 TCCATTGAGACTTGTCTCAGAGG + Intergenic
1020036054 7:4963678-4963700 CTCAGTGTGAGTTGTCCCTGAGG - Intergenic
1020941551 7:14545296-14545318 CTCATAGTTAATTGTATCTGAGG - Intronic
1023270339 7:38455744-38455766 CTCCTTGTGAGTTCTCTCTCTGG - Intronic
1024547133 7:50531559-50531581 CTCATTATGGCTTTTCTCTGGGG + Intronic
1025756604 7:64350625-64350647 CTGATTGTGTCTTATCTTTGTGG + Exonic
1026409004 7:70099518-70099540 CTCATTGTGAATTGTATTTAAGG - Intronic
1028492486 7:91427612-91427634 CTTATTCTGATTTGTCTCTGAGG - Intergenic
1031441100 7:121795507-121795529 CTCATTCCTACTTGGCTCTGGGG - Intergenic
1033428412 7:141266209-141266231 CTCATTGGGACTTCCCTCTGTGG + Intronic
1033528396 7:142239952-142239974 CTTATTTTTACTTTTCTCTGTGG - Intergenic
1035620141 8:1030296-1030318 CCCATTGTGTTTTGTTTCTGAGG + Intergenic
1038344503 8:26719807-26719829 CCCATGGTGAATTGGCTCTGTGG - Intergenic
1039611316 8:38921524-38921546 CTCACTCTGATTTGTCACTGGGG + Intronic
1040660992 8:49575200-49575222 ATCAACATGACTTGTCTCTGTGG - Intergenic
1043380250 8:79694948-79694970 CTCAGTCTGTTTTGTCTCTGGGG - Intergenic
1044891948 8:96845620-96845642 GGCATTGTGCCTTGTGTCTGTGG - Intronic
1050027762 9:1353670-1353692 CTCAGAGACACTTGTCTCTGTGG + Intergenic
1052328975 9:27247934-27247956 CACATTGTGACTTGGCTGAGAGG + Intergenic
1056280858 9:85040145-85040167 GTCATTGTCCCTTGGCTCTGAGG + Intergenic
1056711967 9:88998701-88998723 CCCCTGGTGACTTTTCTCTGAGG - Exonic
1057475235 9:95394343-95394365 CTCATTATGTCTTGTCTCTTTGG - Intergenic
1059039805 9:110800414-110800436 GTCACAGTGACTTGTCTATGAGG + Exonic
1060423843 9:123488411-123488433 CTCATTGGGATCTGTCTCAGAGG - Intronic
1060785820 9:126450998-126451020 CCCATGGTGACTGGGCTCTGCGG + Intronic
1186280782 X:7990442-7990464 CTCACTGTGCCTTTTCACTGTGG - Intergenic
1190885551 X:54528683-54528705 ATCTTTGTGACTTGTGACTGGGG - Intergenic
1194434310 X:93851041-93851063 CTCATTCTCATTTGTCTATGTGG - Intergenic
1194869261 X:99107766-99107788 CTCTTTTGGACTTGCCTCTGGGG - Intergenic
1199639580 X:149847342-149847364 CTCATTGTGGCCTTCCTCTGTGG + Intergenic
1200863428 Y:8017167-8017189 GGCATTGTGACATATCTCTGGGG - Intergenic
1200903819 Y:8460821-8460843 GTCATTGTGACATATCTCTGGGG + Intergenic
1200921847 Y:8620285-8620307 TTCACTGAGACTTGCCTCTGGGG + Intergenic
1202255049 Y:22912329-22912351 GGCATTGTGACATATCTCTGGGG + Intergenic
1202408040 Y:24546078-24546100 GGCATTGTGACATATCTCTGGGG + Intergenic
1202462742 Y:25124003-25124025 GGCATTGTGACATATCTCTGGGG - Intergenic