ID: 1105440531

View in Genome Browser
Species Human (GRCh38)
Location 13:20412078-20412100
Sequence TGGGAGGTTTAGATGTTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105440531_1105440541 25 Left 1105440531 13:20412078-20412100 CCTCTCAACATCTAAACCTCCCA 0: 1
1: 0
2: 1
3: 10
4: 175
Right 1105440541 13:20412126-20412148 CAGCTTACCCACTTAAAGCATGG 0: 1
1: 0
2: 0
3: 9
4: 108
1105440531_1105440542 26 Left 1105440531 13:20412078-20412100 CCTCTCAACATCTAAACCTCCCA 0: 1
1: 0
2: 1
3: 10
4: 175
Right 1105440542 13:20412127-20412149 AGCTTACCCACTTAAAGCATGGG 0: 1
1: 0
2: 0
3: 2
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105440531 Original CRISPR TGGGAGGTTTAGATGTTGAG AGG (reversed) Intronic
900460045 1:2798502-2798524 TGGGAGGTTTGGAGGCTGAGAGG - Intronic
900460129 1:2798758-2798780 TGGGAGGCTTGGAGGCTGAGAGG - Intronic
900460154 1:2798838-2798860 TGGGAGGCTTGGAGGCTGAGAGG - Intronic
900460160 1:2798862-2798884 TGGGAGGCTTGGAGGCTGAGAGG - Intronic
900460194 1:2798974-2798996 TGGGAGGCTTGGAGGCTGAGAGG - Intronic
900460203 1:2799006-2799028 TGGGAGGCTTGGAGGCTGAGAGG - Intronic
900460219 1:2799054-2799076 TGGGAGGCTTGGAGGCTGAGAGG - Intronic
903489010 1:23713833-23713855 TTGGAGGTTTATATTTTAAGAGG + Intergenic
903831189 1:26176195-26176217 CGAGAGGTTGAGAGGTTGAGCGG - Intergenic
906624327 1:47312801-47312823 TGCTAGGTGTAGATGTTGTGTGG - Intronic
908527920 1:65005397-65005419 TGGGAGGGGAAGATGATGAGAGG + Intergenic
908900794 1:68954229-68954251 TGTGAGGATTAAATGTTGAAAGG + Intergenic
909693109 1:78432710-78432732 TGCAAGGTTATGATGTTGAGAGG - Intronic
913221538 1:116664527-116664549 GGGGAGGTTTGGATGTGGGGTGG - Intronic
916169230 1:161988276-161988298 GAGGAGGTTTATATGCTGAGGGG - Intronic
920002467 1:202809060-202809082 TGGGAGGTGGAGATGTTGCAGGG + Exonic
920573754 1:207039908-207039930 TGGGTGGCTGAGATGCTGAGAGG + Intronic
920851867 1:209633576-209633598 TGGGATATGTAGATGATGAGTGG - Intronic
920880984 1:209880414-209880436 TGAGAGGTTGAGCTGATGAGAGG - Intergenic
923105328 1:230849812-230849834 TGGGAAGAATAGATGTTAAGTGG - Intronic
1064520351 10:16194340-16194362 TGGGAGGTTCAGAAGATAAGAGG - Intergenic
1065548668 10:26847909-26847931 TGGGAGGCTCACATGTTGGGAGG + Intronic
1066309699 10:34184336-34184358 TGGGAGCTGAAGAGGTTGAGTGG - Intronic
1069051053 10:63794680-63794702 TGGGAGGTGGAGATGGTTAGTGG + Intergenic
1070575818 10:77678072-77678094 TGGGAGCTTGAGTTGTGGAGGGG - Intergenic
1072407687 10:95170006-95170028 TGGGAGGTTTAGCTGAAGACAGG - Intergenic
1074853895 10:117459287-117459309 TGGGAGATGTTGATGTAGAGTGG + Intergenic
1075350974 10:121725084-121725106 TGGGAGGTGTATAGGTTGTGGGG - Intergenic
1079377134 11:19903518-19903540 AGGGAGCATTAGATGTTAAGAGG - Intronic
1086701245 11:89902200-89902222 TCGAAGGTTTAAATGTTGTGTGG - Intergenic
1086704922 11:89942327-89942349 TCGAAGGTTTAAATGTTGTGTGG + Intergenic
1087688908 11:101297321-101297343 AGGGAGGCTTAGGTGGTGAGTGG + Intergenic
1091621979 12:2095806-2095828 TGGAAGGTTTAGGAGTGGAGAGG + Intronic
1097157165 12:57020955-57020977 TTGGAGGTTTGGGTGTAGAGAGG - Intronic
1099829809 12:87826999-87827021 TGAGAGATGTAGATGTAGAGAGG + Intergenic
1100694511 12:97077388-97077410 TGGAAGGTTTGAATATTGAGAGG - Intergenic
1100902561 12:99259293-99259315 TGGTATGTTTAGATGCTGAATGG + Intronic
1101618787 12:106363327-106363349 TAGCAGGTTTAGGTGTGGAGGGG - Intronic
1105440531 13:20412078-20412100 TGGGAGGTTTAGATGTTGAGAGG - Intronic
1106314052 13:28578142-28578164 ACTGAGGTTTAGATGCTGAGAGG + Intergenic
1106511707 13:30418771-30418793 TGGGAGGTGAAGATGCTGGGAGG + Intergenic
1107055659 13:36100756-36100778 TGGGAGGTTAAGAGACTGAGGGG - Intronic
1111540543 13:89662048-89662070 TGGTAGTTTGACATGTTGAGAGG - Intergenic
1112895971 13:104301247-104301269 TGGGATGTTTAAATGTGGAATGG - Intergenic
1119239837 14:73049987-73050009 TGGGAGGCTGAGATGGTGGGTGG + Intergenic
1119598582 14:75958876-75958898 TGGTAAGTTGAGATGTTGTGTGG - Exonic
1121757771 14:96417485-96417507 TGGGAGAATGAGTTGTTGAGGGG - Intronic
1121866165 14:97364665-97364687 TGGGAGGTTTTGATTTGGAAAGG + Intergenic
1126438093 15:48656401-48656423 TGGGAGTTCTAGATGTTCAGAGG + Intergenic
1130033083 15:80333400-80333422 TTGGAGGCTTAGTTGTTTAGGGG + Intergenic
1130040409 15:80401634-80401656 TGGGTTGTTTAAAGGTTGAGTGG + Intronic
1131324540 15:91429762-91429784 TGGGAGGGCTTGATCTTGAGTGG + Intergenic
1133220897 16:4318743-4318765 TGAGAGGATTAGGTGGTGAGAGG - Intronic
1133364491 16:5200053-5200075 TGGGAGGTGTTGAGGTTGTGAGG - Intergenic
1135722504 16:24829453-24829475 TGGGAGGTTTGGGGGTTGGGGGG + Intergenic
1142220322 16:88851155-88851177 TGGGGGTTTTAGATGTTCAATGG - Intronic
1143972840 17:10807948-10807970 TGGCAGGCTCAGATGTTGGGTGG + Intergenic
1144019864 17:11231036-11231058 TTGGAGCTTTGGGTGTTGAGGGG + Intergenic
1148135813 17:45290935-45290957 TGGAACGTGTAGCTGTTGAGAGG - Intronic
1149173664 17:53843936-53843958 TAGGAGCCTTAGATTTTGAGAGG + Intergenic
1150002601 17:61451385-61451407 AGGGAGGTCTAGGTGCTGAGCGG + Intergenic
1150688088 17:67336808-67336830 TTGGTGTTTTAGATGTTTAGGGG - Intergenic
1153953284 18:10075098-10075120 TGGGGGGGTTACAGGTTGAGGGG - Intergenic
1155651816 18:28152407-28152429 TGGGAGGTTAAGATATGCAGAGG + Intronic
1156593558 18:38519656-38519678 TGACAGGTAGAGATGTTGAGAGG + Intergenic
1158497569 18:57970295-57970317 TGAGTGGGTGAGATGTTGAGGGG + Intergenic
1159010819 18:63057574-63057596 TGGCAGGTTAAGATGCTGTGGGG - Intergenic
1160123710 18:76151953-76151975 TGGGATTTTTACAAGTTGAGAGG - Intergenic
1160577708 18:79866220-79866242 TGAGAGGTCTGGATGCTGAGAGG + Intronic
1160720621 19:595548-595570 TGGGTGGATGAGATGGTGAGGGG - Intronic
1163485696 19:17584131-17584153 TGGGAGGTTGAGGAGGTGAGAGG + Intergenic
1165666511 19:37634357-37634379 TGTGAAGTTGAGATGATGAGTGG + Exonic
1166354736 19:42220298-42220320 TGGGAGGTGTGGATAGTGAGGGG + Exonic
927300057 2:21501867-21501889 GGTTGGGTTTAGATGTTGAGAGG - Intergenic
929271334 2:39975533-39975555 AGGAATGTTTAGATGTTGGGTGG - Intergenic
930562758 2:52981303-52981325 TGGAACGTTTAGAAGTTGTGTGG - Intergenic
930864640 2:56110571-56110593 TGGTAGGGAGAGATGTTGAGGGG - Intergenic
931461745 2:62456069-62456091 TGGGAGGTGTAGAGGTTTATCGG + Intergenic
933568884 2:83983866-83983888 AGAGAAGCTTAGATGTTGAGAGG - Intergenic
936608987 2:113983102-113983124 TGTGGTATTTAGATGTTGAGTGG - Intergenic
937302151 2:120849375-120849397 TGGGAGGTTGAGAGGAAGAGAGG - Intronic
939513802 2:143141127-143141149 TGGCAGCTTTAGATGTGGAGAGG + Intronic
939648879 2:144737661-144737683 TGGGAGGGTAAAATGTTCAGTGG - Intergenic
942524161 2:176835452-176835474 TGGTAGGTTTATATGTTTATGGG - Intergenic
942819061 2:180089574-180089596 TGGGAGGGTCAGATGTTATGAGG + Intergenic
944683179 2:202095567-202095589 TGGAAGCTTTAGTTGTTGAAAGG - Intronic
946173743 2:217910339-217910361 TGGGATGTTTAGATGGTGCAGGG - Intronic
946895362 2:224318587-224318609 AGGGAGGTTGAGAGGTTGTGCGG - Intergenic
947011183 2:225568852-225568874 TAGGAGATATAGAGGTTGAGAGG + Intronic
947327627 2:228994965-228994987 TGGGAGAGTAAGATGTTGAGAGG - Intronic
947791258 2:232870667-232870689 AGGGATGTTTTGCTGTTGAGGGG + Intronic
948007162 2:234619025-234619047 TGGGAGGTTTTCATGTTGGCCGG - Intergenic
1170163515 20:13339764-13339786 TGCTTGGTTTAGATGATGAGAGG + Intergenic
1170400143 20:15973382-15973404 TGGGATTTTTAGTTTTTGAGTGG - Intronic
1170441775 20:16386529-16386551 TGGTAGGTTTAGTTGTAAAGGGG + Intronic
1175589383 20:60176171-60176193 TGGTAGGTGTTGAAGTTGAGTGG - Intergenic
1176172458 20:63702092-63702114 TGGGAGGGATGGATGGTGAGTGG - Intronic
1177215154 21:18118689-18118711 TGAGTTGTTTTGATGTTGAGTGG - Intronic
1183007441 22:34915180-34915202 TGGGAAGATAAGATGTGGAGAGG - Intergenic
949184002 3:1168581-1168603 TGGGAGTGTTGAATGTTGAGGGG + Intronic
953811023 3:46112960-46112982 TGGGAGGTTGAGTTCTTGATTGG + Intergenic
954542830 3:51406678-51406700 AGCCAGGTTTAGATGTAGAGGGG - Intronic
955398810 3:58576527-58576549 TGGGTGGCTTAGATCCTGAGTGG - Intronic
955491337 3:59485948-59485970 TCTGAGGTTGAGATGATGAGAGG - Intergenic
955911829 3:63864886-63864908 TGGCACGTTTAGGTGGTGAGAGG + Intronic
956059594 3:65336080-65336102 TGGGAGGTTTGGAACTGGAGTGG + Intergenic
956783384 3:72622468-72622490 TGGGGGGTGTTGATTTTGAGGGG - Intergenic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
959585059 3:108018255-108018277 TGGGAGGTTTAGGGGCTGGGAGG - Intergenic
960208693 3:114933720-114933742 TGGGAGCTGTAGATGTGTAGTGG - Intronic
961575446 3:127832156-127832178 GGGGAGGTTTTGATGGTGATGGG + Intergenic
963849579 3:150197174-150197196 TGGGAGGATTACATCTTGAAAGG - Intergenic
964415784 3:156446132-156446154 GGGAAGGTTTAGATTTTCAGTGG + Intronic
968327785 3:197835425-197835447 TGGGAGGTGGAGGTGGTGAGTGG - Intronic
969938426 4:10706257-10706279 CGGGAGGTTTAGGAGTTCAGAGG - Intergenic
970451473 4:16170519-16170541 TTGGAGGTATAGCTGTTGAATGG + Intronic
973872495 4:55180310-55180332 TGGGAGGTATACAAGTTGAATGG + Intergenic
974841681 4:67306605-67306627 TAGGATGTTTAAATGTTGAGAGG - Intergenic
975131709 4:70838806-70838828 TTGGAGATTTAGCTGTTGGGGGG - Intronic
975319454 4:72993890-72993912 TGGCAGCTTTAGAGGTTGAATGG + Intergenic
979490982 4:121327749-121327771 TGGGAGTCTTAGCTGTTGAAAGG + Intergenic
979720569 4:123895184-123895206 TGGGAGGTTTATAGGTGGAAGGG + Intergenic
984448494 4:179868605-179868627 TGAGATGTTTAGATGTTAAGAGG - Intergenic
986427120 5:7644692-7644714 AGGGAGGTTTAGAGTTTGGGTGG - Intronic
986809372 5:11339647-11339669 TAGGAGGTGGAGATGTTGGGAGG + Intronic
991240922 5:64458986-64459008 TGGCAGCTTTAAATGTTGGGTGG - Intergenic
991420037 5:66431325-66431347 GGGGAGCTTAGGATGTTGAGAGG + Intergenic
993587533 5:89748920-89748942 TGTGAGTTTTAAATGTTGTGGGG + Intergenic
995088819 5:108147440-108147462 TGGGAGGCAGAGATGGTGAGAGG + Intronic
996591913 5:125157864-125157886 TGGGAGAAATGGATGTTGAGTGG + Intergenic
996871194 5:128194833-128194855 TGGGATTTTTAAATGCTGAGAGG + Intergenic
997572139 5:134938531-134938553 TGGGAGCTTTATGTGTTGGGTGG + Intronic
1000105506 5:158055264-158055286 TGGGAGGCAAAGATGGTGAGAGG + Intergenic
1001081732 5:168672270-168672292 TGGGTGGTTCAGATGTAGGGAGG - Intronic
1004037572 6:11938720-11938742 GGGGAGGTTCAGATGTTGTCAGG - Intergenic
1005334578 6:24781515-24781537 TGGAAGTTGTAGATGTTAAGTGG - Exonic
1006598922 6:35213288-35213310 TGGTAGGTGTAAAAGTTGAGAGG + Intergenic
1007655002 6:43446523-43446545 TGGGAGGTGAAAATGTTGGGGGG - Intronic
1008166438 6:48144529-48144551 TGGCACGTTTAGAAGTTAAGAGG - Intergenic
1010570999 6:77474682-77474704 AGGGAGGTCTAGCTGTTGCGTGG + Intergenic
1010610469 6:77948704-77948726 TGGGAGGTTTGGATGTTTCCAGG - Intergenic
1011007534 6:82663829-82663851 TGGGAGAATTATATTTTGAGTGG - Intergenic
1012432710 6:99182647-99182669 TGGGACGTTTACAAGTTGTGGGG - Intergenic
1014292385 6:119573630-119573652 TTGGAGGTGAAGATGTTGGGAGG + Intergenic
1014706334 6:124751871-124751893 TGGGAAGTTGAGATGATGGGAGG + Intronic
1015099412 6:129457938-129457960 GGTGAGTTTTAGATGGTGAGGGG - Intronic
1015461269 6:133494402-133494424 TGGGAAGGGTAGTTGTTGAGGGG + Intronic
1018783544 6:167090598-167090620 ACGGCGGTTTAGTTGTTGAGTGG + Intergenic
1020208401 7:6138377-6138399 TGGGAGATTTATATTTTGAATGG + Intronic
1022360596 7:29653072-29653094 TAGGAGTTTTAAAGGTTGAGGGG + Intergenic
1022693360 7:32680441-32680463 TGGGACGTTAAGGTGTTGATGGG - Intergenic
1022942254 7:35252309-35252331 TGGCAGGTTTAGATTTAGATGGG + Intronic
1024272826 7:47655375-47655397 TGGGAGGTGTGGATGCTGGGAGG + Intronic
1027542333 7:79483052-79483074 TGAGAGGTTTAGCTTTTGAAAGG + Intergenic
1029009927 7:97248980-97249002 TGGGAGGTTGGGAAGTTAAGAGG + Intergenic
1030453794 7:109746892-109746914 AAGGAGATTTAAATGTTGAGTGG - Intergenic
1030693588 7:112559906-112559928 TGGGAAGATTAGCTGTTGAGGGG + Intergenic
1033616164 7:143016275-143016297 TGGGAGGTCGAGATGTTTGGTGG - Intergenic
1034250249 7:149684652-149684674 ACGGAGCTTTAGATTTTGAGAGG + Intergenic
1036272301 8:7317717-7317739 TGGGAGGTATAGAAGGTGAGAGG + Intergenic
1036349047 8:7992625-7992647 TGGGAGGTATAGAAGGTGAGAGG - Intergenic
1039616649 8:38959854-38959876 TGGGAGGAGGAGCTGTTGAGAGG + Intronic
1039873899 8:41569211-41569233 TGAGAGCTTTAGATGTTGGAAGG + Intergenic
1041153687 8:54962031-54962053 TGGGAAGTTTAGATGATGAGTGG - Intergenic
1041373357 8:57188276-57188298 AAGGAGATGTAGATGTTGAGGGG + Intergenic
1041641208 8:60204072-60204094 TAGGTGGTTTAAATCTTGAGTGG - Intronic
1043303530 8:78764913-78764935 TGGTAGGTTTTGAAATTGAGTGG - Intronic
1043500821 8:80853257-80853279 TGGGAGGTTGAGGTGGTGGGAGG + Intronic
1044960084 8:97521960-97521982 TGGGAGGTTGAGAGGCTGAGTGG + Intergenic
1046108810 8:109696671-109696693 TGGGAGATGGAGTTGTTGAGTGG + Intergenic
1050786218 9:9405127-9405149 TGTGAGTTTTAGATTTTGAAAGG - Intronic
1052111516 9:24590228-24590250 TTGGAAGATTAGATATTGAGAGG + Intergenic
1052748768 9:32467470-32467492 TGAAAGGTTTACATGTTGACTGG + Intronic
1054693380 9:68335877-68335899 TGGGGGCTTGAGATGTTCAGGGG + Intronic
1056345190 9:85686715-85686737 TGGGAAGTTTTGATATTGACTGG + Intronic
1057303475 9:93899617-93899639 TGGGAGACTGAGATGTGGAGAGG - Intergenic
1061536889 9:131255841-131255863 TGGGAGGTGGAGATGTTATGGGG + Intergenic
1061966469 9:134016924-134016946 TGGGAGGTCTTGAAGCTGAGGGG + Intergenic
1186707749 X:12160047-12160069 AGGTAGCTGTAGATGTTGAGGGG + Intronic
1186808493 X:13163501-13163523 TGGGAGGGTTTGATGGTTAGCGG - Intergenic
1187910852 X:24110070-24110092 TGGGAGGTTGGGAGGTTGGGAGG - Intergenic
1187910855 X:24110078-24110100 TGGGAGGTTGGGAGGTTGGGAGG - Intergenic
1187910858 X:24110086-24110108 TGGGAGGTTGGGAGGTTGGGAGG - Intergenic
1190652138 X:52577686-52577708 TGGGAGGTTCAGATGCTGCTTGG + Intergenic
1192571812 X:72212360-72212382 GAGGTGGATTAGATGTTGAGAGG - Intronic
1198868564 X:141152145-141152167 TGTGAGGTCAAGATGTTGATAGG + Intergenic
1200047442 X:153410371-153410393 TGGGCTGTTGAGATGTTGTGGGG - Intergenic