ID: 1105441218

View in Genome Browser
Species Human (GRCh38)
Location 13:20416491-20416513
Sequence GTGGCCCCTCGCACCCCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 88}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105441209_1105441218 9 Left 1105441209 13:20416459-20416481 CCCTCTCTCCAGGCTGCTGGAAG 0: 1
1: 2
2: 7
3: 51
4: 405
Right 1105441218 13:20416491-20416513 GTGGCCCCTCGCACCCCCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 88
1105441210_1105441218 8 Left 1105441210 13:20416460-20416482 CCTCTCTCCAGGCTGCTGGAAGG 0: 1
1: 1
2: 2
3: 48
4: 453
Right 1105441218 13:20416491-20416513 GTGGCCCCTCGCACCCCCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 88
1105441206_1105441218 14 Left 1105441206 13:20416454-20416476 CCCTGCCCTCTCTCCAGGCTGCT 0: 1
1: 0
2: 7
3: 87
4: 731
Right 1105441218 13:20416491-20416513 GTGGCCCCTCGCACCCCCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 88
1105441214_1105441218 1 Left 1105441214 13:20416467-20416489 CCAGGCTGCTGGAAGGCCTGGGC 0: 1
1: 0
2: 4
3: 46
4: 504
Right 1105441218 13:20416491-20416513 GTGGCCCCTCGCACCCCCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 88
1105441207_1105441218 13 Left 1105441207 13:20416455-20416477 CCTGCCCTCTCTCCAGGCTGCTG 0: 1
1: 3
2: 11
3: 106
4: 912
Right 1105441218 13:20416491-20416513 GTGGCCCCTCGCACCCCCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105441218 Original CRISPR GTGGCCCCTCGCACCCCCGT GGG Intronic
900605322 1:3521202-3521224 GTGGCCTCTCCCACCCCCATGGG - Intronic
901317627 1:8319317-8319339 GTGGCCCAAGGCAACCCCGTGGG + Intronic
903044176 1:20553356-20553378 GCGGCCCCCCGAACCCCCGGCGG - Exonic
903239637 1:21974296-21974318 GTGGACCCTCCCATGCCCGTGGG + Intergenic
913075627 1:115338489-115338511 GCGGCCCCTCAGACCCCAGTGGG - Intergenic
914855605 1:151347991-151348013 GTGGCATCCAGCACCCCCGTGGG - Intergenic
920606721 1:207396124-207396146 CTGGCCCCTACCACCTCCGTGGG - Intergenic
922472338 1:225884004-225884026 GTGGCCCCTGGACTCCCCGTTGG + Intergenic
924502880 1:244653236-244653258 GAGGCCGCTCTCACCCCCGCGGG - Exonic
1064078216 10:12287193-12287215 GTGACCCCTCACAGCCCAGTAGG - Intergenic
1064256582 10:13747679-13747701 GTGTCCCCTCGCACCCCGAGAGG + Intronic
1066421920 10:35271704-35271726 GTGGCCCCTCCAACCCCACTGGG + Intronic
1070912732 10:80132589-80132611 GAGGCCCCTCGGCACCCCGTGGG - Intronic
1075875084 10:125799502-125799524 AAGGCCCCTCGCACACCTGTGGG - Intronic
1077092944 11:787818-787840 GTGGCCCCCCCCACCCCTGGCGG - Exonic
1077317179 11:1924821-1924843 GAGGCCCCTCCCACCCTCCTGGG - Intronic
1084165176 11:67372261-67372283 GTAGCCCCTCACACCCCGGGGGG + Intronic
1104966049 12:132509270-132509292 GGGGTCCCTCCCAGCCCCGTCGG + Intronic
1105441218 13:20416491-20416513 GTGGCCCCTCGCACCCCCGTGGG + Intronic
1115019100 14:28653371-28653393 GAATCCCCTCCCACCCCCGTAGG + Intergenic
1115124158 14:29972450-29972472 GTGGCTCCTGGAACCCCAGTGGG + Intronic
1117250760 14:53935213-53935235 GTGCCCCCTCCCACCACAGTAGG + Intergenic
1117548566 14:56812119-56812141 GCGGCCCCTCGAGCCCCCGAGGG + Intergenic
1122891398 14:104733816-104733838 GTGGCCCCCCGCAACCCCACCGG + Intronic
1123148060 14:106153558-106153580 GTGGCCCCGCGCGCCCCTGCAGG + Intergenic
1123201174 14:106666013-106666035 GTGGCCCCGCGCGCCCCTGCAGG + Intergenic
1123214088 14:106790628-106790650 GTGGCCCCACGCGCCCCTGCAGG + Intergenic
1124082688 15:26516364-26516386 GTGGCCCTCCGCACACCGGTGGG + Intergenic
1128379147 15:67098805-67098827 GTGGGCCCTCAGACCCCCGCTGG - Intronic
1135752252 16:25066851-25066873 GGGGCCCCGCCCACCCCCTTCGG - Intergenic
1136220134 16:28823326-28823348 GTGGCCCGTCGGCCCCCCGGGGG + Exonic
1136993847 16:35174097-35174119 GTGTCCCCTCGCAGCCCCTCTGG - Intergenic
1138346070 16:56320994-56321016 GTGGCCCCTCTCTCTCCCATGGG - Intronic
1141567843 16:84915400-84915422 GTGGCTCCACGCAGCCCCCTGGG - Intronic
1142313789 16:89330394-89330416 GTGGCCGCTCGCACACCGGGAGG + Intronic
1143565460 17:7717756-7717778 GTTGCCCCTCGCAGCCCTCTCGG - Exonic
1150318674 17:64191390-64191412 GTGGCCCCATATACCCCCGTGGG + Intronic
1151928991 17:77219052-77219074 GAGGCCCCACGAACCCCAGTGGG + Intergenic
1155081641 18:22416107-22416129 TGGGCCCCTGGCACCTCCGTGGG - Exonic
1157573697 18:48730275-48730297 GGGGCCCCTCACACCCCAGGAGG - Intronic
1160679881 19:407771-407793 GGGGCCCCCATCACCCCCGTTGG + Exonic
1161004129 19:1925938-1925960 GTGGCCCCTCGCCGCATCGTTGG + Exonic
1161576763 19:5058674-5058696 GCGGCCCCTCGCTCACCCGCTGG + Intronic
1161772958 19:6241330-6241352 CAGGCCCCTAGCACCCCCGCTGG + Intronic
1163814322 19:19454726-19454748 GTGCCCCCCCCCACCCCCTTAGG + Intronic
1165329823 19:35135282-35135304 GTGGCCCCTCCCCCTCCTGTGGG - Intronic
1167073081 19:47231540-47231562 GTGGACCCTGGAACGCCCGTCGG - Intronic
1168553278 19:57317618-57317640 GAGGCCGCTCCCACCCCCGCGGG + Intergenic
936463215 2:112726442-112726464 GGGACCCCTCTCACCCCCTTGGG + Intronic
946389170 2:219405183-219405205 GTGGCCCCTCCCAGCCCCAAGGG + Intergenic
947546932 2:231016759-231016781 GGGGCCCCTCCCACCCCTGGAGG + Intronic
948751691 2:240136782-240136804 GGGGCCCCTCGCACCGCGGCGGG + Intronic
949003800 2:241633812-241633834 GTGTCCCCTCACACCCCCTGTGG + Exonic
949053721 2:241912489-241912511 GTGGCCCCACGCTTCCCCGAGGG + Intergenic
1175256404 20:57650353-57650375 GGGGGCCCTCCCACCCCCATGGG + Exonic
1175926280 20:62473181-62473203 GTGGCCCCTGGCATCCCCACTGG + Intronic
1180945070 22:19688310-19688332 CTGGCCCCTCGGACCCCGGCTGG + Intergenic
1182295471 22:29309384-29309406 GTGGCCCCTGCCACCCCTGAGGG + Intronic
1184086637 22:42269924-42269946 GGGGCCCCTGGCAGCCCCGGGGG - Intronic
1184510358 22:44929839-44929861 GTGGACCCTCGCATCTCTGTGGG - Intronic
1184644718 22:45889652-45889674 GGGGCCCCTCGCCCTCCCGGCGG + Intergenic
1185234398 22:49703629-49703651 GTGGCCCCTCCCTGCCCCATGGG - Intergenic
1185259311 22:49853097-49853119 GTGGCCCCGAGGTCCCCCGTTGG - Intergenic
950444413 3:13028078-13028100 GTGGCCCCTCAAAGCCCCGCAGG + Intronic
956675173 3:71725687-71725709 CCGGTCCCTCTCACCCCCGTGGG - Intronic
961459160 3:127039336-127039358 GTGGCCCGTGGCACCCCTTTGGG + Intergenic
964801601 3:160564942-160564964 CCGGCCCCTCGCACCCGCGCCGG + Intronic
967891055 3:194364898-194364920 GTGGCCCCTCCCTCCCCTGCGGG - Intronic
968471475 4:784577-784599 CTGCCCCCCAGCACCCCCGTGGG - Intergenic
968540914 4:1167940-1167962 GGGGCCCCTGGGAACCCCGTGGG + Intronic
968901622 4:3434892-3434914 GTGGCTCCTCCCAGCCCCTTTGG + Intronic
985576827 5:677491-677513 CTGGCTCCTCTCAGCCCCGTGGG - Intronic
993971852 5:94429663-94429685 GTGGCCCCTGCCACCCCCCAGGG - Intronic
995837198 5:116410690-116410712 GTGGCCCCTCTCACCAGCATTGG + Intronic
997645180 5:135477268-135477290 GGGGCCCCTCACAGCCCCCTCGG - Intergenic
999341745 5:150778964-150778986 GTGGCCCCACTCACCCCAGATGG - Exonic
1012550940 6:100464521-100464543 GCGGCGCCTCCCACCCCCGGGGG - Intronic
1036870442 8:12431689-12431711 GTTGCCCCACGGACCCCTGTTGG - Intronic
1037547738 8:19940085-19940107 GGGGCCCCTCGCTCCGCTGTGGG + Intronic
1038288007 8:26223288-26223310 CTGGTCCCTCTCACTCCCGTGGG - Intergenic
1040458883 8:47627692-47627714 CTGGCCCCCAGCACCCCCATCGG + Intronic
1049412174 8:142478292-142478314 CTGGCACTCCGCACCCCCGTAGG - Exonic
1049637655 8:143697650-143697672 CCGGCCCCTCACACCCCCATGGG - Intronic
1049828398 8:144685088-144685110 GGGTCCCCTCACACCCCCCTCGG + Intergenic
1060661616 9:125408235-125408257 GTGGCCGTTCCCACCGCCGTCGG + Intergenic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1185633681 X:1535995-1536017 GTGGCCCCTCGTCACCCCCTCGG - Intronic
1185647169 X:1624063-1624085 GGGGCGGCTAGCACCCCCGTCGG - Intronic
1196983327 X:121239802-121239824 GTGGCCCCTGGCACCACAGGTGG + Intergenic
1197015465 X:121620810-121620832 CTGGCCCCTCCCACCAACGTGGG + Intergenic