ID: 1105443746

View in Genome Browser
Species Human (GRCh38)
Location 13:20435677-20435699
Sequence ATACAACGGCAGCGCAGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 27}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1105443741_1105443746 -3 Left 1105443741 13:20435657-20435679 CCCCCGAAAGGGTTCGACAGATA 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1105443746 13:20435677-20435699 ATACAACGGCAGCGCAGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 27
1105443743_1105443746 -5 Left 1105443743 13:20435659-20435681 CCCGAAAGGGTTCGACAGATACA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1105443746 13:20435677-20435699 ATACAACGGCAGCGCAGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 27
1105443742_1105443746 -4 Left 1105443742 13:20435658-20435680 CCCCGAAAGGGTTCGACAGATAC 0: 1
1: 0
2: 0
3: 0
4: 22
Right 1105443746 13:20435677-20435699 ATACAACGGCAGCGCAGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 27
1105443744_1105443746 -6 Left 1105443744 13:20435660-20435682 CCGAAAGGGTTCGACAGATACAA 0: 1
1: 0
2: 1
3: 33
4: 420
Right 1105443746 13:20435677-20435699 ATACAACGGCAGCGCAGCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1105443746 Original CRISPR ATACAACGGCAGCGCAGCGC AGG Intronic
1095875985 12:47080111-47080133 CTAGAACGGCCGCGCAGAGCGGG + Intronic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1105443746 13:20435677-20435699 ATACAACGGCAGCGCAGCGCAGG + Intronic
1107091993 13:36491659-36491681 AGACAAGGGCAGGGCAGGGCAGG + Intergenic
1109152106 13:58859028-58859050 ATTCCAGCGCAGCGCAGCGCTGG + Intergenic
1117157052 14:52951321-52951343 ATAAAAGGGCAGCGCTCCGCGGG - Intronic
1122783729 14:104154533-104154555 CTGCAACGGCAGCGCTGCCCCGG - Intronic
1123016803 14:105379616-105379638 ATCCAACGGCAGAGCAGAGCTGG - Intronic
1140799236 16:78470159-78470181 AGACAACAGCAGGGCAGTGCTGG - Intronic
932315722 2:70780845-70780867 ATACAGAGGCAGCCCAGCGCAGG + Intronic
932625511 2:73293134-73293156 AGACGACGACGGCGCAGCGCGGG - Intronic
937543704 2:122989368-122989390 GTTCAACGGCAGCTCAGCACTGG + Intergenic
938042976 2:128091302-128091324 AGACAACGCCAGGGCAGGGCGGG - Exonic
946471779 2:219967191-219967213 ATACAAAGGCAGCGGAGGACTGG - Intergenic
1173165825 20:40686763-40686785 GTACAAGGGCAGGGCAGGGCAGG - Exonic
1177356332 21:20012704-20012726 ATACCACTGCAGCCCAGCGTAGG + Intergenic
1177922665 21:27172002-27172024 TTACAAGGGCAGGGCAGGGCAGG + Intergenic
968372841 4:11368-11390 AAAAAATGGCGGCGCAGCGCAGG + Intergenic
985462555 4:190121199-190121221 AAAAAATGGCGGCGCAGCGCAGG - Intergenic
987224626 5:15827142-15827164 ACACAAAGGCAGAGCAGAGCAGG - Intronic
988993460 5:36693047-36693069 ACAAAACGGCCACGCAGCGCGGG - Intergenic
990782951 5:59386665-59386687 AAAGAAGGGCAGGGCAGCGCAGG + Intronic
1001638704 5:173230656-173230678 ATACAAGGGCAGTGGAGTGCAGG - Intergenic
1005383025 6:25256636-25256658 ATACCACTGCAGCCCAGCCCAGG + Intergenic
1006312705 6:33272146-33272168 ATCCAGCGGCATCGCAGCTCGGG + Intronic
1035792175 8:2317136-2317158 AGAGCACAGCAGCGCAGCGCAGG - Intergenic
1035800630 8:2404569-2404591 AGAGCACAGCAGCGCAGCGCAGG + Intergenic
1049743091 8:144250310-144250332 ACACCACGGCTGCGCAGTGCTGG - Exonic
1061534342 9:131238484-131238506 CTACAACGGCAGCCCGGCGGGGG + Intergenic
1061973679 9:134057815-134057837 ACACAAAGGCAGCCCAGGGCAGG + Intronic